>gb|BC036978.1| Mus musculus kelch-like 15 (Drosophila), transcript variant 4, mRNA
           (cDNA clone IMAGE:4947611), complete cds
          Length = 1238

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 83  tcgggcgccgggatggaccgcga 105
           |||||||||||||||||||||||
Sbjct: 254 tcgggcgccgggatggaccgcga 232

>dbj|AK169500.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630052D17 product:hypothetical
           BTB/POZ/BTB domain profile containing protein, full
           insert sequence
          Length = 3945

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 83  tcgggcgccgggatggaccgcga 105
           |||||||||||||||||||||||
Sbjct: 260 tcgggcgccgggatggaccgcga 238

>dbj|AK078112.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330500C13 product:weakly
           similar to CDNA FLJ32736 FIS, CLONE TESTI2001237, WEAKLY
           SIMILAR TO RING CANAL PROTEIN [Homo sapiens], full
           insert sequence
          Length = 1581

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 83  tcgggcgccgggatggaccgcga 105
           |||||||||||||||||||||||
Sbjct: 353 tcgggcgccgggatggaccgcga 331

>dbj|AK081546.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130036K12 product:CDNA FLJ32736 FIS,
           CLONE TESTI2001237, WEAKLY SIMILAR TO RING CANAL PROTEIN
           homolog [Homo sapiens], full insert sequence
          Length = 1236

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 83  tcgggcgccgggatggaccgcga 105
           |||||||||||||||||||||||
Sbjct: 321 tcgggcgccgggatggaccgcga 299

>dbj|AK030432.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
           enriched library, clone:5330411I24
           product:unclassifiable, full insert sequence
          Length = 3334

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 83  tcgggcgccgggatggaccgcga 105
           |||||||||||||||||||||||
Sbjct: 353 tcgggcgccgggatggaccgcga 331

>ref|NM_001039060.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript
           variant 2, mRNA
          Length = 4001

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 83  tcgggcgccgggatggaccgcga 105
           |||||||||||||||||||||||
Sbjct: 317 tcgggcgccgggatggaccgcga 295

>ref|NM_001039059.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript
           variant 3, mRNA
          Length = 3137

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 83  tcgggcgccgggatggaccgcga 105
           |||||||||||||||||||||||
Sbjct: 317 tcgggcgccgggatggaccgcga 295

>ref|NM_001039061.1| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript
           variant 1, mRNA
          Length = 2363

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 83  tcgggcgccgggatggaccgcga 105
           |||||||||||||||||||||||
Sbjct: 412 tcgggcgccgggatggaccgcga 390

>ref|NM_153165.2| Mus musculus kelch-like 15 (Drosophila) (Klhl15), transcript
           variant 4, mRNA
          Length = 3188

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 83  tcgggcgccgggatggaccgcga 105
           |||||||||||||||||||||||
Sbjct: 317 tcgggcgccgggatggaccgcga 295

>emb|AL646049.14| Mouse DNA sequence from clone RP23-63A9 on chromosome X, complete
             sequence
          Length = 146105

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 83    tcgggcgccgggatggaccgcga 105
             |||||||||||||||||||||||
Sbjct: 27624 tcgggcgccgggatggaccgcga 27602

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 61      attctccgtccgtcacgggc 80
               ||||||||||||||||||||
Sbjct: 4134240 attctccgtccgtcacgggc 4134259

>gb|DQ249342.1| Streptomyces hygroscopicus subsp. duamyceticus strain JCM4427 unknown
             polyketide biosynthetic gene cluster, partial sequence;
             and AHBA biosynthesis gene cluster, complete sequence
          Length = 55488

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    tgccgatgcagatccgtca 31
             |||||||||||||||||||
Sbjct: 54230 tgccgatgcagatccgtca 54212

>gb|AF250324.1|AF250324 Homo sapiens chromosome 4q35 BAC clones RPCI-11-463J17 and
              RPCI-6-92G13RCB2, complete sequence
          Length = 245708

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 18     atgcagatccgtcacagcc 36
              |||||||||||||||||||
Sbjct: 123319 atgcagatccgtcacagcc 123337


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 366,123
Number of Sequences: 3902068
Number of extensions: 366123
Number of successful extensions: 23523
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 23488
Number of HSP's gapped (non-prelim): 35
length of query: 109
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 88
effective length of database: 17,151,101,840
effective search space: 1509296961920
effective search space used: 1509296961920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)