Clone Name | bastl10f09 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... | 46 | 0.067 | 2 | gb|AC106461.6| Rattus norvegicus 1 BAC CH230-208N10 (Children's ... | 42 | 1.0 | 3 | gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome | 42 | 1.0 |
---|
>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence Length = 3288558 Score = 46.1 bits (23), Expect = 0.067 Identities = 23/23 (100%) Strand = Plus / Plus Query: 143 tcaagcagcgcttttaaacgcgc 165 ||||||||||||||||||||||| Sbjct: 2331467 tcaagcagcgcttttaaacgcgc 2331489
>gb|AC106461.6| Rattus norvegicus 1 BAC CH230-208N10 (Children's Hospital Oakland Research Institute) complete sequence Length = 212829 Score = 42.1 bits (21), Expect = 1.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 81 ctcccgccccatccctcttcttccc 105 ||||| ||||||||||||||||||| Sbjct: 79561 ctccctccccatccctcttcttccc 79585
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 42.1 bits (21), Expect = 1.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 197 ccgccgagccgctggtcgcgccgcc 221 |||||||||||||||| |||||||| Sbjct: 3753281 ccgccgagccgctggtggcgccgcc 3753257 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,625,790 Number of Sequences: 3902068 Number of extensions: 1625790 Number of successful extensions: 34472 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 34417 Number of HSP's gapped (non-prelim): 55 length of query: 314 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 292 effective length of database: 17,147,199,772 effective search space: 5006982333424 effective search space used: 5006982333424 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)