ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl09a12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL669836.9| Mouse DNA sequence from clone RP23-79H8 on chrom... 52 0.002
2ref|XM_413717.1| PREDICTED: Gallus gallus similar to thyroid hor... 44 0.38
3emb|CR386866.1| Gallus gallus finished cDNA, clone ChEST37j20 44 0.38
4gb|AF225468.1|AF225468 Coxsackievirus B2 isolate 2 polyprotein g... 44 0.38
5gb|AF225467.1|AF225467 Coxsackievirus B2 isolate 1 polyprotein g... 44 0.38
6gb|AY253982.1| Homo sapiens hypogonadotropin-1 (GPR54) mRNA, com... 42 1.5
7gb|AY253981.1| Homo sapiens hypogonadotropin-1 (GPR54) mRNA, com... 42 1.5
8emb|BX058519.1|CNS09HBF Single read from an extremity of a full-... 42 1.5
9emb|BX055797.1|CNS09F7T Single read from an extremity of a full-... 42 1.5
10emb|BX054524.1|CNS09E8G Single read from an extremity of a full-... 42 1.5
11emb|BX050600.1|CNS09B7G Single read from an extremity of a full-... 42 1.5
12emb|BX040804.1|CNS093NC Single read from an extremity of a full-... 42 1.5
13emb|BX040803.1|CNS093NB Single read from an extremity of a full-... 42 1.5
14emb|BX038361.1|CNS091RH Single read from an extremity of a full-... 42 1.5
15emb|BX038360.1|CNS091RG Single read from an extremity of a full-... 42 1.5
16emb|BX038080.1|CNS091JO Single read from an extremity of a full-... 42 1.5
17emb|BX038079.1|CNS091JN Single read from an extremity of a full-... 42 1.5
18emb|BX037782.1|CNS091BE Single read from an extremity of a full-... 42 1.5
19emb|BX037781.1|CNS091BD Single read from an extremity of a full-... 42 1.5
20emb|BX034175.1|CNS08YJ7 Single read from an extremity of a full-... 42 1.5
21emb|BX034174.1|CNS08YJ6 Single read from an extremity of a full-... 42 1.5
22emb|BX033991.1|CNS08YE3 Single read from an extremity of a full-... 42 1.5
23emb|BX033990.1|CNS08YE2 Single read from an extremity of a full-... 42 1.5
24emb|BX032901.1|CNS08XJT Single read from an extremity of a full-... 42 1.5
25emb|BX027066.1|CNS08T1Q Single read from an extremity of a full-... 42 1.5
26emb|BX023230.1|CNS08Q36 Single read from an extremity of a full-... 42 1.5
27emb|BX021213.1|CNS08OJ5 Single read from an extremity of a full-... 42 1.5
28emb|BX017562.1|CNS08LPQ Single read from an extremity of a full-... 42 1.5
29emb|BX017234.1|CNS08LGM Single read from an extremity of a full-... 42 1.5
30emb|BX012537.1|CNS08HU5 Single read from an extremity of a full-... 42 1.5
31emb|BX010546.1|CNS08GAU Single read from an extremity of a full-... 42 1.5
32emb|BX008555.1|CNS08ERJ Single read from an extremity of a full-... 42 1.5
33emb|BX007450.1|CNS08DWU Single read from an extremity of a full-... 42 1.5
34emb|AJ309020.1|HSA309020 Homo sapiens mRNA for G protein-coupled... 42 1.5
35dbj|AB051065.1| Homo sapiens hot7t175 mRNA for G protein-coupled... 42 1.5
36emb|CR621438.1| full-length cDNA clone CS0DE005YC17 of Placenta ... 42 1.5
37ref|NM_032551.3| Homo sapiens KISS1 receptor (KISS1R), mRNA 42 1.5
38gb|AY029541.1| Homo sapiens putative G protein-coupled receptor ... 42 1.5
39gb|AF343725.1|AF343725 Homo sapiens G-protein-coupled receptor G... 42 1.5
40ref|XM_309490.2| Anopheles gambiae str. PEST ENSANGP00000022070 ... 42 1.5
41emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromo... 42 1.5
42gb|AC005379.1|AC005379 Homo sapiens chromosome 19, cosmid R32603... 42 1.5
43gb|AC123751.6| Mus musculus chromosome 8, clone RP24-187F1, comp... 40 5.9
44gb|AF311916.1| Saguinus imperator Duffy antigen/chemokine recept... 40 5.9
45gb|AC121848.3| Mus musculus BAC clone RP24-87G10 from chromosome... 40 5.9
46emb|AL353795.13| Human DNA sequence from clone RP11-182N22 on ch... 40 5.9
47emb|X13607.1|GGVITIIG Chicken vitellogenin II gene 40 5.9
48emb|BX908798.1| Parachlamydia-related symbiont UWE25, complete g... 40 5.9
49gb|AC079906.15| Homo sapiens 12q BAC RP11-618L22 (Roswell Park C... 40 5.9
50gb|AC093844.3| Homo sapiens BAC clone RP11-451F20 from 4, comple... 40 5.9
51gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 5.9
52dbj|AK034238.1| Mus musculus adult male diencephalon cDNA, RIKEN... 40 5.9
53gb|AC155839.4| Mus musculus 6 BAC RP24-96J4 (Roswell Park Cancer... 40 5.9
54gb|AC021011.5| Homo sapiens BAC clone RP11-32K22 from 4, complet... 40 5.9
55gb|AC016759.11| Homo sapiens BAC clone RP11-535J8 from 2, comple... 40 5.9
56dbj|AB185211.1| Gallus gallus gene for vitellogenin, partial cds 40 5.9
57ref|XM_344485.2| PREDICTED: Rattus norvegicus similar to hypothe... 40 5.9
58gb|AC107209.4| Homo sapiens BAC clone RP11-4F12 from 2, complete... 40 5.9
59ref|NM_209046.1| Eremothecium gossypii ACR291Cp (ACR291C), mRNA 40 5.9 
>emb|AL669836.9| Mouse DNA sequence from clone RP23-79H8 on chromosome 2, complete
             sequence
          Length = 141877

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 303   agagcaggaactgcaggagcttcagg 328
             ||||||||||||||||||||||||||
Sbjct: 32583 agagcaggaactgcaggagcttcagg 32558
to top
>ref|XM_413717.1| PREDICTED: Gallus gallus similar to thyroid hormone receptor
            interactor 4; thyroid receptor interacting protein 4;
            activating signal cointegrator 1 (LOC415330), mRNA
          Length = 2113

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 302  gagagcaggaactgcaggagct 323
            ||||||||||||||||||||||
Sbjct: 1166 gagagcaggaactgcaggagct 1187
to top
>emb|CR386866.1| Gallus gallus finished cDNA, clone ChEST37j20
          Length = 1489

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 302 gagagcaggaactgcaggagct 323
           ||||||||||||||||||||||
Sbjct: 541 gagagcaggaactgcaggagct 562
to top
>gb|AF225468.1|AF225468 Coxsackievirus B2 isolate 2 polyprotein gene, partial cds
          Length = 846

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 278 tgaggctctctctcttttctgt 299
           ||||||||||||||||||||||
Sbjct: 838 tgaggctctctctcttttctgt 817
to top
>gb|AF225467.1|AF225467 Coxsackievirus B2 isolate 1 polyprotein gene, partial cds
          Length = 360

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 278 tgaggctctctctcttttctgt 299
           ||||||||||||||||||||||
Sbjct: 352 tgaggctctctctcttttctgt 331
to top
>gb|AY253982.1| Homo sapiens hypogonadotropin-1 (GPR54) mRNA, complete cds
          Length = 1607

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 167  ccctgcgcgccgcgccgcccc 187
            |||||||||||||||||||||
Sbjct: 1160 ccctgcgcgccgcgccgcccc 1180
to top
>gb|AY253981.1| Homo sapiens hypogonadotropin-1 (GPR54) mRNA, complete cds
          Length = 1197

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 167  ccctgcgcgccgcgccgcccc 187
            |||||||||||||||||||||
Sbjct: 1015 ccctgcgcgccgcgccgcccc 1035
to top
>emb|BX058519.1|CNS09HBF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 576

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 353 ggcaccagatccatgccgagc 333
to top
>emb|BX055797.1|CNS09F7T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 351 ggcaccagatccatgccgagc 331
to top
>emb|BX054524.1|CNS09E8G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 302 ggcaccagatccatgccgagc 282
to top
>emb|BX050600.1|CNS09B7G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 651

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 302 ggcaccagatccatgccgagc 282
to top
>emb|BX040804.1|CNS093NC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 441 ggcaccagatccatgccgagc 461
to top
>emb|BX040803.1|CNS093NB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 358 ggcaccagatccatgccgagc 338
to top
>emb|BX038361.1|CNS091RH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 460 ggcaccagatccatgccgagc 480
to top
>emb|BX038360.1|CNS091RG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 539

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 213 ggcaccagatccatgccgagc 193
to top
>emb|BX038080.1|CNS091JO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 471 ggcaccagatccatgccgagc 491
to top
>emb|BX038079.1|CNS091JN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 317 ggcaccagatccatgccgagc 297
to top
>emb|BX037782.1|CNS091BE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 532

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 437 ggcaccagatccatgccgagc 457
to top
>emb|BX037781.1|CNS091BD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 328 ggcaccagatccatgccgagc 308
to top
>emb|BX034175.1|CNS08YJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 415 ggcaccagatccatgccgagc 435
to top
>emb|BX034174.1|CNS08YJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 329 ggcaccagatccatgccgagc 309
to top
>emb|BX033991.1|CNS08YE3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 778

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 422 ggcaccagatccatgccgagc 442
to top
>emb|BX033990.1|CNS08YE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 778

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 296 ggcaccagatccatgccgagc 276
to top
>emb|BX032901.1|CNS08XJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 336 ggcaccagatccatgccgagc 316
to top
>emb|BX027066.1|CNS08T1Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 347 ggcaccagatccatgccgagc 327
to top
>emb|BX023230.1|CNS08Q36 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 317 ggcaccagatccatgccgagc 297
to top
>emb|BX021213.1|CNS08OJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 318 ggcaccagatccatgccgagc 298
to top
>emb|BX017562.1|CNS08LPQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 712

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 224 ggcaccagatccatgccgagc 204
to top
>emb|BX017234.1|CNS08LGM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 325 ggcaccagatccatgccgagc 305
to top
>emb|BX012537.1|CNS08HU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 347 ggcaccagatccatgccgagc 327
to top
>emb|BX010546.1|CNS08GAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 644

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 298 ggcaccagatccatgccgagc 278
to top
>emb|BX008555.1|CNS08ERJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 283

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 260 ggcaccagatccatgccgagc 240
to top
>emb|BX007450.1|CNS08DWU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 778

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 301 ggcaccagatccatgccgagc 281
to top
>emb|AJ309020.1|HSA309020 Homo sapiens mRNA for G protein-coupled receptor (AXOR12 gene)
          Length = 1197

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 167  ccctgcgcgccgcgccgcccc 187
            |||||||||||||||||||||
Sbjct: 1015 ccctgcgcgccgcgccgcccc 1035
to top
>dbj|AB051065.1| Homo sapiens hot7t175 mRNA for G protein-coupled receptor, complete
            cds
          Length = 1197

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 167  ccctgcgcgccgcgccgcccc 187
            |||||||||||||||||||||
Sbjct: 1015 ccctgcgcgccgcgccgcccc 1035
to top
>emb|CR621438.1| full-length cDNA clone CS0DE005YC17 of Placenta of Homo sapiens
            (human)
          Length = 1582

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 167  ccctgcgcgccgcgccgcccc 187
            |||||||||||||||||||||
Sbjct: 1175 ccctgcgcgccgcgccgcccc 1195
to top
>ref|NM_032551.3| Homo sapiens KISS1 receptor (KISS1R), mRNA
          Length = 1607

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 167  ccctgcgcgccgcgccgcccc 187
            |||||||||||||||||||||
Sbjct: 1160 ccctgcgcgccgcgccgcccc 1180
to top
>gb|AY029541.1| Homo sapiens putative G protein-coupled receptor mRNA, complete cds
          Length = 1197

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 167  ccctgcgcgccgcgccgcccc 187
            |||||||||||||||||||||
Sbjct: 1015 ccctgcgcgccgcgccgcccc 1035
to top
>gb|AF343725.1|AF343725 Homo sapiens G-protein-coupled receptor GPR54 (GPR54) mRNA, complete
            cds
          Length = 1197

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 167  ccctgcgcgccgcgccgcccc 187
            |||||||||||||||||||||
Sbjct: 1015 ccctgcgcgccgcgccgcccc 1035
to top
>ref|XM_309490.2| Anopheles gambiae str. PEST ENSANGP00000022070
           (ENSANGG00000019581), partial mRNA
          Length = 580

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 43  ggcaccagatccatgccgagc 63
           |||||||||||||||||||||
Sbjct: 348 ggcaccagatccatgccgagc 328
to top
>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib
          Length = 2013089

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 9      gtctccttcctcgttttcctc 29
              |||||||||||||||||||||
Sbjct: 586545 gtctccttcctcgttttcctc 586525
to top
>gb|AC005379.1|AC005379 Homo sapiens chromosome 19, cosmid R32603, complete sequence
          Length = 45617

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   ccctgcgcgccgcgccgcccc 187
             |||||||||||||||||||||
Sbjct: 15120 ccctgcgcgccgcgccgcccc 15140
to top
>gb|AC123751.6| Mus musculus chromosome 8, clone RP24-187F1, complete sequence
          Length = 159523

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 300   atgagagcaggaactgcagg 319
             ||||||||||||||||||||
Sbjct: 28773 atgagagcaggaactgcagg 28754
to top
>gb|AF311916.1| Saguinus imperator Duffy antigen/chemokine receptor (DARC) gene,
           complete cds
          Length = 1477

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 10  tctccttcctcgttttcctc 29
           ||||||||||||||||||||
Sbjct: 122 tctccttcctcgttttcctc 141
to top
>gb|AC121848.3| Mus musculus BAC clone RP24-87G10 from chromosome 15, complete sequence
          Length = 231797

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 283    ctctctctcttttctgtatg 302
              ||||||||||||||||||||
Sbjct: 180724 ctctctctcttttctgtatg 180705
to top
>emb|AL353795.13| Human DNA sequence from clone RP11-182N22 on chromosome 9 Contains a
              novel gene, the VCP gene for valosin-containing protein,
              the FANCG gene for Fanconi anemia, complementation group G
              (FAG, XRCC9), the gene for phosphatidylinositol glycan
              class O (PIGO), a novel gene, the STOML2 gene for stomatin
              (EPB72)-like 2 (SLP-2), a novel gene (KIAA1539) (FLJ11560),
              a zinc finger protein pseudogene, the 5' end of the UNC13
              gene for unc-13-like (C. elegans) (hmunc13) and nine CpG
              islands, complete sequence
          Length = 195102

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 267    cctctaatctctgaggctct 286
              ||||||||||||||||||||
Sbjct: 112767 cctctaatctctgaggctct 112748
to top
>emb|X13607.1|GGVITIIG Chicken vitellogenin II gene
          Length = 20343

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 240  ttctcctccctccgttttcc 259
            ||||||||||||||||||||
Sbjct: 7555 ttctcctccctccgttttcc 7574
to top
>emb|BX908798.1| Parachlamydia-related symbiont UWE25, complete genome
          Length = 2414465

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 238     tcttctcctccctccgtttt 257
               ||||||||||||||||||||
Sbjct: 1764699 tcttctcctccctccgtttt 1764680
to top
>gb|AC079906.15| Homo sapiens 12q BAC RP11-618L22 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 180688

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 54    catgccgagccaaaaccaga 73
             ||||||||||||||||||||
Sbjct: 86189 catgccgagccaaaaccaga 86170
to top
>gb|AC093844.3| Homo sapiens BAC clone RP11-451F20 from 4, complete sequence
          Length = 196044

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 276    tctgaggctctctctctttt 295
              ||||||||||||||||||||
Sbjct: 164024 tctgaggctctctctctttt 164005
to top
>gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome III,
              complete sequence
          Length = 907057

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 305    agcaggaactgcaggagcttcagg 328
              ||||||||||||||||||| ||||
Sbjct: 889984 agcaggaactgcaggagctgcagg 889961
to top
>dbj|AK034238.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched
            library, clone:9330166I09 product:weakly similar to SUPER
            CYSTEINE RICH PROTEIN (FRAGMENT) [Homo sapiens], full
            insert sequence
          Length = 3690

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 239  cttctcctccctccgttttc 258
            ||||||||||||||||||||
Sbjct: 1519 cttctcctccctccgttttc 1538
to top
>gb|AC155839.4| Mus musculus 6 BAC RP24-96J4 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 173368

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 239    cttctcctccctccgttttc 258
              ||||||||||||||||||||
Sbjct: 126588 cttctcctccctccgttttc 126569
to top
>gb|AC021011.5| Homo sapiens BAC clone RP11-32K22 from 4, complete sequence
          Length = 43958

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 244   cctccctccgttttcctctgctcc 267
             |||||||| |||||||||||||||
Sbjct: 16857 cctccctcagttttcctctgctcc 16880



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 244   cctccctccgttttcctctgctcc 267
             |||||||| |||||||||||||||
Sbjct: 16811 cctccctcagttttcctctgctcc 16834
to top
>gb|AC016759.11| Homo sapiens BAC clone RP11-535J8 from 2, complete sequence
          Length = 219574

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 292   ttttctgtatgagagcagga 311
             ||||||||||||||||||||
Sbjct: 17984 ttttctgtatgagagcagga 17965
to top
>dbj|AB185211.1| Gallus gallus gene for vitellogenin, partial cds
          Length = 12808

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 240  ttctcctccctccgttttcc 259
            ||||||||||||||||||||
Sbjct: 5743 ttctcctccctccgttttcc 5762
to top
>ref|XM_344485.2| PREDICTED: Rattus norvegicus similar to hypothetical protein
            4933430J11 (LOC364513), mRNA
          Length = 3468

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 232  aaatcgtcttctcctccctc 251
            ||||||||||||||||||||
Sbjct: 1225 aaatcgtcttctcctccctc 1206
to top
>gb|AC107209.4| Homo sapiens BAC clone RP11-4F12 from 2, complete sequence
          Length = 113078

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 292   ttttctgtatgagagcagga 311
             ||||||||||||||||||||
Sbjct: 48791 ttttctgtatgagagcagga 48772
to top
>ref|NM_209046.1| Eremothecium gossypii ACR291Cp (ACR291C), mRNA
          Length = 2055

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 305  agcaggaactgcaggagcttcagg 328
            ||||||||||||||||||| ||||
Sbjct: 998  agcaggaactgcaggagctgcagg 1021


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,697,243
Number of Sequences: 3902068
Number of extensions: 3697243
Number of successful extensions: 80942
Number of sequences better than 10.0: 59
Number of HSP's better than 10.0 without gapping: 59
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80837
Number of HSP's gapped (non-prelim): 105
length of query: 442
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 420
effective length of database: 17,147,199,772
effective search space: 7201823904240
effective search space used: 7201823904240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top