>ref|NM_192045.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1038

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 381 gcggngagcagccgcggccatgaa 404
           |||| |||||||||||||||||||
Sbjct: 438 gcggcgagcagccgcggccatgaa 461

>emb|AL591846.15| Human DNA sequence from clone RP11-343H5 on chromosome 1 Contains the
              LGTN gene for ligatin, the DYRK3 gene for dual-specificity
              tyrosine-(Y)-phosphorylation regulated kinase 3, a novel
              gene, the MAPKAPK2 gene for mitogen-activated protein
              kinase-activated protein kinase 2, a ribosomal protein S14
              (RPS14) pseudogene and a CpG island, complete sequence
          Length = 195485

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 45     cgacctggttttcttcagaga 65
              |||||||||||||||||||||
Sbjct: 130556 cgacctggttttcttcagaga 130576

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 66      gggaaggtgattgattttctc 86
               |||||||||||||||||||||
Sbjct: 3267562 gggaaggtgattgattttctc 3267542

>gb|AC155912.7| Mus musculus 10 BAC RP24-536C12 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 141692

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 191   tatatatggactgattgatga 211
             |||||||||||||||||||||
Sbjct: 52235 tatatatggactgattgatga 52255

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 430     gcgcgtcgccggcgaggatc 449
               ||||||||||||||||||||
Sbjct: 4052556 gcgcgtcgccggcgaggatc 4052537

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 430    gcgcgtcgccggcgaggatc 449
              ||||||||||||||||||||
Sbjct: 361245 gcgcgtcgccggcgaggatc 361226

>emb|AL161908.13| Human DNA sequence from clone RP11-123K19 on chromosome 9 Contains two
             novel genes, the 5' end of the LMX1B gene for LIM homeobox
             transcription factor 1 beta and two CpG islands, complete
             sequence
          Length = 106216

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    ttcagagagggaaggtgatt 77
             ||||||||||||||||||||
Sbjct: 80745 ttcagagagggaaggtgatt 80764

>emb|BX572594.1| Rhodopseudomonas palustris CGA009 complete genome; segment 2/16
          Length = 348971

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 430    gcgcgtcgccggcgaggatc 449
              ||||||||||||||||||||
Sbjct: 235899 gcgcgtcgccggcgaggatc 235918

>gb|AC157094.8| Mus musculus 6 BAC RP24-445L10 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 176428

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 199    gactgattgatgatgaaata 218
              ||||||||||||||||||||
Sbjct: 134612 gactgattgatgatgaaata 134593

>emb|CR774194.4| Zebrafish DNA sequence from clone DKEYP-11A2 in linkage group 1,
             complete sequence
          Length = 160120

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 277   ctagattttcagattagtcg 296
             ||||||||||||||||||||
Sbjct: 44456 ctagattttcagattagtcg 44475

>emb|BX950183.9| Zebrafish DNA sequence from clone DKEY-28C2 in linkage group 20,
             complete sequence
          Length = 200179

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   ctagattttcagattagtcg 296
             ||||||||||||||||||||
Sbjct: 46272 ctagattttcagattagtcg 46253

>gb|AF072220.1|AF072220 Blattella germanica major allergen Bla g 1.02 mRNA, partial cds
          Length = 1791

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 190  gtatatatggactgattgatgatg 213
            ||||| ||||||||||||||||||
Sbjct: 1220 gtataaatggactgattgatgatg 1243

>emb|BX322616.8| Zebrafish DNA sequence from clone DKEY-21K24 in linkage group 25,
             complete sequence
          Length = 232304

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 63    agagggaaggtgattgattttctc 86
             |||||||||||||| |||||||||
Sbjct: 46588 agagggaaggtgatagattttctc 46611

>gb|AC158635.6| Mus musculus 10 BAC RP23-396A23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 183931

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 213    gaaatagattctttccttct 232
              ||||||||||||||||||||
Sbjct: 125701 gaaatagattctttccttct 125720

>ref|XM_227313.3| PREDICTED: Rattus norvegicus similar to dachsous 2 isoform 1
            (LOC310550), mRNA
          Length = 10701

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 20   ttgttgccagcatccagatc 39
            ||||||||||||||||||||
Sbjct: 6176 ttgttgccagcatccagatc 6157

>emb|AL807734.7| Mouse DNA sequence from clone RP23-303N21 on chromosome X, complete
              sequence
          Length = 184303

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 171    agggaaggtgattgatccagtata 194
              |||||||||||||||| |||||||
Sbjct: 145808 agggaaggtgattgatacagtata 145785

>gb|AC155288.3| Mus musculus 6 BAC RP24-176C17 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 168486

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 199    gactgattgatgatgaaata 218
              ||||||||||||||||||||
Sbjct: 154026 gactgattgatgatgaaata 154045

>dbj|AP002760.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-795E18, complete
             sequence
          Length = 211673

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 61    agagagggaaggtgattgat 80
             ||||||||||||||||||||
Sbjct: 94112 agagagggaaggtgattgat 94093

>dbj|AB075525.1| Oreochromis mossambicus mRNA for OmCLC-K, complete cds
          Length = 2953

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 55   ttcttcagagagggaaggtg 74
            ||||||||||||||||||||
Sbjct: 1702 ttcttcagagagggaaggtg 1683

>gb|AF036920.1|AF036920 Rhizobium tropici plasmid pRtrCFN299a aryl-alcohol dehydrogenase
            homolog (xylB1) gene, partial cds; periplasmic sugar
            binding protein homolog (teuB), sugar transport
            ATP-binding protein homolog (teuA), sugar transport
            system permease protein homolog (teuC1), and sugar
            transport system permease homolog (teuC2) genes, complete
            cds; and aryl-alcohol dehydrogenase homolog (xylB2) gene,
            partial cds
          Length = 6936

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 427  accgcgcgtcgccggcgaggatcatgaa 454
            ||||||| |||||||||||| |||||||
Sbjct: 1270 accgcgcctcgccggcgaggttcatgaa 1243

>emb|AL808015.4| Mouse DNA sequence from clone RP23-467C11 on chromosome X, complete
              sequence
          Length = 180935

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 204    attgatgatgaaatagattctttc 227
              |||||||||| |||||||||||||
Sbjct: 130726 attgatgatgtaatagattctttc 130703

>dbj|AB062883.1| Rhodopseudomonas palustris fps gene for farnesyl diphosphate
           synthase, partial cds
          Length = 442

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 430 gcgcgtcgccggcgaggatc 449
           ||||||||||||||||||||
Sbjct: 103 gcgcgtcgccggcgaggatc 84


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,764,335
Number of Sequences: 3902068
Number of extensions: 4764335
Number of successful extensions: 92895
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92756
Number of HSP's gapped (non-prelim): 139
length of query: 474
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 452
effective length of database: 17,147,199,772
effective search space: 7750534296944
effective search space used: 7750534296944
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)