ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl10e09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 60 2e-06
2dbj|AK098921.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 2e-06
3dbj|AK068713.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 2e-06
4dbj|AK067777.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 2e-06
5emb|AL731599.2|OSJN00244 Oryza sativa genomic DNA, chromosome 4,... 46 0.031
6emb|CR647832.2|CNS0EYU6 Tetraodon nigroviridis full-length cDNA 40 1.9
7ref|NM_112671.3| Arabidopsis thaliana unknown protein AT3G17900 ... 38 7.7
8ref|XM_367013.1| Magnaporthe grisea 70-15 chromosome VII hypothe... 38 7.7
9ref|XM_656748.1| Aspergillus nidulans FGSC A4 hypothetical prote... 38 7.7
10ref|XM_745273.1| Aspergillus fumigatus Af293 proteasome regulato... 38 7.7
11gb|AE004250.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 38 7.7
12dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 38 7.7
13gb|AF361586.1| Arabidopsis thaliana AT3g17900/MEB5_12 mRNA, comp... 38 7.7
14gb|DQ399904.1| Nocardiopsis sp. 90127 plasmid pSQ10, complete se... 38 7.7
15emb|BX824719.1|CNS0A4QF Arabidopsis thaliana Full-length cDNA Co... 38 7.7
16gb|AC073592.11| Homo sapiens 12 BAC RP11-83B20 (Roswell Park Can... 38 7.7
17dbj|AB019230.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 38 7.7
18gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome 38 7.7

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                            
Query: 66       gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcggaggagcct 125
                ||||||||||  ||| ||||| ||||| || || || |||||||||||| |||||| |||
Sbjct: 19187329 gaaaatggggtggtttcgggctgcgtccggattggctcgggtggcgctgaggaggaacct 19187388

                                              
Query: 126      gtcgcgcgctccggcgagcccgttcgccgg 155
                | |||| |||||||||| ||| || |||||
Sbjct: 19187389 ggcgcgtgctccggcgaacccttttgccgg 19187418



to top

>dbj|AK098921.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002N21, full
           insert sequence
          Length = 3612

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 66  gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcggaggagcct 125
           ||||||||||  ||| ||||| ||||| || || || |||||||||||| |||||| |||
Sbjct: 271 gaaaatggggtggtttcgggctgcgtccggattggctcgggtggcgctgaggaggaacct 330

                                         
Query: 126 gtcgcgcgctccggcgagcccgttcgccgg 155
           | |||| |||||||||| ||| || |||||
Sbjct: 331 ggcgcgtgctccggcgaacccttttgccgg 360



to top

>dbj|AK068713.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013161L21, full
           insert sequence
          Length = 2576

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 66  gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcggaggagcct 125
           ||||||||||  ||| ||||| ||||| || || || |||||||||||| |||||| |||
Sbjct: 261 gaaaatggggtggtttcgggctgcgtccggattggctcgggtggcgctgaggaggaacct 320

                                         
Query: 126 gtcgcgcgctccggcgagcccgttcgccgg 155
           | |||| |||||||||| ||| || |||||
Sbjct: 321 ggcgcgtgctccggcgaacccttttgccgg 350



to top

>dbj|AK067777.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116O03, full
           insert sequence
          Length = 3581

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 66  gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcggaggagcct 125
           ||||||||||  ||| ||||| ||||| || || || |||||||||||| |||||| |||
Sbjct: 317 gaaaatggggtggtttcgggctgcgtcaggattggctcgggtggcgctgaggaggaacct 376

                                         
Query: 126 gtcgcgcgctccggcgagcccgttcgccgg 155
           | |||| |||||||||| ||| || |||||
Sbjct: 377 ggcgcgtgctccggcgaacccttttgccgg 406



to top

>emb|AL731599.2|OSJN00244 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0053B21,
              complete sequence
          Length = 151936

 Score = 46.1 bits (23), Expect = 0.031
 Identities = 75/91 (82%), Gaps = 1/91 (1%)
 Strand = Plus / Plus

                                                                          
Query: 66     gaaaatggggctgttccgggccgcgtcgggtttagcccgggtggcgctgcg-gaggagcc 124
              ||||||||||  ||| ||||| ||||| || || || |||||||||||| | ||||| ||
Sbjct: 120850 gaaaatggggtggtttcgggctgcgtccggattggctcgggtggcgctgagtgaggaacc 120909

                                             
Query: 125    tgtcgcgcgctccggcgagcccgttcgccgg 155
              || |||| |||||||||| ||| || |||||
Sbjct: 120910 tggcgcgtgctccggcgaacccttttgccgg 120940



to top

>emb|CR647832.2|CNS0EYU6 Tetraodon nigroviridis full-length cDNA
          Length = 1651

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 94   ggtttagcccgggtggcgct 113
            ||||||||||||||||||||
Sbjct: 1111 ggtttagcccgggtggcgct 1130



to top

>ref|NM_112671.3| Arabidopsis thaliana unknown protein AT3G17900 mRNA, complete cds
          Length = 3034

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 56  aattcgatctgaaaatggg 74
           |||||||||||||||||||
Sbjct: 162 aattcgatctgaaaatggg 144



to top

>ref|XM_367013.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
           (MG03089.4) partial mRNA
          Length = 849

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 109 gcgctgcggaggagcctgt 127
           |||||||||||||||||||
Sbjct: 109 gcgctgcggaggagcctgt 91



to top

>ref|XM_656748.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4236.2), mRNA
          Length = 1398

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 47   gggagagggaattcgatct 65
            |||||||||||||||||||
Sbjct: 1145 gggagagggaattcgatct 1127



to top

>ref|XM_745273.1| Aspergillus fumigatus Af293 proteasome regulatory particle subunit
            Rpt5 (Afu1g06170) partial mRNA
          Length = 1395

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 47   gggagagggaattcgatct 65
            |||||||||||||||||||
Sbjct: 1142 gggagagggaattcgatct 1124



to top

>gb|AE004250.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 158
            of 251 of the complete chromosome
          Length = 10146

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 121  agcctgtcgcgcgctccgg 139
            |||||||||||||||||||
Sbjct: 7560 agcctgtcgcgcgctccgg 7578



to top

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 16      ttctcttttttccgcggct 34
               |||||||||||||||||||
Sbjct: 2299597 ttctcttttttccgcggct 2299579



to top

>gb|AF361586.1| Arabidopsis thaliana AT3g17900/MEB5_12 mRNA, complete cds
          Length = 3008

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 56  aattcgatctgaaaatggg 74
           |||||||||||||||||||
Sbjct: 136 aattcgatctgaaaatggg 118



to top

>gb|DQ399904.1| Nocardiopsis sp. 90127 plasmid pSQ10, complete sequence
          Length = 18219

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 72   ggggctgttccgggccgcg 90
            |||||||||||||||||||
Sbjct: 2875 ggggctgttccgggccgcg 2857



to top

>emb|BX824719.1|CNS0A4QF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH67ZG04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 3007

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 56  aattcgatctgaaaatggg 74
           |||||||||||||||||||
Sbjct: 163 aattcgatctgaaaatggg 145



to top

>gb|AC073592.11| Homo sapiens 12 BAC RP11-83B20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 161127

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 122   gcctgtcgcgcgctccggc 140
             |||||||||||||||||||
Sbjct: 69081 gcctgtcgcgcgctccggc 69063



to top

>dbj|AB019230.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEB5
          Length = 74968

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 56    aattcgatctgaaaatggg 74
             |||||||||||||||||||
Sbjct: 39248 aattcgatctgaaaatggg 39230



to top

>gb|CP000103.1| Nitrosospira multiformis ATCC 25196, complete genome
          Length = 3184243

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 57      attcgatctgaaaatgggg 75
               |||||||||||||||||||
Sbjct: 2907476 attcgatctgaaaatgggg 2907494


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,131,792
Number of Sequences: 3902068
Number of extensions: 1131792
Number of successful extensions: 73703
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 73621
Number of HSP's gapped (non-prelim): 83
length of query: 159
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 137
effective length of database: 17,147,199,772
effective search space: 2349166368764
effective search space used: 2349166368764
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top