>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 44      cgcatgcctgctcctcgtcg 63
               ||||||||||||||||||||
Sbjct: 3584729 cgcatgcctgctcctcgtcg 3584748

>emb|CR792458.6| Zebrafish DNA sequence from clone RP71-47I2, complete sequence
          Length = 186632

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    cttcccggcttggccttgc 35
             |||||||||||||||||||
Sbjct: 65818 cttcccggcttggccttgc 65836

>gb|AC117944.2| Homo sapiens chromosome 1 clone RP4-653E17, complete sequence
          Length = 55673

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 2     aattaatcccaacaccttc 20
             |||||||||||||||||||
Sbjct: 35123 aattaatcccaacaccttc 35105

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 49      gcctgctcctcgtcgatca 67
               |||||||||||||||||||
Sbjct: 1339406 gcctgctcctcgtcgatca 1339388

>dbj|AK052327.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:D330028P16 product:POTASSIUM CHANNEL
            SUBFAMILY K MEMBER 10 (OUTWARD RECTIFYING POTASSIUM
            CHANNEL PROTEIN TREK-2) (TREK-2 K+ CHANNEL SUBUNIT)
            homolog [Rattus norvegicus], full insert sequence
          Length = 2670

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 64   atcagcctcccaaacccta 82
            |||||||||||||||||||
Sbjct: 2069 atcagcctcccaaacccta 2051

>gb|AC009376.7| Drosophila melanogaster 3 BAC RPCI98-1D4 (Roswell Park Cancer Institute
              Human PAC library) complete sequence
          Length = 183948

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 25     cttggccttgcttagattc 43
              |||||||||||||||||||
Sbjct: 147566 cttggccttgcttagattc 147584

>gb|AE003516.4| Drosophila melanogaster chromosome 3L, section 69 of 83 of the complete
             sequence
          Length = 305312

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 25    cttggccttgcttagattc 43
             |||||||||||||||||||
Sbjct: 23988 cttggccttgcttagattc 23970

>gb|AC134249.4| Mus musculus BAC clone RP23-359K17 from 12, complete sequence
          Length = 190423

 Score = 38.2 bits (19), Expect = 4.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 64     atcagcctcccaaacccta 82
              |||||||||||||||||||
Sbjct: 121395 atcagcctcccaaacccta 121413


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,343,780
Number of Sequences: 3902068
Number of extensions: 1343780
Number of successful extensions: 339349
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 339195
Number of HSP's gapped (non-prelim): 154
length of query: 104
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 83
effective length of database: 17,151,101,840
effective search space: 1423541452720
effective search space used: 1423541452720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)