Clone Name | bastl09b12 |
---|---|
Clone Library Name | barley_pub |
>emb|AL118508.27|HSJ737E23 Human DNA sequence from clone RP4-737E23 on chromosome 20p11.1-11.23 Contains the gene complement component C1q receptor (C1QR), a putative novel gene, ESTs, STSs and GSSs, complete sequence Length = 123832 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 176 tggggcttcccctcccccttctt 198 ||||||||||||||||||||||| Sbjct: 101617 tggggcttcccctcccccttctt 101595
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 97 cggcggccgccgcttcggcac 117 ||||||||||||||||||||| Sbjct: 2787904 cggcggccgccgcttcggcac 2787884 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 267 tcgccggccgccgtgcgcctcgcgtggg 294 ||||||| ||||||||||||| |||||| Sbjct: 3190319 tcgccggacgccgtgcgcctcacgtggg 3190292
>emb|CR855994.1| Wallaby DNA sequence from clone MEKBa-69G12, complete sequence Length = 174698 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 gggcttcccctcccccttctt 198 ||||||||||||||||||||| Sbjct: 99379 gggcttcccctcccccttctt 99399
>emb|AL158053.14| Human DNA sequence from clone RP11-156J23 on chromosome Xq21.2-21.33 Contains a discs, large homolog 7 (Drosophila) (DLG7) pseudogene, complete sequence Length = 177722 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 224 tcgggatctggatcgggacct 244 ||||||||||||||||||||| Sbjct: 49039 tcgggatctggatcgggacct 49019
>gb|AC010140.3|AC010140 Homo sapiens BAC clone RP11-218E11 from Y, complete sequence Length = 148342 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 224 tcgggatctggatcgggacct 244 ||||||||||||||||||||| Sbjct: 68575 tcgggatctggatcgggacct 68555
>gb|AC140356.3| Mus musculus BAC clone RP23-216B19 from 6, complete sequence Length = 211504 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 cttcccctcccccttcttctg 201 ||||||||||||||||||||| Sbjct: 116457 cttcccctcccccttcttctg 116437
>gb|AC158142.19| Mus musculus chromosome 15, clone RP24-342H15, complete sequence Length = 195319 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 180 gcttcccctcccccttcttct 200 ||||||||||||||||||||| Sbjct: 83268 gcttcccctcccccttcttct 83288
>gb|L01060.1|DOGIDUA03 Dog alpha-L-iduronidase (IDUA) gene, exons 7-12 Length = 1557 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 60 cgcgaccgccgcacccccgcc 80 ||||||||||||||||||||| Sbjct: 642 cgcgaccgccgcacccccgcc 662
>ref|NM_195001.1| Oryza sativa (japonica cultivar-group) putative cytochrome P-450 (OSJNBa0089D15.20), mRNA Length = 1260 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 261 cccgcctcgccggccgccgtgcgc 284 |||||||||| ||||||||||||| Sbjct: 941 cccgcctcgcgggccgccgtgcgc 918
>gb|AC169506.1| Mus musculus BAC clone RP23-417L6 from chromosome 17, complete sequence Length = 202033 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 49229 cttcccctcccccttcttct 49210
>ref|XM_516255.1| PREDICTED: Pan troglodytes similar to caveolin 3; M-caveolin; caveolin-3 (LOC460143), mRNA Length = 853 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 gaagctgctgtggggcttcccctc 189 ||||||||||||||||| |||||| Sbjct: 26 gaagctgctgtggggctgcccctc 3
>gb|AC005751.1| Homo sapiens chromosome 16, BAC clone 375G12 (LANL), complete sequence Length = 162822 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 122202 cttcccctcccccttcttct 122221
>ref|XM_362231.1| Magnaporthe grisea 70-15 hypothetical protein (MG04676.4) partial cds Length = 1512 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 198 tctgggcggcggcccctcgc 217 |||||||||||||||||||| Sbjct: 141 tctgggcggcggcccctcgc 160
>gb|AC103380.13| Mus musculus chromosome 1, clone RP24-263A16, complete sequence Length = 173136 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 149465 cttcccctcccccttcttct 149446
>gb|AC147478.2| Pan troglodytes BAC clone CH251-571L4 from Y, complete sequence Length = 188138 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcgaagctgctgtggggctt 183 |||||||||||||||||||| Sbjct: 123681 tcgaagctgctgtggggctt 123700
>gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosome 5, complete sequence Length = 227388 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 177 ggggcttcccctcccccttcttct 200 |||||| ||||||||||||||||| Sbjct: 146802 ggggctccccctcccccttcttct 146779
>gb|AC147131.2| Pan troglodytes BAC clone CH251-403A11 from Y, complete sequence Length = 168159 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcgaagctgctgtggggctt 183 |||||||||||||||||||| Sbjct: 155968 tcgaagctgctgtggggctt 155987
>gb|AC009135.12| Homo sapiens chromosome 16 clone RP11-509E10, complete sequence Length = 221640 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 130611 cttcccctcccccttcttct 130592
>gb|AC126550.3| Mus musculus BAC clone RP24-405L5 from chromosome 17, complete sequence Length = 171820 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 54182 cttcccctcccccttcttct 54163
>emb|AJ301559.2|RFA301559 Rhodococcus fascians ORF1 (partial), ORF2, ORF3, vicA gene and ORF5 (partial) Length = 18560 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 106 ccgcttcggcaccgctggcc 125 |||||||||||||||||||| Sbjct: 1882 ccgcttcggcaccgctggcc 1863
>emb|AL354668.13| Human DNA sequence from clone RP11-506P24 on chromosome 13 Contains the SPRY2 gene for sprouty homolog 2 (Drosophila) and a CpG island, complete sequence Length = 191652 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 171838 cttcccctcccccttcttct 171857
>emb|AL096814.26|HSDJ139D8 Human DNA sequence from clone RP1-139D8 on chromosome 6p12.1-21.1 Contains genes for GUCA1A (guanylate cyclase activator 1A) and GUCA1B (guanylate cyclase activator 1B) both from retina, the 3' end of the TReP-132 gene for zinc finger transcription regulating protein, the MRPS10 gene for mitochondrial ribosomal protein S10, the 5' end the gene for a novel protein, the gene for a novel protein and two CpG Islands, complete sequence Length = 167078 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 247 cactccttcctttccccgcc 266 |||||||||||||||||||| Sbjct: 19456 cactccttcctttccccgcc 19475
>emb|AL035411.28|HS592A1 Human DNA sequence from clone RP4-592A1 on chromosome 1p31.2-32.3 Contains the 3' end of a novel gene (KIAA1915), an adenylate kinase 2 (AK2) pseudogene, the TACSTD2 gene for tumor-associated calcium signal transducer 2 and a CpG island, complete sequence Length = 146112 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 243 ctgccactccttcctttccc 262 |||||||||||||||||||| Sbjct: 143202 ctgccactccttcctttccc 143221
>ref|XM_971080.1| PREDICTED: Tribolium castaneum hypothetical protein LOC656182 (LOC656182), mRNA Length = 1812 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 302 tcgttccgaaaacaccacca 321 |||||||||||||||||||| Sbjct: 126 tcgttccgaaaacaccacca 145
>emb|CR860580.1| Pongo pygmaeus mRNA; cDNA DKFZp459J237 (from clone DKFZp459J237) Length = 3022 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 259 tccccgcctcgccggccgcc 278 |||||||||||||||||||| Sbjct: 87 tccccgcctcgccggccgcc 106
>gb|AC163387.2| Mus musculus chromosome 1, clone RP24-181G14, complete sequence Length = 194188 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 187806 cttcccctcccccttcttct 187825
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 263 cgcctcgccggccgccgtgc 282 |||||||||||||||||||| Sbjct: 5266601 cgcctcgccggccgccgtgc 5266620
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 tcgaagctgctgtggggctt 183 |||||||||||||||||||| Sbjct: 5756950 tcgaagctgctgtggggctt 5756969
>ref|NM_001038859.1| Drosophila melanogaster CG8585-RE, transcript variant E (Ih), mRNA Length = 4435 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 1417 gatcgggatctggatcggga 1436
>ref|NM_001038858.1| Drosophila melanogaster CG8585-RB, transcript variant B (Ih), mRNA Length = 4324 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 1417 gatcgggatctggatcggga 1436
>ref|NM_001038856.1| Drosophila melanogaster CG8585-RC, transcript variant C (Ih), mRNA Length = 4486 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 1579 gatcgggatctggatcggga 1598
>gb|AY060342.1| Drosophila melanogaster GH23838 full length cDNA Length = 2828 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 824 gatcgggatctggatcggga 843
>gb|AC154491.2| Mus musculus BAC clone RP24-106D8 from chromosome 17, complete sequence Length = 146960 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 115079 cttcccctcccccttcttct 115060
>gb|AC078944.5|AC078944 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0089D15, from Chromosome 10, complete sequence Length = 164679 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 261 cccgcctcgccggccgccgtgcgc 284 |||||||||| ||||||||||||| Sbjct: 94368 cccgcctcgcgggccgccgtgcgc 94345
>gb|AF176315.2|AF176315 Homo sapiens chromosome 3 clone RP11-83M12 map 3p, complete sequence Length = 170755 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 gaagctgctgtggggcttcccctc 189 ||||||||||||||||| |||||| Sbjct: 67223 gaagctgctgtggggctgcccctc 67246
>gb|AC008381.8|AC008381 Homo sapiens chromosome 5 clone CTC-216O13, complete sequence Length = 101303 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 243 ctgccactccttcctttccc 262 |||||||||||||||||||| Sbjct: 78474 ctgccactccttcctttccc 78455
>gb|AC008229.3|AC008229 Drosophila melanogaster, chromosome 2R, region 51E-51F, BAC clone BACR16C17, complete sequence Length = 180425 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 54883 gatcgggatctggatcggga 54902
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 261 cccgcctcgccggccgccgtgcgc 284 |||||||||| ||||||||||||| Sbjct: 4097539 cccgcctcgcgggccgccgtgcgc 4097516
>gb|AC119873.38| Mus musculus chromosome 3, clone RP24-275F18, complete sequence Length = 183408 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 92272 cttcccctcccccttcttct 92291
>gb|AC154462.2| Mus musculus BAC clone RP24-165F12 from chromosome 14, complete sequence Length = 164631 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 182 ttcccctcccccttcttctg 201 |||||||||||||||||||| Sbjct: 129340 ttcccctcccccttcttctg 129359
>gb|AC025752.8| Homo sapiens chromosome 5 clone CTC-430J12, complete sequence Length = 189154 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 243 ctgccactccttcctttccc 262 |||||||||||||||||||| Sbjct: 40770 ctgccactccttcctttccc 40751
>gb|AC008151.1| Homo sapiens 3 BAC CITB-243A6 (California Institute of Technology BAC Library) complete sequence Length = 178242 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 gaagctgctgtggggcttcccctc 189 ||||||||||||||||| |||||| Sbjct: 8054 gaagctgctgtggggctgcccctc 8031
>gb|AF204690.1|AF204690 Homo sapiens caveolin-3 gene, partial cds Length = 1297 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 gaagctgctgtggggcttcccctc 189 ||||||||||||||||| |||||| Sbjct: 564 gaagctgctgtggggctgcccctc 541
>gb|AY928072.1| Drosophila melanogaster hyperpolarization-activated ion channel variant DMIH-A1B2C2 mRNA, complete cds, alternatively spliced Length = 4411 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 1393 gatcgggatctggatcggga 1412
>gb|AY928070.1| Drosophila melanogaster hyperpolarization-activated ion channel variant DMIH-A2B1C1 mRNA, complete cds, alternatively spliced Length = 4462 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 1555 gatcgggatctggatcggga 1574
>gb|AY928069.1| Drosophila melanogaster hyperpolarization-activated ion channel variant DMIH-A1B1C1 mRNA, complete cds, alternatively spliced Length = 4300 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 1393 gatcgggatctggatcggga 1412
>gb|AF124300.1|AF124300 Drosophila melanogaster putative voltage- and cyclic nucleotide-gated ion channel mRNA, complete cds Length = 3262 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 340 gatcgggatctggatcggga 359
>dbj|AK065306.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002O07, full insert sequence Length = 1113 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 ccgccgcacccccgccaccg 84 |||||||||||||||||||| Sbjct: 81 ccgccgcacccccgccaccg 62
>emb|CT010445.12| Mouse DNA sequence from clone RP23-285G1 on chromosome 17, complete sequence Length = 123987 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 52361 cttcccctcccccttcttct 52380
>gb|AE003815.4| Drosophila melanogaster chromosome 2R, section 35 of 73 of the complete sequence Length = 229685 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 gatcgggatctggatcggga 241 |||||||||||||||||||| Sbjct: 139945 gatcgggatctggatcggga 139964
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 261 cccgcctcgccggccgccgtgcgc 284 |||||||||| ||||||||||||| Sbjct: 4098360 cccgcctcgcgggccgccgtgcgc 4098337
>gb|AC127255.4| Mus musculus BAC clone RP24-291I7 from 5, complete sequence Length = 153492 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 177 ggggcttcccctcccccttcttct 200 |||||| ||||||||||||||||| Sbjct: 102405 ggggctccccctcccccttcttct 102428
>emb|AL626768.21| Mouse DNA sequence from clone RP23-347B4 on chromosome 4, complete sequence Length = 227165 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 184 cccctcccccttcttctggg 203 |||||||||||||||||||| Sbjct: 210630 cccctcccccttcttctggg 210649
>emb|AL627445.21| Mouse DNA sequence from clone RP23-81D2 on chromosome 11, complete sequence Length = 216303 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 182 ttcccctcccccttcttctg 201 |||||||||||||||||||| Sbjct: 198335 ttcccctcccccttcttctg 198354
>emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on chromosome 11, complete sequence Length = 220242 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 cttcccctcccccttcttct 200 |||||||||||||||||||| Sbjct: 93699 cttcccctcccccttcttct 93718
>gb|AC068312.5| Homo sapiens chromosome 3 clone RP11-128A5 map 3p, complete sequence Length = 170350 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 gaagctgctgtggggcttcccctc 189 ||||||||||||||||| |||||| Sbjct: 62910 gaagctgctgtggggctgcccctc 62887 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,482,506 Number of Sequences: 3902068 Number of extensions: 3482506 Number of successful extensions: 82869 Number of sequences better than 10.0: 56 Number of HSP's better than 10.0 without gapping: 56 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 82554 Number of HSP's gapped (non-prelim): 315 length of query: 429 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 407 effective length of database: 17,147,199,772 effective search space: 6978910307204 effective search space used: 6978910307204 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)