>gb|U56406.1|HVU56406 Hordeum vulgare methyljasmonate-inducible lipoxygenase 2 mRNA,
           complete cds
          Length = 3054

 Score =  232 bits (117), Expect = 2e-58
 Identities = 117/117 (100%)
 Strand = Plus / Plus

                                                                       
Query: 28  tgccagggcagggttgcacagtctagctaggtcgaaaccaaccaagacggtgcaaccttc 87
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   tgccagggcagggttgcacagtctagctaggtcgaaaccaaccaagacggtgcaaccttc 60

                                                                    
Query: 88  cgccccatcgcgtagcgcaatagccaacaccgtagcgtacccacgatgctgacggcg 144
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  cgccccatcgcgtagcgcaatagccaacaccgtagcgtacccacgatgctgacggcg 117

>gb|AC146383.4| Pan troglodytes BAC clone RP43-125D18 from 7, complete sequence
          Length = 141329

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 13    cttcctttcctgatctgccagggc 36
             |||||||||||||| |||||||||
Sbjct: 31172 cttcctttcctgatgtgccagggc 31149

>gb|AC006960.1|AC006960 Homo sapiens clone RP11-182J23 from 7p14-15, complete sequence
          Length = 179757

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 13     cttcctttcctgatctgccagggc 36
              |||||||||||||| |||||||||
Sbjct: 137738 cttcctttcctgatgtgccagggc 137761

>emb|AL356579.24| Human DNA sequence from clone RP11-593A16 on chromosome 6 Contains the 5'
              end of the gene for KIAA1798 protein and a CpG island,
              complete sequence
          Length = 172816

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 104    gcaatagccaacaccgtag 122
              |||||||||||||||||||
Sbjct: 115643 gcaatagccaacaccgtag 115661

>emb|AL356275.20| Human DNA sequence from clone RP11-328D5 on chromosome 1 Contains the
             5' end of a novel gene, a novel gene, the CD34 gene for
             CD34 antigen and the 3' end of the PLXNA2 gene for plexin
             A2, complete sequence
          Length = 198906

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 42    tgcacagtctagctaggtc 60
             |||||||||||||||||||
Sbjct: 25906 tgcacagtctagctaggtc 25924

>gb|AC151284.3| Mus musculus BAC clone RP23-391C14 from chromosome 17, complete
             sequence
          Length = 202363

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 22    ctgatctgccagggcaggg 40
             |||||||||||||||||||
Sbjct: 46534 ctgatctgccagggcaggg 46516

>gb|AC084393.20| Homo sapiens 12q BAC RP11-453E3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 182489

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 42     tgcacagtctagctaggtc 60
              |||||||||||||||||||
Sbjct: 138866 tgcacagtctagctaggtc 138884

>gb|AC022101.4| Homo sapiens chromosome 5 clone CTC-210G5, complete sequence
          Length = 173691

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 14    ttcctttcctgatctgcca 32
             |||||||||||||||||||
Sbjct: 20046 ttcctttcctgatctgcca 20064

>gb|AC155301.2| Mus musculus BAC clone RP24-216J21 from chromosome 13, complete sequence
          Length = 192299

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 7      tcacctcttcctttcctga 25
              |||||||||||||||||||
Sbjct: 139589 tcacctcttcctttcctga 139607

>gb|AC016722.9| Homo sapiens BAC clone RP11-333I13 from 2, complete sequence
          Length = 149995

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 16    cctttcctgatctgccagggcag 38
             ||||||||| |||||||||||||
Sbjct: 88690 cctttcctgctctgccagggcag 88712

>gb|AF167304.1|AF167301S4 Homo sapiens synuclein alpha interacting protein (SNCAIP) gene,
           exon 5
          Length = 4861

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 14  ttcctttcctgatctgcca 32
           |||||||||||||||||||
Sbjct: 548 ttcctttcctgatctgcca 566

>gb|AY095345.1| Papio anubis insulin-like growth factor binding protein-1 (IGFBP-1)
           gene, partial cds
          Length = 3886

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 22  ctgatctgccagggcagggttgc 44
           |||| ||||||||||||||||||
Sbjct: 443 ctgacctgccagggcagggttgc 465

>gb|AC151264.2| Mus musculus BAC clone RP24-347M6 from 17, complete sequence
          Length = 153677

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     ctgatctgccagggcaggg 40
              |||||||||||||||||||
Sbjct: 120690 ctgatctgccagggcaggg 120672

>gb|AC117480.9| Homo sapiens 3 BAC RP11-491D10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 115257

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 4     acatcacctcttcctttcctgat 26
             |||||||||||||| ||||||||
Sbjct: 27792 acatcacctcttccattcctgat 27814

>emb|CT010471.11| Mouse DNA sequence from clone RP23-20A5 on chromosome 13, complete
              sequence
          Length = 219145

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 7      tcacctcttcctttcctga 25
              |||||||||||||||||||
Sbjct: 106322 tcacctcttcctttcctga 106340

>emb|AL035091.2|HS88L2 Human DNA sequence from clone XX-D88L2 on chromosome 1q32.2-32.3,
             complete sequence
          Length = 160771

 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 42    tgcacagtctagctaggtc 60
             |||||||||||||||||||
Sbjct: 24021 tgcacagtctagctaggtc 24039


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 879,229
Number of Sequences: 3902068
Number of extensions: 879229
Number of successful extensions: 61333
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61308
Number of HSP's gapped (non-prelim): 25
length of query: 144
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 123
effective length of database: 17,151,101,840
effective search space: 2109585526320
effective search space used: 2109585526320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)