ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl11b08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF320254.1|AF320254 Azoarcus evansii aerobic 2-aminobenzoate ... 46 0.061
2emb|AL121956.21|HSDJ655C5 Human DNA sequence from clone RP4-655C... 42 0.95
3ref|NM_175922.3| Homo sapiens hypothetical protein MGC35308 (MGC... 42 0.95
4gb|BC034775.1| Homo sapiens hypothetical protein MGC35308, mRNA ... 42 0.95
5emb|BX572604.1| Rhodopseudomonas palustris CGA009 complete genom... 40 3.8
6emb|AL939111.1|SCO939111 Streptomyces coelicolor A3(2) complete ... 40 3.8
7ref|XM_565549.1| Anopheles gambiae str. PEST ENSANGP00000027339 ... 40 3.8
8ref|XM_307920.2| Anopheles gambiae str. PEST ENSANGP00000021695 ... 40 3.8

>gb|AF320254.1|AF320254 Azoarcus evansii aerobic 2-aminobenzoate metabolism type II operon,
            complete sequence
          Length = 11010

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 185  ccgccaccgcccgcccctcgacc 207
            |||||||||||||||||||||||
Sbjct: 6366 ccgccaccgcccgcccctcgacc 6388



to top

>emb|AL121956.21|HSDJ655C5 Human DNA sequence from clone RP4-655C5 on chromosome 6 Contains a
             pseudogene similar to heterogeneous nuclear
             ribonuclearprotein A, novel protein similar to RIKEN cDNA
             5630401J11 (pRGR1) (MGC19825), a guanine nucleotide
             binding protein (G protein), gamma 5 pseudogene (GCG5), a
             novel gene and 3 CpG islands, complete sequence
          Length = 119733

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 177   cgcccatgccgccaccgcccgcccc 201
             ||||||||||||| |||||||||||
Sbjct: 32181 cgcccatgccgccgccgcccgcccc 32205



to top

>ref|NM_175922.3| Homo sapiens hypothetical protein MGC35308 (MGC35308), mRNA
          Length = 2704

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 177 cgcccatgccgccaccgcccgcccc 201
           ||||||||||||| |||||||||||
Sbjct: 252 cgcccatgccgccgccgcccgcccc 276



to top

>gb|BC034775.1| Homo sapiens hypothetical protein MGC35308, mRNA (cDNA clone
           MGC:35308 IMAGE:5177440), complete cds
          Length = 2174

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 177 cgcccatgccgccaccgcccgcccc 201
           ||||||||||||| |||||||||||
Sbjct: 252 cgcccatgccgccgccgcccgcccc 276



to top

>emb|BX572604.1| Rhodopseudomonas palustris CGA009 complete genome; segment 12/16
          Length = 348068

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   cgccaccgcccgcccctcga 205
             ||||||||||||||||||||
Sbjct: 58617 cgccaccgcccgcccctcga 58636



to top

>emb|AL939111.1|SCO939111 Streptomyces coelicolor A3(2) complete genome; segment 8/29
          Length = 321250

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 184   gccgccaccgcccgcccctc 203
             ||||||||||||||||||||
Sbjct: 15397 gccgccaccgcccgcccctc 15378



to top

>ref|XM_565549.1| Anopheles gambiae str. PEST ENSANGP00000027339 (ENSANGG00000019206),
            partial mRNA
          Length = 2280

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 7    tcccttccttcagcaccacc 26
            ||||||||||||||||||||
Sbjct: 1738 tcccttccttcagcaccacc 1719



to top

>ref|XM_307920.2| Anopheles gambiae str. PEST ENSANGP00000021695 (ENSANGG00000019206),
            partial mRNA
          Length = 2790

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 7    tcccttccttcagcaccacc 26
            ||||||||||||||||||||
Sbjct: 2092 tcccttccttcagcaccacc 2073


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,654,367
Number of Sequences: 3902068
Number of extensions: 1654367
Number of successful extensions: 34170
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34157
Number of HSP's gapped (non-prelim): 13
length of query: 287
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 265
effective length of database: 17,147,199,772
effective search space: 4544007939580
effective search space used: 4544007939580
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top