>dbj|AP005645.1| Streptomyces avermitilis MA-4680 plasmid SAP1 DNA, complete sequence
          Length = 94287

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 73   gcccgcagcgcgcagccgaa 92
            ||||||||||||||||||||
Sbjct: 2914 gcccgcagcgcgcagccgaa 2895

>emb|AL606480.11| Mouse DNA sequence from clone RP23-112C19 on chromosome 11 Contains the
             3' end of the Col1a1 gene for procollagen type I alpha 1,
             the Sgca gene for alpha sarcoglycan (dystrophin-associated
             glycoprotein), the Hils1 gene for histone H1-like protein
             in spermatids 1, the Ppp1r9b gene for protein phosphatase
             1 regulatory subunit 9B, a novel gene (A930041A10Rik,
             B930032I08Rik, C530046K03Rik), the Pdk2 gene for pyruvate
             dehydrogenase kinase isoenzyme 2, a novel gene, the Itga3
             gene for integrin alpha 3, the Dlx3 gene for distal-less
             homeobox 3 and three CpG islands, complete sequence
          Length = 186276

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 50    acacacacacagagccgac 68
             |||||||||||||||||||
Sbjct: 65237 acacacacacagagccgac 65219

>dbj|AB168308.1| Macaca fascicularis testis cDNA clone: QtsA-11109, similar to human
           trophoblast glycoprotein (TPBG), mRNA, RefSeq:
           NM_006670.3
          Length = 2714

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 73  gcccgcagcgcgcagccga 91
           |||||||||||||||||||
Sbjct: 423 gcccgcagcgcgcagccga 441


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 10,549,895
Number of Sequences: 3902068
Number of extensions: 10549895
Number of successful extensions: 187127
Number of sequences better than 10.0: 3
Number of HSP's better than 10.0 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 187120
Number of HSP's gapped (non-prelim): 7
length of query: 111
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 90
effective length of database: 17,151,101,840
effective search space: 1543599165600
effective search space used: 1543599165600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)