>gb|AC154393.8| Mus musculus chromosome 1, clone RP23-64O1, complete sequence
          Length = 253733

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 108    atgaatgcaggtgctaacagtg 129
              ||||||||||||||||||||||
Sbjct: 106721 atgaatgcaggtgctaacagtg 106742

>dbj|AK156597.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830032B15 product:unclassifiable, full
           insert sequence
          Length = 1124

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 108 atgaatgcaggtgctaacagtg 129
           ||||||||||||||||||||||
Sbjct: 222 atgaatgcaggtgctaacagtg 243

>gb|DP000008.1| Bos taurus target 1 genomic scaffold
          Length = 2072671

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 165     gtcaatgcagaggtttctgaa 185
               |||||||||||||||||||||
Sbjct: 1872326 gtcaatgcagaggtttctgaa 1872306

>gb|AC156367.3| Bos taurus clone RP42-394P24, complete sequence
          Length = 78774

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 165   gtcaatgcagaggtttctgaa 185
             |||||||||||||||||||||
Sbjct: 46342 gtcaatgcagaggtttctgaa 46322

>gb|AC146430.4| Pan troglodytes BAC clone RP43-21F8 from 7, complete sequence
          Length = 179251

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    attcccattccccagatgag 68
             ||||||||||||||||||||
Sbjct: 71314 attcccattccccagatgag 71333



 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    attcccattccccagatgag 68
             ||||||||||||||||||||
Sbjct: 71276 attcccattccccagatgag 71295

>gb|AC145592.3| Mus musculus BAC clone RP24-335F16 from chromosome y, complete sequence
          Length = 167384

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     cattgggcaccccaagctca 20
             ||||||||||||||||||||
Sbjct: 45211 cattgggcaccccaagctca 45192

>gb|AC125518.3| Mus musculus BAC clone RP24-267E6 from chromosome 1, complete sequence
          Length = 174190

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 54    cattccccagatgagatcct 73
             ||||||||||||||||||||
Sbjct: 94345 cattccccagatgagatcct 94326

>gb|AC007269.3| Homo sapiens PAC clone RP5-1058P19 from 7, complete sequence
          Length = 93011

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    attcccattccccagatgag 68
             ||||||||||||||||||||
Sbjct: 46270 attcccattccccagatgag 46251



 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    attcccattccccagatgag 68
             ||||||||||||||||||||
Sbjct: 46232 attcccattccccagatgag 46213

>gb|AC092171.4| Homo sapiens BAC clone RP11-1275H24 from 7, complete sequence
          Length = 85132

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 45    gatcattcccattccccagatgag 68
             ||||||||||||| ||||||||||
Sbjct: 76774 gatcattcccatttcccagatgag 76751

>dbj|AK208405.1| Mus musculus cDNA, clone:Y2G0111C09, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000032934, based on BLAT search
          Length = 390

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 131 tagcatggaggttgatggat 150
           ||||||||||||||||||||
Sbjct: 195 tagcatggaggttgatggat 176

>gb|AC011465.4|AC011465 Homo sapiens chromosome 19 clone CTC-450M9, complete sequence
          Length = 156997

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    tcattcccattccccagatg 66
             ||||||||||||||||||||
Sbjct: 65407 tcattcccattccccagatg 65388

>gb|AC145393.4| Mus musculus BAC clone RP24-208N6 from Y, complete sequence
          Length = 167299

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 1      cattgggcaccccaagctca 20
              ||||||||||||||||||||
Sbjct: 146495 cattgggcaccccaagctca 146476

>gb|AY067528.1| Schmidtea mediterranea clone H.107.4h unknown mRNA sequence
          Length = 648

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 141 gttgatggatcagttgttaa 160
           ||||||||||||||||||||
Sbjct: 156 gttgatggatcagttgttaa 175


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,190,365
Number of Sequences: 3902068
Number of extensions: 2190365
Number of successful extensions: 40658
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40611
Number of HSP's gapped (non-prelim): 47
length of query: 260
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 238
effective length of database: 17,147,199,772
effective search space: 4081033545736
effective search space used: 4081033545736
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)