>dbj|AP000925.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-759M17, complete
              sequence
          Length = 177831

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 15     acaccaggcttgttttcgttcagtg 39
              |||||||||||||||| ||||||||
Sbjct: 174382 acaccaggcttgtttttgttcagtg 174358

>dbj|AP001781.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-108O10, complete
             sequence
          Length = 181022

 Score = 42.1 bits (21), Expect = 0.17
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 15    acaccaggcttgttttcgttcagtg 39
             |||||||||||||||| ||||||||
Sbjct: 25351 acaccaggcttgtttttgttcagtg 25327

>gb|AC009560.10| Homo sapiens chromosome 15, clone RP11-219B17, complete sequence
          Length = 177308

 Score = 40.1 bits (20), Expect = 0.67
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      atgtctctacaccaggcttg 26
              ||||||||||||||||||||
Sbjct: 119573 atgtctctacaccaggcttg 119592

>gb|BC072859.1| Xenopus laevis MGC80259 protein, mRNA (cDNA clone MGC:80259
           IMAGE:5073183), complete cds
          Length = 985

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 8   tgtctctacaccaggcttg 26
           |||||||||||||||||||
Sbjct: 526 tgtctctacaccaggcttg 508

>gb|BC091715.1| Xenopus laevis MGC80259 protein, mRNA (cDNA clone MGC:85096
            IMAGE:6867616), complete cds
          Length = 2942

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 8    tgtctctacaccaggcttg 26
            |||||||||||||||||||
Sbjct: 2492 tgtctctacaccaggcttg 2474

>dbj|AB159447.1| Bombyx mori DNA, chromosome 13, clone:534E24, complete sequence
          Length = 124898

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 33    ttcagtgatcctgaaaaga 51
             |||||||||||||||||||
Sbjct: 74102 ttcagtgatcctgaaaaga 74084

>emb|AJ244090.1|SFO244090 Simian foamy virus env gene, partial, isolate agm24
          Length = 1794

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 48 aagaatggcacccccaatg 66
          |||||||||||||||||||
Sbjct: 45 aagaatggcacccccaatg 63

>emb|AJ244089.1|SFO244089 Simian foamy virus env gene, partial, isolate agm22
          Length = 1794

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 48 aagaatggcacccccaatg 66
          |||||||||||||||||||
Sbjct: 45 aagaatggcacccccaatg 63

>emb|AJ244088.1|SFO244088 Simian foamy virus env gene, partial, isolate agm17
          Length = 1794

 Score = 38.2 bits (19), Expect = 2.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                             
Query: 48 aagaatggcacccccaatg 66
          |||||||||||||||||||
Sbjct: 45 aagaatggcacccccaatg 63


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 490,134
Number of Sequences: 3902068
Number of extensions: 490134
Number of successful extensions: 29400
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29391
Number of HSP's gapped (non-prelim): 9
length of query: 68
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 47
effective length of database: 17,151,101,840
effective search space: 806101786480
effective search space used: 806101786480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)