ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bastl08e03 |
|---|---|
| Clone Library Name | barley_pub |
>emb|BX842680.1| Neurospora crassa DNA linkage group I cosmid contig 90C4 Length = 131439 Score = 65.9 bits (33), Expect = 1e-07 Identities = 33/33 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 ||||||||||||||||||||||||||||||||| Sbjct: 19681 ctcttcctcttcctcttcctcttcgtcccctcc 19713 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 19675 ctcttcctcttcctcttcctcttc 19698 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ttcctcttcctcttcctcttc 84 ||||||||||||||||||||| Sbjct: 19672 ttcctcttcctcttcctcttc 19692
>gb|AC159381.10| Mus musculus 6 BAC RP24-460E4 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 211463 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| ||||||||| Sbjct: 7403 ctcttcctcttcctcttcctcttcctcccctccc 7436 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7397 ctcttcctcttcctcttcctcttc 7420 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctct 82 ||||||||||||||||||||| Sbjct: 7374 tcttcctcttcctcttcctct 7394 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||| ||||||||||||||||||| Sbjct: 7391 ctctccctcttcctcttcctcttc 7414 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||| ||||||||||||| Sbjct: 7385 ctcttcctctccctcttcctcttc 7408 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||| ||||||| Sbjct: 7379 ctcttcctcttcctctccctcttc 7402
>gb|AC116409.9| Mus musculus chromosome 3, clone RP24-337P23, complete sequence Length = 162232 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| ||||||||| Sbjct: 57542 ctcttcctcttcctcttcctcttcctcccctccc 57575
>gb|AC163355.2| Mus musculus BAC clone RP23-11P15 from chromosome 16, complete sequence Length = 225547 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| ||||||||| Sbjct: 164811 ctcttcctcttcctcttcctcttcctcccctccc 164844 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164805 ctcttcctcttcctcttcctcttc 164828 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164799 ctcttcctcttcctcttcctcttc 164822 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 23664 tcctcttcctcttcctcttc 23645 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 23662 ctcttcctcttcctcttcct 23643 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||| ||||||||| Sbjct: 23656 ctcttcctcttccttttcctcttc 23633 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||| ||||||||||||||| Sbjct: 23650 ctcttccttttcctcttcctcttc 23627
>gb|AC155719.11| Mus musculus 6 BAC RP24-236K6 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 179419 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| ||||||||| Sbjct: 152902 ctcttcctcttcctcttcctcttcctcccctccc 152935 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 152896 ctcttcctcttcctcttcctcttc 152919 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 61387 ctcttcctcttcctcttcctcttc 61410 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctct 82 ||||||||||||||||||||| Sbjct: 152873 tcttcctcttcctcttcctct 152893 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||| ||||||||||||||||||| Sbjct: 152890 ctctccctcttcctcttcctcttc 152913 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||| ||||||||||||| Sbjct: 152884 ctcttcctctccctcttcctcttc 152907 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||| ||||||| Sbjct: 152878 ctcttcctcttcctctccctcttc 152901 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 61393 ctcttcctcttcctcttcct 61412 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||| |||||||||||||||||| Sbjct: 61381 ctctttctcttcctcttcctcttc 61404
>gb|AC109220.16| Mus musculus chromosome 7, clone RP23-84B11, complete sequence Length = 212018 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| ||||||||| Sbjct: 44218 ctcttcctcttcctcttcctcttcctcccctccc 44185 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 44230 ctcttcctcttcctcttcctcttc 44207 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 44224 ctcttcctcttcctcttcctcttc 44201 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 44232 tcctcttcctcttcctcttc 44213
>emb|AL627183.16| Mouse DNA sequence from clone RP23-345H2 on chromosome 4, complete sequence Length = 216153 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| ||||||||| Sbjct: 80469 ctcttcctcttcctcttcctcttcctcccctccc 80502 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80463 ctcttcctcttcctcttcctcttc 80486 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80457 ctcttcctcttcctcttcctcttc 80480 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80451 ctcttcctcttcctcttcctcttc 80474 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80445 ctcttcctcttcctcttcctcttc 80468 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80439 ctcttcctcttcctcttcctcttc 80462 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80433 ctcttcctcttcctcttcctcttc 80456 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80427 ctcttcctcttcctcttcctcttc 80450 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 80425 tcctcttcctcttcctcttc 80444
>ref|XM_503681.1| Yarrowia lipolytica CLIB122, YALI0E08008g predicted mRNA Length = 1362 Score = 58.0 bits (29), Expect = 2e-05 Identities = 29/29 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttcgtcc 88 ||||||||||||||||||||||||||||| Sbjct: 794 gctcttcctcttcctcttcctcttcgtcc 822
>gb|AC129555.29| Mus musculus chromosome 5, clone RP24-90F19, complete sequence Length = 242141 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||||| ||||||||| Sbjct: 180547 tcttcctcttcctcttcctcttcttcccctccc 180515
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 58.0 bits (29), Expect = 2e-05 Identities = 29/29 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttcgtcc 88 ||||||||||||||||||||||||||||| Sbjct: 935417 gctcttcctcttcctcttcctcttcgtcc 935389 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||| ||||| Sbjct: 1506599 ctcttcctcttcctcttcctcctcgtc 1506625 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctc 81 |||||||||||||||||||| Sbjct: 1980986 tcttcctcttcctcttcctc 1980967
>ref|XM_948454.1| Theileria annulata strain Ankara sub-telomeric protein (TA09785) partial mRNA Length = 1809 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcc 88 |||||||||||||||||||||||||||| Sbjct: 1098 ctcttcctcttcctcttcctcttcgtcc 1071 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 1110 ctcttcctcttcctcttcctcttc 1087 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 1104 ctcttcctcttcctcttcctcttc 1081 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 1112 tcctcttcctcttcctcttc 1093
>emb|CT573053.1| Medicago truncatula chromosome 5 clone mte1-8e5, COMPLETE SEQUENCE Length = 106640 Score = 56.0 bits (28), Expect = 1e-04 Identities = 28/28 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||||| Sbjct: 80142 gctcttcctcttcctcttcctcttcgtc 80115 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 80135 ctcttcctcttcctcttcgtcttc 80112
>gb|AC148114.8| Mus musculus chromosome 8, clone RP24-134B6, complete sequence Length = 155465 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 14458 ctcttcctcttcctcttcctcttcgtc 14432 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 14521 ctcttcctcttcctcttcctcttc 14498 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 14515 ctcttcctcttcctcttcctcttc 14492 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 14509 ctcttcctcttcctcttcctcttc 14486 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 14503 ctcttcctcttcctcttcctcttc 14480 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 14497 ctcttcctcttcctcttcctcttc 14474 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 14491 ctcttcctcttcctcttcctc 14471 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 14460 tcctcttcctcttcctcttc 14441 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 14452 ctcttcctcttcctcttcgtcttc 14429
>gb|AC160339.2| Mus musculus BAC clone RP23-410O11 from chromosome 9, complete sequence Length = 174612 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 47435 ctcttcctcttcctcttcctcttcgtc 47409 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 47437 tcctcttcctcttcctcttc 47418
>gb|AC110536.10| Mus musculus chromosome 1, clone RP24-545N23, complete sequence Length = 190817 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 114858 ctcttcctcttcctcttcctcttcgtc 114884 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 114852 ctcttcctcttcctcttcctcttc 114875 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 114847 tcttcctcttcctcttcctcttc 114869 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 114864 ctcttcctcttcctcttcgtcttc 114887
>ref|XM_718354.1| Candida albicans SC5314 putative Sir2 family histone deacetylase (CaO19_4761), mRNA Length = 1974 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 264 ctcttcctcttcctcttcctcttcgtc 238 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 336 ctcttcctcttcctcttcctcttc 313 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 330 ctcttcctcttcctcttcctcttc 307 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 324 ctcttcctcttcctcttcctcttc 301 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 318 ctcttcctcttcctcttcctcttc 295 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 312 ctcttcctcttcctcttcctcttc 289 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 306 ctcttcctcttcctcttcctcttc 283 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 300 ctcttcctcttcctcttcctcttc 277 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 294 ctcttcctcttcctcttcctcttc 271 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 288 ctcttcctcttcctcttcctcttc 265 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 282 ctcttcctcttcctcttcctcttc 259 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 276 ctcttcctcttcctcttcctcttc 253 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 270 ctcttcctcttcctcttcctcttc 247 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 341 tcttcctcttcctcttcctcttc 319
>ref|XM_718165.1| Candida albicans SC5314 putative Sir2 family histone deacetylase (CaO19_12225), mRNA Length = 1896 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 264 ctcttcctcttcctcttcctcttcgtc 238 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 269 tcttcctcttcctcttcctcttc 247
>gb|AC140206.2| Mus musculus BAC clone RP24-446O8 from chromosome 16, complete sequence Length = 195790 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 58580 ctcttcctcttcctcttcctcttcgtc 58554 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 58586 ctcttcctcttcctcttcctcttc 58563 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||| |||||||| Sbjct: 58574 ctcttcctcttcctcttcgtcttcgtc 58548 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 58588 tcctcttcctcttcctcttc 58569
>gb|AC002410.2| Homo sapiens BAC clone CTA-264L19 from 7, complete sequence Length = 96217 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccct 91 |||||||||||||||||||||||| |||||| Sbjct: 50068 ctcttcctcttcctcttcctcttcttcccct 50098 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 50063 tcttcctcttcctcttcctcttc 50085
>gb|AC133518.3| Mus musculus BAC clone RP23-138G24 from chromosome 7, complete sequence Length = 195464 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 179883 ctcttcctcttcctcttcctcttcgtc 179909 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 179877 ctcttcctcttcctcttcctcttc 179900 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 179873 cttcctcttcctcttcctcttc 179894 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 179889 ctcttcctcttcctcttcgtcttc 179912
>ref|XM_810076.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053511089.140) partial mRNA Length = 858 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 453 ctcttcctcttcctcttcctcttcgtc 427 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 428 tcttcctcttcctcttcctcttcgtc 403 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 404 tcttcctcttcctcttcctcttcgtc 379 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 380 tcttcctcttcctcttcctcttcgtc 355 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 447 ctcttcctcttcctcttcgtcttc 424 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 441 ctcttcctcttcgtcttcctcttc 418 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 435 ctcttcgtcttcctcttcctcttc 412 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 423 ctcttcctcttcctcttcgtcttc 400 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 417 ctcttcctcttcgtcttcctcttc 394 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 411 ctcttcgtcttcctcttcctcttc 388 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 399 ctcttcctcttcctcttcgtcttc 376 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 393 ctcttcctcttcgtcttcctcttc 370 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 387 ctcttcgtcttcctcttcctcttc 364 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 375 ctcttcctcttcctcttcgtcttc 352
>gb|AC121970.2| Mus musculus BAC clone RP24-275B23 from 1, complete sequence Length = 179612 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Minus Query: 64 ttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||| ||||||||| Sbjct: 134702 ttcctcttcctcttcctcttcctcccctccc 134672 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 134699 ctcttcctcttcctcttcctc 134679
>gb|AC128638.34| Medicago truncatula clone mth2-36h10, complete sequence Length = 110895 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 68630 ctcttcctcttcctcttcctcttcgtc 68604 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 68634 cttcctcttcctcttcctcttc 68613 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 68624 ctcttcctcttcctcttcgtcttc 68601
>emb|AL031262.2|SPBC30B4 S.pombe chromosome II cosmid c30B4 Length = 25282 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 582 ctcttcctcttcctcttcctcttcgtc 556 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 587 tcttcctcttcctcttcctcttc 565 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||| |||||||| Sbjct: 576 ctcttcctcttcctcttcgtcttcgtc 550
>gb|AF520420.1| Mus musculus c222389 pseudogene, complete sequence; nuclear receptor 2E1 (Nr2e1) and sorting nexin 3 (Snx3) genes, complete cds; and lactation elevated 1 (Lace1) gene, partial cds Length = 187196 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcccaccacctcc 103 |||||||||||||||||||||||| ||| ||||| || ||||| Sbjct: 19804 ctcttcctcttcctcttcctcttcctcctctccctcctcctcc 19762 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 19729 ctcttcctcttcctcttcctcttc 19706 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 19723 ctcttcctcttcctcttcctcttc 19700 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 19717 ctcttcctcttcctcttcctcttc 19694 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 19711 ctcttcctcttcctcttcctc 19691 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 15698 ctcttcctcttcctcttcctc 15718 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 19806 tcctcttcctcttcctcttc 19787 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 19731 tcctcttcctcttcctcttc 19712
>gb|AC153138.3| Mus musculus BAC clone RP23-442K7 from chromosome 7, complete sequence Length = 206648 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 116616 ctcttcctcttcctcttcctcttcgtc 116642 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 116610 ctcttcctcttcctcttcctcttc 116633 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 116606 cttcctcttcctcttcctcttc 116627 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 116622 ctcttcctcttcctcttcgtcttc 116645
>ref|NM_001021435.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC3D6.14c), partial mRNA Length = 932 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 350 ctcttcctcttcctcttcctcttcgtc 376 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||| |||||||| Sbjct: 356 ctcttcctcttcctcttcgtcttcgtc 382 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 345 tcttcctcttcctcttcctcttc 367
>emb|CT010584.19| Mouse DNA sequence from clone RP23-383B20 on chromosome 16, complete sequence Length = 199010 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 131328 ctcttcctcttcctcttcctcttcgtc 131354 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 131322 ctcttcctcttcctcttcctcttc 131345 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 131316 ctcttcctcttcctcttcctcttc 131339 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 131310 ctcttcctcttcctcttcctcttc 131333 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 131340 ctcttcctcttcgtcttcctcttc 131363 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 131334 ctcttcctcttcctcttcgtcttc 131357 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 131308 tcctcttcctcttcctcttc 131327
>emb|CT572989.7| Mouse DNA sequence from clone RP24-176J14 on chromosome 9, complete sequence Length = 168760 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 4585 ctcttcctcttcctcttcctcttcgtc 4611 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 4583 tcctcttcctcttcctcttc 4602
>emb|Z95620.1|SPBC3D6 S.pombe chromosome II cosmid c3D6 Length = 32329 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 31980 ctcttcctcttcctcttcctcttcgtc 31954 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 31985 tcttcctcttcctcttcctcttc 31963 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||| |||||||| Sbjct: 31974 ctcttcctcttcctcttcgtcttcgtc 31948
>gb|AC147184.3| Mus musculus BAC clone RP24-286F20 from 1, complete sequence Length = 176857 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 64 ttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||| ||||||||| Sbjct: 168655 ttcctcttcctcttcctcttcctcccctccc 168685 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 168658 ctcttcctcttcctcttcctc 168678
>gb|AC136147.4| Mus musculus BAC clone RP23-18B3 from 8, complete sequence Length = 210916 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccct 91 |||||||||||||||||||||||| |||||| Sbjct: 25691 ctcttcctcttcctcttcctcttcctcccct 25721 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 25686 tcttcctcttcctcttcctcttc 25708
>gb|AC150903.2| Mus musculus BAC clone RP23-35B12 from chromosome 7, complete sequence Length = 217178 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 187349 ctcttcctcttcctcttcctcttcgtc 187323 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 187355 ctcttcctcttcctcttcctcttc 187332 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 187359 cttcctcttcctcttcctcttc 187338 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 187343 ctcttcctcttcctcttcgtcttc 187320
>dbj|AB027890.1| Schizosaccharomyces pombe gene for Hypothetical protein, partial cds, clone:TA46 Length = 631 Score = 54.0 bits (27), Expect = 4e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||||||||| Sbjct: 138 ctcttcctcttcctcttcctcttcgtc 164 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||| |||||||| Sbjct: 144 ctcttcctcttcctcttcgtcttcgtc 170 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 133 tcttcctcttcctcttcctcttc 155
>gb|AC119269.9| Mus musculus chromosome 5, clone RP24-324B22, complete sequence Length = 172282 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||||| ||||||||| Sbjct: 6579 ctcttcctcttcctcttcctctttctcccctccc 6546 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6621 ctcttcctcttcctcttcctcttc 6598 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6615 ctcttcctcttcctcttcctcttc 6592 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6609 ctcttcctcttcctcttcctcttc 6586 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6603 ctcttcctcttcctcttcctcttc 6580 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6597 ctcttcctcttcctcttcctcttc 6574 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6591 ctcttcctcttcctcttcctcttc 6568 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6585 ctcttcctcttcctcttcctcttc 6562 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 6623 tcctcttcctcttcctcttc 6604
>gb|AC165074.2| Mus musculus BAC clone RP24-501F1 from chromosome 12, complete sequence Length = 166016 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| | ||||||| Sbjct: 149905 ctcttcctcttcctcttcctcttccttccctccc 149872 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 149947 ctcttcctcttcctcttcctcttc 149924 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 149941 ctcttcctcttcctcttcctcttc 149918 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 149935 ctcttcctcttcctcttcctcttc 149912 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 149929 ctcttcctcttcctcttcctcttc 149906 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 149923 ctcttcctcttcctcttcctcttc 149900 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 149917 ctcttcctcttcctcttcctcttc 149894 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 149911 ctcttcctcttcctcttcctcttc 149888 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||| |||||||||||||||||| Sbjct: 149953 ctctttctcttcctcttcctcttc 149930
>ref|XM_467104.1| Oryza sativa (japonica cultivar-group), mRNA Length = 976 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 59 agctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||||| Sbjct: 53 agctcttcctcttcctcttcctcttc 78 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 61 ctcttcctcttcctcttcctc 81
>gb|AC120865.7| Mus musculus chromosome 5, clone RP23-88L6, complete sequence Length = 235287 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| || |||||| Sbjct: 121312 ctcttcctcttcctcttcctcttcctctcctccc 121279 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 121317 tcttcctcttcctcttcctcttc 121295 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtccc 89 ||||||||||| |||||||||||| |||| Sbjct: 196032 ctcttcctctttctcttcctcttcctccc 196004 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||||||||| |||||| Sbjct: 196038 ctcttcctcttcctctttctcttc 196015
>gb|AC103407.12| Mus musculus chromosome 1, clone RP23-230J23, complete sequence Length = 204077 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 193459 ctcttcctcttcctcttcctcttcctcccc 193430 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 193461 tcctcttcctcttcctcttc 193442
>gb|AC104901.13| Mus musculus chromosome 1, clone RP24-404L18, complete sequence Length = 144659 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 142008 ctcttcctcttcctcttcctcttcctcccc 142037 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 142006 tcctcttcctcttcctcttc 142025
>ref|XM_460721.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F09185g) partial mRNA Length = 1233 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 461 tcttcctcttcctcttcctcttcgtc 436
>gb|AC137514.2| Mus musculus BAC clone RP24-511G20 from chromosome 8, complete sequence Length = 133829 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| || |||||| Sbjct: 108695 ctcttcctcttcctcttcctcttcctctcctccc 108728 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 108689 ctcttcctcttcctcttcctcttc 108712 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 108683 ctcttcctcttcctcttcctcttc 108706 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 108677 ctcttcctcttcctcttcctcttc 108700 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 108671 ctcttcctcttcctcttcctcttc 108694 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 108665 ctcttcctcttcctcttcctcttc 108688 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 108659 ctcttcctcttcctcttcctcttc 108682 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 108653 ctcttcctcttcctcttcctcttc 108676 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 108647 ctcttcctcttcctcttcctcttc 108670 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 108641 ctcttcctcttcctcttcctcttc 108664 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 108615 tcttcctcttcctcttcctcttc 108637 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 108592 ctcttcctcttcctcttcctctt 108614 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 108620 ctcttcctcttcctcttcctc 108640 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 98508 ctcttcctcttcctcttcctc 98488 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 108639 tcctcttcctcttcctcttc 108658 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 98510 tcctcttcctcttcctcttc 98491
>ref|XM_951656.1| Neurospora crassa OR74A hypothetical protein (NCU01472.1) partial mRNA Length = 4494 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 4404 ctcttcctcttcctcttcctcttcctcccc 4375 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 4428 ctcttcctcttcctcttcctcttc 4405 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 4422 ctcttcctcttcctcttcctcttc 4399 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 4416 ctcttcctcttcctcttcctcttc 4393 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 4410 ctcttcctcttcctcttcctcttc 4387 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 4430 tcctcttcctcttcctcttc 4411
>ref|XM_958593.1| Neurospora crassa OR74A hypothetical protein (NCU00543.1) partial mRNA Length = 351 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 320 tcttcctcttcctcttcctcttcgtc 295
>ref|XM_324722.1| Neurospora crassa OR74A hypothetical protein (NCU00543.1) partial mRNA Length = 351 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 320 tcttcctcttcctcttcctcttcgtc 295
>ref|XM_327910.1| Neurospora crassa OR74A hypothetical protein (NCU01472.1) partial mRNA Length = 4494 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 4404 ctcttcctcttcctcttcctcttcctcccc 4375 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 4428 ctcttcctcttcctcttcctcttc 4405 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 4422 ctcttcctcttcctcttcctcttc 4399 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 4416 ctcttcctcttcctcttcctcttc 4393 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 4410 ctcttcctcttcctcttcctcttc 4387 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 4430 tcctcttcctcttcctcttc 4411
>gb|AC134537.3| Mus musculus BAC clone RP24-388M1 from chromosome 12, complete sequence Length = 221662 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 176786 ctcttcctcttcctcttcctcttcctcccc 176815 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 176780 ctcttcctcttcctcttcctcttc 176803 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 176774 ctcttcctcttcctcttcctcttc 176797 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 176768 ctcttcctcttcctcttcctcttc 176791 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 176762 ctcttcctcttcctcttcctcttc 176785 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 176756 ctcttcctcttcctcttcctcttc 176779 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 176752 cttcctcttcctcttcctcttc 176773
>gb|AC128668.4| Mus musculus BAC clone RP24-81D14 from chromosome 8, complete sequence Length = 211075 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 147181 ctcttcctcttcctcttcctcttcctcccc 147152 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 147205 ctcttcctcttcctcttcctcttc 147182 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 147199 ctcttcctcttcctcttcctcttc 147176 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 147193 ctcttcctcttcctcttcctcttc 147170 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 147187 ctcttcctcttcctcttcctcttc 147164 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 147209 cttcctcttcctcttcctcttc 147188
>gb|AC151982.4| Mus musculus BAC clone RP23-445J16 from chromosome 12, complete sequence Length = 183898 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| | ||||||| Sbjct: 154468 ctcttcctcttcctcttcctcttccttccctccc 154501 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 154462 ctcttcctcttcctcttcctcttc 154485 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 154456 ctcttcctcttcctcttcctcttc 154479 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 154450 ctcttcctcttcctcttcctcttc 154473 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 154444 ctcttcctcttcctcttcctcttc 154467 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 154438 ctcttcctcttcctcttcctcttc 154461 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 154432 ctcttcctcttcctcttcctcttc 154455 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 154426 ctcttcctcttcctcttcctcttc 154449 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||| |||||||||||||||||| Sbjct: 154420 ctctttctcttcctcttcctcttc 154443
>gb|AC131105.4| Mus musculus BAC clone RP23-280N9 from chromosome 19, complete sequence Length = 225527 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| ||| ||||| Sbjct: 212449 ctcttcctcttcctcttcctcttcttccgctccc 212482 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 212443 ctcttcctcttcctcttcctcttc 212466 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 212437 ctcttcctcttcctcttcctcttc 212460 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 212432 tcttcctcttcctcttcctcttc 212454
>gb|AC125331.4| Mus musculus chromosome 7 clone RP23-11L1, complete sequence Length = 255921 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||| |||||| ||||||||| Sbjct: 195672 ctcttcctcttcctctttctcttcctcccctccc 195705 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 148136 ctcttcctcttcctcttcctc 148156 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 148134 tcctcttcctcttcctcttc 148153
>gb|AC123052.4| Mus musculus chromosome 13 clone RP24-373D10, complete sequence Length = 175595 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 175168 ctcttcctcttcctcttcctcttcctcccc 175197 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 175162 ctcttcctcttcctcttcctcttc 175185 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 175156 ctcttcctcttcctcttcctcttc 175179 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 175150 ctcttcctcttcctcttcctcttc 175173 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 175144 ctcttcctcttcctcttcctcttc 175167 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 175138 ctcttcctcttcctcttcctcttc 175161 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 175132 ctcttcctcttcctcttcctcttc 175155 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 175126 ctcttcctcttcctcttcctcttc 175149 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 175120 ctcttcctcttcctcttcctcttc 175143 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 175118 tcctcttcctcttcctcttc 175137
>gb|AC138457.3| Mus musculus BAC clone RP23-358E1 from chromosome 19, complete sequence Length = 237854 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| ||| ||||| Sbjct: 45601 ctcttcctcttcctcttcctcttcttccgctccc 45634 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 45595 ctcttcctcttcctcttcctcttc 45618 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 45589 ctcttcctcttcctcttcctcttc 45612 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 45584 tcttcctcttcctcttcctcttc 45606 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 58958 tcctcttcctcttcctcttc 58977
>ref|XM_813599.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053508433.90) partial mRNA Length = 837 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 413 tcttcctcttcctcttcctcttcgtc 388 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 408 ctcttcctcttcctcttcgtcttc 385
>gb|AC104096.5| Mus musculus BAC clone RP24-370O22 from chromosome 8, complete sequence Length = 160450 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| || |||||| Sbjct: 24058 ctcttcctcttcctcttcctcttcctctcctccc 24091 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 24052 ctcttcctcttcctcttcctcttc 24075 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 24046 ctcttcctcttcctcttcctcttc 24069 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 24040 ctcttcctcttcctcttcctcttc 24063 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 24034 ctcttcctcttcctcttcctcttc 24057 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 24028 ctcttcctcttcctcttcctcttc 24051 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 24022 ctcttcctcttcctcttcctcttc 24045 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 24016 ctcttcctcttcctcttcctcttc 24039 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 24010 ctcttcctcttcctcttcctcttc 24033 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 24004 ctcttcctcttcctcttcctcttc 24027 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 23978 tcttcctcttcctcttcctcttc 24000 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 23955 ctcttcctcttcctcttcctctt 23977 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 23983 ctcttcctcttcctcttcctc 24003 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 13871 ctcttcctcttcctcttcctc 13851 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctc 81 |||||||||||||||||||| Sbjct: 150566 tcttcctcttcctcttcctc 150547 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 24002 tcctcttcctcttcctcttc 24021 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 13873 tcctcttcctcttcctcttc 13854
>gb|AC125327.4| Mus musculus BAC clone RP23-346B17 from chromosome 6, complete sequence Length = 224846 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 164649 ctcttcctcttcctcttcctcttcctcccc 164620 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164679 ctcttcctcttcctcttcctcttc 164656 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164673 ctcttcctcttcctcttcctcttc 164650 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164667 ctcttcctcttcctcttcctcttc 164644 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164661 ctcttcctcttcctcttcctcttc 164638 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164655 ctcttcctcttcctcttcctcttc 164632 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 164684 tcttcctcttcctcttcctcttc 164662
>gb|AC124413.2| Mus musculus BAC clone RP24-280K5 from chromosome 10, complete sequence Length = 178858 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 69617 ctcttcctcttcctcttcctcttcctcccc 69646 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 69611 ctcttcctcttcctcttcctcttc 69634 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 69605 ctcttcctcttcctcttcctcttc 69628 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 69599 ctcttcctcttcctcttcctcttc 69622 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 69593 ctcttcctcttcctcttcctcttc 69616 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 |||| |||||||||||||||||||| Sbjct: 69586 gctcctcctcttcctcttcctcttc 69610
>ref|XM_812786.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein (MASP) (Tc00.1047053506955.212) partial mRNA Length = 807 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 395 tcttcctcttcctcttcctcttcgtc 370 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||| |||||||| Sbjct: 390 ctcttcctcttcctcttcgtcttcgtc 364
>ref|XM_813012.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053504149.90) partial mRNA Length = 5238 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 2207 tcttcctcttcctcttcctcttcgtc 2182
>gb|AC121774.3| Mus musculus BAC clone RP23-350E1 from chromosome 5, complete sequence Length = 191733 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||||| ||||||||| Sbjct: 144879 ctcttcctcttcctcttcctctttctcccctccc 144846 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 144921 ctcttcctcttcctcttcctcttc 144898 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 144915 ctcttcctcttcctcttcctcttc 144892 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 144909 ctcttcctcttcctcttcctcttc 144886 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 144903 ctcttcctcttcctcttcctcttc 144880 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 144897 ctcttcctcttcctcttcctcttc 144874 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 144891 ctcttcctcttcctcttcctcttc 144868 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 144885 ctcttcctcttcctcttcctcttc 144862 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115471 ctcttcctcttcctcttcctcttc 115448 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115465 ctcttcctcttcctcttcctcttc 115442 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 115459 ctcttcctcttcctcttcctctt 115437 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 115475 cttcctcttcctcttcctcttc 115454 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 144923 tcctcttcctcttcctcttc 144904
>gb|AC127337.4| Mus musculus BAC clone RP23-168F21 from 12, complete sequence Length = 209066 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 6814 ctcttcctcttcctcttcctcttcctcccc 6843 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6808 ctcttcctcttcctcttcctcttc 6831 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6802 ctcttcctcttcctcttcctcttc 6825 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6796 ctcttcctcttcctcttcctcttc 6819 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6790 ctcttcctcttcctcttcctcttc 6813 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6784 ctcttcctcttcctcttcctcttc 6807 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 6780 cttcctcttcctcttcctcttc 6801
>gb|AC121962.3| Mus musculus chromosome UNK clone RP24-255I5, complete sequence Length = 152890 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 45046 ctcttcctcttcctcttcctcttcctcccc 45075 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 45040 ctcttcctcttcctcttcctcttc 45063 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 45034 ctcttcctcttcctcttcctcttc 45057 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 45028 ctcttcctcttcctcttcctcttc 45051 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 45022 ctcttcctcttcctcttcctcttc 45045 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 45016 ctcttcctcttcctcttcctcttc 45039 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 45011 tcttcctcttcctcttcctcttc 45033
>gb|AC142310.1| Pan troglodytes BAC clone RP43-45P13 from 7, complete sequence Length = 197471 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccct 91 ||||||||||||||||||||||| |||||| Sbjct: 169794 tcttcctcttcctcttcctcttcttcccct 169823 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 169787 ctcttcttcttcctcttcctcttc 169810
>gb|AC161500.4| Mus musculus chromosome 7, clone RP23-145H5, complete sequence Length = 223833 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||| ||||||||| Sbjct: 149170 tcctcttcctcttcctcttcttcccctccc 149141
>gb|AC157942.7| Mus musculus BAC clone RP24-118E2 from chromosome 13, complete sequence Length = 173717 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 101762 ctcttcctcttcctcttcctcttcctcccc 101791 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 101756 ctcttcctcttcctcttcctcttc 101779 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 101750 ctcttcctcttcctcttcctcttc 101773 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 101744 ctcttcctcttcctcttcctcttc 101767 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 101738 ctcttcctcttcctcttcctcttc 101761 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 101732 ctcttcctcttcctcttcctcttc 101755 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 101726 ctcttcctcttcctcttcctcttc 101749 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 101720 ctcttcctcttcctcttcctcttc 101743 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 101718 tcctcttcctcttcctcttc 101737
>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii Length = 2336804 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||||||||||| Sbjct: 730491 tcttcctcttcctcttcctcttcgtc 730516
>emb|BX842620.1| Neurospora crassa DNA linkage group V BAC contig B11E5 Length = 191196 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 42192 ctcttcctcttcctcttcctcttcctcccc 42163 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 42216 ctcttcctcttcctcttcctcttc 42193 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 42210 ctcttcctcttcctcttcctcttc 42187 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 42204 ctcttcctcttcctcttcctcttc 42181 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 42198 ctcttcctcttcctcttcctcttc 42175 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 42218 tcctcttcctcttcctcttc 42199
>emb|AL672141.12| Mouse DNA sequence from clone RP23-219C18 on chromosome 11 Contains the 3' end of the Hs3st3a gene for heparan sulfate (glucosamine) 3-O-sulfotransferase 3A and a CpG island, complete sequence Length = 153658 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 102529 ctcttcctcttcctcttcctcttcctcccc 102558 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 102523 ctcttcctcttcctcttcctcttc 102546 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 102517 ctcttcctcttcctcttcctcttc 102540 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 102512 tcttcctcttcctcttcctcttc 102534
>ref|XM_662210.1| Cryptosporidium hominis TU502 protein kinase (Chro.70144), partial mRNA Length = 2604 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 2406 ctcttcctcttcctcttcctcttcctcccc 2435 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2400 ctcttcctcttcctcttcctcttc 2423 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2394 ctcttcctcttcctcttcctcttc 2417 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2388 ctcttcctcttcctcttcctcttc 2411 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2382 ctcttcctcttcctcttcctcttc 2405 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2376 ctcttcctcttcctcttcctcttc 2399 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2370 ctcttcctcttcctcttcctcttc 2393 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2364 ctcttcctcttcctcttcctcttc 2387 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2358 ctcttcctcttcctcttcctcttc 2381 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2352 ctcttcctcttcctcttcctcttc 2375 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2346 ctcttcctcttcctcttcctcttc 2369 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2340 ctcttcctcttcctcttcctcttc 2363 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2334 ctcttcctcttcctcttcctcttc 2357 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2328 ctcttcctcttcctcttcctcttc 2351 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2322 ctcttcctcttcctcttcctcttc 2345 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2316 ctcttcctcttcctcttcctcttc 2339 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2310 ctcttcctcttcctcttcctcttc 2333 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2304 ctcttcctcttcctcttcctcttc 2327 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 2299 tcttcctcttcctcttcctcttc 2321
>gb|AC154542.2| Mus musculus BAC clone RP23-458O22 from chromosome 17, complete sequence Length = 191836 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 15051 ctcttcctcttcctcttcctcttcctcccc 15080 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 15047 cttcctcttcctcttcctcttc 15068
>gb|AC153818.5| Mus musculus 6 BAC RP23-345F4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 193079 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 169679 ctcttcctcttcctcttcctcttcctcccc 169708 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 169673 ctcttcctcttcctcttcctcttc 169696 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 169667 ctcttcctcttcctcttcctcttc 169690 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 169661 ctcttcctcttcctcttcctcttc 169684 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 169655 ctcttcctcttcctcttcctcttc 169678 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 169649 ctcttcctcttcctcttcctcttc 169672 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 169644 tcttcctcttcctcttcctcttc 169666
>emb|BX537288.7| Zebrafish DNA sequence from clone DKEY-264B2 in linkage group 2, complete sequence Length = 114103 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 59 agctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||||| Sbjct: 27309 agctcttcctcttcctcttcctcttc 27334 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 27317 ctcttcctcttcctcttcct 27336
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 59 agctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||||| Sbjct: 26423413 agctcttcctcttcctcttcctcttc 26423438 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 19412161 tcttcctcttcctcttcctcttc 19412139 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 9961670 ctcttcctcttcctcttcctctt 9961648 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 27566911 cttcctcttcctcttcctcttc 27566890 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctctt 83 |||||||||||||||||||||| Sbjct: 26996459 tcttcctcttcctcttcctctt 26996480 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 23280227 cttcctcttcctcttcctcttc 23280248 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 9961674 cttcctcttcctcttcctcttc 9961653 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctct 82 |||||||||||||||||||||| Sbjct: 1444181 ctcttcctcttcctcttcctct 1444160 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 71 tcctcttcctcttcgtcccctccca 95 |||||||||||||| |||||||||| Sbjct: 31734901 tcctcttcctcttcctcccctccca 31734877 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 26423421 ctcttcctcttcctcttcctc 26423441 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 19412156 ctcttcctcttcctcttcctc 19412136 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||||||||| |||||| Sbjct: 24232726 ctcttcctcttcctctttctcttc 24232749 Score = 40.1 bits (20), Expect = 5.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 57 gcagctcttcctcttcctcttcctcttcgtcc 88 ||||||||||||| ||||| ||||| |||||| Sbjct: 9447193 gcagctcttcctcctcctcctcctcctcgtcc 9447162 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 7550515 ctcttcctcttcctcttcttcttc 7550492
>gb|AC158528.1| Mus musculus BAC clone RP23-259G7 from chromosome 8, complete sequence Length = 180194 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| || |||||| Sbjct: 177924 ctcttcctcttcctcttcctcttcctctcctccc 177891 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 177978 ctcttcctcttcctcttcctcttc 177955 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 177972 ctcttcctcttcctcttcctcttc 177949 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 177966 ctcttcctcttcctcttcctcttc 177943 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 177960 ctcttcctcttcctcttcctcttc 177937 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 177954 ctcttcctcttcctcttcctcttc 177931 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 177948 ctcttcctcttcctcttcctcttc 177925 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 177942 ctcttcctcttcctcttcctcttc 177919 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 177936 ctcttcctcttcctcttcctcttc 177913 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 177930 ctcttcctcttcctcttcctcttc 177907 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 178027 ctcttcctcttcctcttcctctt 178005 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 178004 tcttcctcttcctcttcctcttc 177982 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 177999 ctcttcctcttcctcttcctc 177979 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 177980 tcctcttcctcttcctcttc 177961 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctc 81 |||||||||||||||||||| Sbjct: 51397 tcttcctcttcctcttcctc 51416
>gb|AC091312.8| Mus musculus chromosome 3, clone RP23-333N1, complete sequence Length = 199026 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||||||| || |||||| Sbjct: 90338 ctcttcctcttcctcttcctcttcctctcctccc 90305 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 90392 ctcttcctcttcctcttcctcttc 90369 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 90386 ctcttcctcttcctcttcctcttc 90363 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 90380 ctcttcctcttcctcttcctcttc 90357 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 90374 ctcttcctcttcctcttcctcttc 90351 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 90368 ctcttcctcttcctcttcctcttc 90345 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 90362 ctcttcctcttcctcttcctcttc 90339 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 90356 ctcttcctcttcctcttcctcttc 90333 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 90350 ctcttcctcttcctcttcctcttc 90327 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 90344 ctcttcctcttcctcttcctcttc 90321
>dbj|AP004676.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1003_B06 Length = 131956 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 59 agctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||||| Sbjct: 23329 agctcttcctcttcctcttcctcttc 23354 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 23337 ctcttcctcttcctcttcctc 23357
>emb|AL929254.12| Mouse DNA sequence from clone RP23-456I1 on chromosome 2, complete sequence Length = 222104 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 192309 ctcttcctcttcctcttcctcttcctcccc 192338 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 192303 ctcttcctcttcctcttcctcttc 192326 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 192299 cttcctcttcctcttcctcttc 192320
>dbj|AK066320.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013066H16, full insert sequence Length = 977 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 59 agctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||||| Sbjct: 53 agctcttcctcttcctcttcctcttc 78 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 61 ctcttcctcttcctcttcctc 81
>gb|AC125319.5| Mus musculus BAC clone RP23-472L3 from 5, complete sequence Length = 186202 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccct 91 ||||||||||||||||||||||| |||||| Sbjct: 121704 tcttcctcttcctcttcctcttcttcccct 121733
>gb|AC153593.4| Mus musculus 6 BAC RP23-131B11 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 205164 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||| |||||||| ||||||||| Sbjct: 172301 ctcttcctcttcctcctcctcttcctcccctccc 172334
>gb|AC138272.11| Mus musculus chromosome 7, clone RP23-91H13, complete sequence Length = 234237 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttcgtcccctccc 94 |||||||||||||||||||| ||||||||| Sbjct: 151798 tcctcttcctcttcctcttcttcccctccc 151827
>gb|AC156506.4| Mus musculus 6 BAC RP24-266P6 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 164284 Score = 52.0 bits (26), Expect = 0.001 Identities = 32/34 (94%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||| |||||||| ||||||||| Sbjct: 156968 ctcttcctcttcctcctcctcttcctcccctccc 156935
>gb|AC154471.2| Mus musculus BAC clone RP23-195D3 from chromosome 14, complete sequence Length = 192057 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 109867 ctcttcctcttcctcttcctcttcctcccc 109896 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109861 ctcttcctcttcctcttcctcttc 109884 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109855 ctcttcctcttcctcttcctcttc 109878 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109849 ctcttcctcttcctcttcctcttc 109872 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109843 ctcttcctcttcctcttcctcttc 109866 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109837 ctcttcctcttcctcttcctcttc 109860 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109831 ctcttcctcttcctcttcctcttc 109854 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109825 ctcttcctcttcctcttcctcttc 109848 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109819 ctcttcctcttcctcttcctcttc 109842 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109813 ctcttcctcttcctcttcctcttc 109836 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109807 ctcttcctcttcctcttcctcttc 109830 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109801 ctcttcctcttcctcttcctcttc 109824 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 109796 tcttcctcttcctcttcctcttc 109818 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 98088 tcctcttcctcttcctcttc 98069
>gb|AC003042.1|AC003042 Homo sapiens chromosome 17, clone HCIT75G16, complete sequence Length = 102818 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 68 tcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||||| Sbjct: 15366 tcttcctcttcctcttcgtcccctcc 15391 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 23588 ctcttcctcttcttcttcctcttc 23565 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 23582 ctcttcttcttcctcttcctcttc 23559
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 59 agctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||||| Sbjct: 145479 agctcttcctcttcctcttcctcttc 145504 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 145487 ctcttcctcttcctcttcctc 145507
>emb|AL844846.11| Mouse DNA sequence from clone RP23-358I19 on chromosome 2, complete sequence Length = 209013 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 43902 ctcttcctcttcctcttcctcttcctcccc 43931 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 43896 ctcttcctcttcctcttcctcttc 43919 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 43892 cttcctcttcctcttcctcttc 43913
>emb|CT030001.16| Mouse DNA sequence from clone RP23-225D15 on chromosome 17, complete sequence Length = 180961 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 3175 ctcttcctcttcctcttcctcttcctcccc 3146 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 3179 cttcctcttcctcttcctcttc 3158
>emb|AL845455.7| Mouse DNA sequence from clone RP23-325E4 on chromosome 2, complete sequence Length = 143689 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 |||||||||||||||||||||||| ||||| Sbjct: 77670 ctcttcctcttcctcttcctcttcctcccc 77641 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 77675 tcttcctcttcctcttcctcttc 77653
>gb|AC164647.3| Mus musculus BAC clone RP23-463P13 from chromosome 16, complete sequence Length = 181953 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 113942 ctcttcctcttcctcttcctcttcctctcctcc 113910 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 113947 tcttcctcttcctcttcctcttc 113925
>gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, complete sequence Length = 218917 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 112841 ctcttcctcttcctcttcctcttcctctcctcc 112809 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 112853 ctcttcctcttcctcttcctcttc 112830 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 112847 ctcttcctcttcctcttcctcttc 112824 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||| |||||||||||| Sbjct: 112865 ctcttcctctttctcttcctcttc 112842 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||| |||||||||||||||||| Sbjct: 112859 ctctttctcttcctcttcctcttc 112836
>gb|AC123618.26| Mus musculus chromosome 12, clone RP23-38N23, complete sequence Length = 201596 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 136714 ctcttcctcttcctcttcctcttcctctcctcc 136682 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 136726 ctcttcctcttcctcttcctcttc 136703 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 136720 ctcttcctcttcctcttcctcttc 136697 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 136731 tcttcctcttcctcttcctcttc 136709 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctct 82 ||||||||||||||||||||| Sbjct: 59073 tcttcctcttcctcttcctct 59053
>gb|AC161496.6| Mus musculus chromosome 3, clone RP23-119A9, complete sequence Length = 203655 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 660 ctcttcctcttcctcttcctcttcctctcctcc 692 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 654 ctcttcctcttcctcttcctcttc 677 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 648 ctcttcctcttcctcttcctcttc 671 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||| |||||||||||||||||| Sbjct: 642 ctctttctcttcctcttcctcttc 665 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||| |||||||||||| Sbjct: 636 ctcttcctctttctcttcctcttc 659
>gb|AC113007.11| Mus musculus chromosome 3, clone RP23-349H13, complete sequence Length = 180852 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 129582 ctcttcctcttcctcttcctcttcctctcctcc 129614 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129576 ctcttcctcttcctcttcctcttc 129599 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129570 ctcttcctcttcctcttcctcttc 129593 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129564 ctcttcctcttcctcttcctcttc 129587 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129558 ctcttcctcttcctcttcctcttc 129581 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129552 ctcttcctcttcctcttcctcttc 129575 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129546 ctcttcctcttcctcttcctcttc 129569 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129540 ctcttcctcttcctcttcctcttc 129563 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129534 ctcttcctcttcctcttcctcttc 129557 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129528 ctcttcctcttcctcttcctcttc 129551 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129522 ctcttcctcttcctcttcctcttc 129545 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129516 ctcttcctcttcctcttcctcttc 129539 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 129511 tcttcctcttcctcttcctcttc 129533
>gb|AC162902.4| Mus musculus BAC clone RP23-448D23 from chromosome 12, complete sequence Length = 190357 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| ||| |||| Sbjct: 16893 ctcttcctcttcctcttcctcttcttcctctcc 16925 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 16887 ctcttcctcttcctcttcctcttc 16910 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 16881 ctcttcctcttcctcttcctcttc 16904 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 16875 ctcttcctcttcctcttcctcttc 16898 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 16869 ctcttcctcttcctcttcctcttc 16892 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 16863 ctcttcctcttcctcttcctcttc 16886 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 16858 tcttcctcttcctcttcctcttc 16880
>gb|AC096856.7| Oryza sativa chromosome 3 BAC OSJNBa0075M12 genomic sequence, complete sequence Length = 130272 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 51808 gctcttcctcttcctcttcctcttc 51832 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 51815 ctcttcctcttcctcttcctcttc 51838
>gb|AC124417.5| Mus musculus BAC clone RP24-313G11 from chromosome 18, complete sequence Length = 181811 Score = 50.1 bits (25), Expect = 0.006 Identities = 32/33 (96%), Gaps = 1/33 (3%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| |||||||| Sbjct: 98945 ctcttcctcttcctcttcctcttc-tcccctcc 98976 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 98943 tcctcttcctcttcctcttc 98962
>gb|AC144797.2| Mus musculus BAC clone RP24-349B2 from chromosome 16, complete sequence Length = 129045 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 104716 ctcttcctcttcctcttcctcttcctctcctcc 104748 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 104711 tcttcctcttcctcttcctcttc 104733
>gb|AC135962.4| Mus musculus BAC clone RP23-342H15 from chromosome 16, complete sequence Length = 202525 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 181801 ctcttcctcttcctcttcctcttcttctcctcc 181833 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 181795 ctcttcctcttcctcttcctcttc 181818 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 181790 tcttcctcttcctcttcctcttc 181812
>gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, complete sequence Length = 248320 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 200243 gctcttcctcttcctcttcctcttc 200267 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200280 ctcttcctcttcctcttcctcttc 200303 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200274 ctcttcctcttcctcttcctcttc 200297 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200268 ctcttcctcttcctcttcctcttc 200291 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200262 ctcttcctcttcctcttcctcttc 200285 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200256 ctcttcctcttcctcttcctcttc 200279 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200250 ctcttcctcttcctcttcctcttc 200273 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 200286 ctcttcctcttcctcttcct 200305
>gb|AC121119.12| Mus musculus chromosome 1, clone RP23-395D10, complete sequence Length = 221436 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 217402 gctcttcctcttcctcttcctcttc 217426 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 217433 ctcttcctcttcctcttcctcttc 217456 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 217427 ctcttcctcttcctcttcctcttc 217450 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 217421 ctcttcctcttcctcttcctcttc 217444 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 217415 ctcttcctcttcctcttcctcttc 217438 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 217409 ctcttcctcttcctcttcctcttc 217432 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 217439 ctcttcctcttcctcttcttcttc 217462
>gb|AC116107.10| Mus musculus chromosome 1, clone RP23-28F18, complete sequence Length = 262581 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 72923 ctcttcctcttcctcttcctcttcttctcctcc 72955 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 72917 ctcttcctcttcctcttcctcttc 72940 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 72911 ctcttcctcttcctcttcctcttc 72934 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 72906 tcttcctcttcctcttcctcttc 72928 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 109470 ctcttcctcttcctcttcctc 109490 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 109468 tcctcttcctcttcctcttc 109487
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 35050907 gctcttcctcttcctcttcctcttc 35050931 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 35050914 ctcttcctcttcctcttcctcttc 35050937 Score = 44.1 bits (22), Expect = 0.36 Identities = 28/30 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 ||||||||||||||| |||||||| ||||| Sbjct: 31319465 ctcttcctcttcctcctcctcttcttcccc 31319436 Score = 40.1 bits (20), Expect = 5.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccctcc 93 |||||||| ||||| |||||||||||| |||| Sbjct: 20292540 tcttcctcctcctcctcctcttcgtcctctcc 20292571
>gb|AC114645.9| Mus musculus chromosome 9, clone RP24-131G14, complete sequence Length = 214734 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||| ||||| |||||||| Sbjct: 121257 ctcttcctcttcctcttcttcttcttcccctcc 121289 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 121253 cttcctcttcctcttcctcttc 121274
>gb|AC165966.3| Mus musculus BAC clone RP23-259L2 from chromosome 17, complete sequence Length = 194944 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttcgtcccct 91 |||||||||||||||||||||| |||||| Sbjct: 94535 cttcctcttcctcttcctcttcttcccct 94507
>gb|AC167229.4| Mus musculus BAC RP24-337D17 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 197711 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 53348 ctcttcctcttcctcttcctcttcctctcctcc 53380 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 53342 ctcttcctcttcctcttcctcttc 53365 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 53340 tcctcttcctcttcctcttc 53359
>ref|XM_385493.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05317.1) partial mRNA Length = 5460 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 4003 gctcttcctcttcctcttcctcttc 3979 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3996 ctcttcctcttcctcttcctcttc 3973 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3990 ctcttcctcttcctcttcctcttc 3967 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3984 ctcttcctcttcctcttcctcttc 3961 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3978 ctcttcctcttcctcttcctcttc 3955 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3972 ctcttcctcttcctcttcctcttc 3949 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3966 ctcttcctcttcctcttcctcttc 3943 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3960 ctcttcctcttcctcttcctcttc 3937 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3954 ctcttcctcttcctcttcctcttc 3931 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3948 ctcttcctcttcctcttcctcttc 3925 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3942 ctcttcctcttcctcttcctcttc 3919 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3936 ctcttcctcttcctcttcctcttc 3913 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3930 ctcttcctcttcctcttcctcttc 3907 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3924 ctcttcctcttcctcttcctcttc 3901 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3918 ctcttcctcttcctcttcctcttc 3895 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3912 ctcttcctcttcctcttcctcttc 3889 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3906 ctcttcctcttcctcttcctcttc 3883 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 3900 ctcttcctcttcctcttcctcttc 3877 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 3894 ctcttcctcttcctcttcttcttc 3871
>gb|AC140436.3| Mus musculus BAC clone RP23-85O2 from chromosome 9, complete sequence Length = 142560 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 95192 ctcttcctcttcctcttcctcttcctctcctcc 95160 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 95194 tcctcttcctcttcctcttc 95175
>gb|AC124352.2| Mus musculus BAC clone RP24-477C23 from chromosome 9, complete sequence Length = 177886 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 130811 ctcttcctcttcctcttcctcttcctctcctcc 130779 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 130813 tcctcttcctcttcctcttc 130794
>gb|AC122471.4| Mus musculus BAC clone RP24-322M5 from chromosome 2, complete sequence Length = 206592 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||||| ||| ||||| Sbjct: 148296 tcttcctcttcctcttcctcttcatcctctccc 148264
>gb|AC125351.3| Mus musculus BAC clone RP23-442M3 from chromosome 12, complete sequence Length = 188024 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtccc 89 |||||||||||||||||||||||| |||| Sbjct: 91087 ctcttcctcttcctcttcctcttcctccc 91059 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 91093 ctcttcctcttcctcttcctcttc 91070
>gb|AC122378.4| Mus musculus BAC clone RP23-474C9 from chromosome 15, complete sequence Length = 203662 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 102829 ctcttcctcttcctcttcctcttcctctcctcc 102861 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 173045 ctcttcctcttcctcttcctctt 173023 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 102824 tcttcctcttcctcttcctcttc 102846 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ttcctcttcctcttcctcttc 84 ||||||||||||||||||||| Sbjct: 173048 ttcctcttcctcttcctcttc 173028
>gb|AC132600.3| Mus musculus BAC clone RP24-134A5 from chromosome 3, complete sequence Length = 160339 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 73650 ctcttcctcttcctcttcctcttcctctcctcc 73618 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 73704 ctcttcctcttcctcttcctcttc 73681 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 73698 ctcttcctcttcctcttcctcttc 73675 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 73692 ctcttcctcttcctcttcctcttc 73669 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 73686 ctcttcctcttcctcttcctcttc 73663 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 73680 ctcttcctcttcctcttcctcttc 73657 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 73674 ctcttcctcttcctcttcctcttc 73651 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 73668 ctcttcctcttcctcttcctcttc 73645 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 73662 ctcttcctcttcctcttcctcttc 73639 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 73656 ctcttcctcttcctcttcctcttc 73633
>gb|AC121918.3| Mus musculus BAC clone RP24-195D23 from chromosome 2, complete sequence Length = 179270 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 77555 ctcttcctcttcctcttcctcttcctctcctcc 77523 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 77579 ctcttcctcttcctcttcctcttc 77556 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 77573 ctcttcctcttcctcttcctcttc 77550 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 77567 ctcttcctcttcctcttcctcttc 77544 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 77561 ctcttcctcttcctcttcctcttc 77538 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 77584 tcttcctcttcctcttcctcttc 77562
>gb|AC126265.3| Mus musculus BAC clone RP23-383O12 from chromosome 16, complete sequence Length = 186172 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 31007 ctcttcctcttcctcttcctcttcttctcctcc 31039 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 100257 ctcttcctcttcctcttcctcttc 100234 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 31001 ctcttcctcttcctcttcctcttc 31024 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 30996 tcttcctcttcctcttcctcttc 31018 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 100261 cttcctcttcctcttcctcttc 100240 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 100251 ctcttcctcttcctcttcctc 100231
>gb|AC124194.3| Mus musculus BAC clone RP23-277L21 from 2, complete sequence Length = 181676 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 44998 gctcttcctcttcctcttcctcttc 45022 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctc 81 |||||||||||||||||||||| Sbjct: 44425 gctcttcctcttcctcttcctc 44446 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctc 81 |||||||||||||||||||||| Sbjct: 44110 gctcttcctcttcctcttcctc 44131 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 45005 ctcttcctcttcctcttcctc 45025
>ref|XM_883897.1| Candida albicans SC5314 hypothetical protein (CaJ7.0440) partial mRNA Length = 2238 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 307 gctcttcctcttcctcttcctcttc 283 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 300 ctcttcctcttcctcttcttcttc 277
>ref|XM_710152.1| Candida albicans SC5314 hypothetical protein (CaO19.7197) partial mRNA Length = 2238 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 307 gctcttcctcttcctcttcctcttc 283 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 300 ctcttcctcttcctcttcttcttc 277
>gb|AC121783.2| Mus musculus BAC clone RP23-370I9 from 18, complete sequence Length = 184366 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 20513 gctcttcctcttcctcttcctcttc 20537 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 20520 ctcttcctcttcctcttcctc 20540 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||| |||||||||||||| Sbjct: 20406 ctcttcctcctcctcttcctcttc 20429
>gb|AF271358.1| Oryza sativa (indica cultivar-group) phospholipase D (RPLD5) gene, complete cds Length = 6300 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 1368 gctcttcctcttcctcttcctcttc 1344
>gb|AC113269.13| Mus musculus chromosome 15, clone RP23-372F2, complete sequence Length = 202155 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| ||| |||| Sbjct: 112422 ctcttcctcttcctcttcctcttcctcctctcc 112454 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 112416 ctcttcctcttcctcttcctcttc 112439 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 112410 ctcttcctcttcctcttcctcttc 112433 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 112404 ctcttcctcttcctcttcctcttc 112427 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 112398 ctcttcctcttcctcttcctcttc 112421 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 112392 ctcttcctcttcctcttcctcttc 112415 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 112386 ctcttcctcttcctcttcctcttc 112409
>gb|AC103627.6| Mus musculus chromosome 1, clone RP24-241N3, complete sequence Length = 201487 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 127365 ctcttcctcttcctcttcctcttcttctcctcc 127397 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127553 ctcttcctcttcctcttcctcttc 127576 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127547 ctcttcctcttcctcttcctcttc 127570 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127541 ctcttcctcttcctcttcctcttc 127564 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127535 ctcttcctcttcctcttcctcttc 127558 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127359 ctcttcctcttcctcttcctcttc 127382 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127353 ctcttcctcttcctcttcctcttc 127376 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 127348 tcttcctcttcctcttcctcttc 127370 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 127559 ctcttcctcttcctcttcctc 127579 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 127533 tcctcttcctcttcctcttc 127552 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 127341 ctcttcttcttcctcttcctcttc 127364
>gb|AC145450.4| Mus musculus strain C57BL/6J clone rp23-430i3, complete sequence Length = 208207 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||||| ||| ||||| Sbjct: 76394 tcttcctcttcctcttcctcttcatcctctccc 76426
>gb|AC162365.5| Mus musculus chromosome 19, clone RP23-75P11, complete sequence Length = 157286 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 17332 ctcttcctcttcctcttcctcttcctctcctcc 17364 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 17326 ctcttcctcttcctcttcctcttc 17349 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 17320 ctcttcctcttcctcttcctcttc 17343 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 17314 ctcttcctcttcctcttcctcttc 17337 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 17308 ctcttcctcttcctcttcctcttc 17331 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 17302 ctcttcctcttcctcttcctcttc 17325 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 17296 ctcttcctcttcctcttcctcttc 17319 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 17290 ctcttcctcttcctcttcctcttc 17313 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 17284 ctcttcctcttcctcttcctcttc 17307 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 17278 ctcttcctcttcctcttcctcttc 17301 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 17276 tcctcttcctcttcctcttc 17295
>gb|AC090007.8| Mus Musculus Strain C57BL6/J chromosome 8 BAC, RP23-156J8, complete sequence Length = 188802 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||||| ||| ||||| Sbjct: 26188 tcttcctcttcctcttcctcttcttcctctccc 26156
>emb|X76078.1|SCGAL1 S.cerevisiae (alphaS288C) GAL1, FUR4 and CAL1 genes Length = 33117 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcg 85 ||||||||||||||||||||||||| Sbjct: 22721 ctcttcctcttcctcttcctcttcg 22697
>gb|AC162948.4| Mus musculus BAC clone RP23-14N2 from chromosome 9, complete sequence Length = 221791 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 73441 ctcttcctcttcctcttcctcttcctctcctcc 73473 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 73439 tcctcttcctcttcctcttc 73458
>gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, complete sequence Length = 223809 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 200647 gctcttcctcttcctcttcctcttc 200623 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200640 ctcttcctcttcctcttcctcttc 200617 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200634 ctcttcctcttcctcttcctcttc 200611 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200628 ctcttcctcttcctcttcctcttc 200605 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200622 ctcttcctcttcctcttcctcttc 200599 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200616 ctcttcctcttcctcttcctcttc 200593 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 200610 ctcttcctcttcctcttcctcttc 200587 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 200604 ctcttcctcttcctcttcct 200585
>gb|AC159910.6| Mus musculus 10 BAC RP23-353C6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 219861 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 35486 ctcttcctcttcctcttcctcttcctctcctcc 35454 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 35492 ctcttcctcttcctcttcctcttc 35469 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 35494 tcctcttcctcttcctcttc 35475
>gb|AC139053.15| Mus musculus chromosome 1, clone RP23-2I19, complete sequence Length = 232850 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 226331 gctcttcctcttcctcttcctcttc 226307 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 226324 ctcttcctcttcctcttcctcttc 226301 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 226318 ctcttcctcttcctcttcctcttc 226295 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 226312 ctcttcctcttcctcttcctcttc 226289 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 226306 ctcttcctcttcctcttcctcttc 226283 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 226300 ctcttcctcttcctcttcctcttc 226277 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 226294 ctcttcctcttcctcttcttcttc 226271
>gb|AC090287.9| Homo sapiens chromosome 17, clone RP11-218F4, complete sequence Length = 90543 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||| |||||||| Sbjct: 26056 tcctcttcctcttcctcttcctcccctcc 26028 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 26054 ctcttcctcttcctcttcctc 26034
>gb|AC155312.2| Mus musculus BAC clone RP23-411F11 from chromosome 12, complete sequence Length = 197795 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| ||| |||| Sbjct: 104458 ctcttcctcttcctcttcctcttcttcctctcc 104490 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 104452 ctcttcctcttcctcttcctcttc 104475 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 104446 ctcttcctcttcctcttcctcttc 104469 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 104440 ctcttcctcttcctcttcctcttc 104463 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 104434 ctcttcctcttcctcttcctcttc 104457 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 104428 ctcttcctcttcctcttcctcttc 104451 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 104423 tcttcctcttcctcttcctcttc 104445
>ref|XM_628302.1| Cryptosporidium parvum Iowa II Ser/Thr protein kinase (cgd7_1190), partial mRNA Length = 2484 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccc 90 ||||||||||||||||||||||| ||||| Sbjct: 2287 tcttcctcttcctcttcctcttcctcccc 2315 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 2292 ctcttcctcttcctcttcctc 2312
>gb|AC140776.6| Mus musculus chromosome 1, clone RP23-284K5, complete sequence Length = 223196 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 221821 gctcttcctcttcctcttcctcttc 221845 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 221864 ctcttcctcttcctcttcctcttc 221887 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 221858 ctcttcctcttcctcttcctcttc 221881 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 221852 ctcttcctcttcctcttcctcttc 221875 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 221846 ctcttcctcttcctcttcctcttc 221869 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 221840 ctcttcctcttcctcttcctcttc 221863 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 221834 ctcttcctcttcctcttcctcttc 221857 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 221828 ctcttcctcttcctcttcctcttc 221851 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 221870 ctcttcctcttcctcttcttcttc 221893
>gb|AF332579.1|AF332579 Mus musculus small nuclear ribonucleoprotein N (Snrpn) gene, upstream reading frame exons U1, 1, 2, and 3 Length = 80730 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcg 85 ||||||||||||||||||||||||| Sbjct: 10218 ctcttcctcttcctcttcctcttcg 10242 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 10212 ctcttcctcttcctcttcctcttc 10235 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 10210 tcctcttcctcttcctcttc 10229
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtccc 89 |||||||||||||||||||||||| |||| Sbjct: 13361366 ctcttcctcttcctcttcctcttcctccc 13361394 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 13361360 ctcttcctcttcctcttcctcttc 13361383 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctct 82 |||||||||||||||||||||| Sbjct: 27453873 ctcttcctcttcctcttcctct 27453852 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 22038714 cttcctcttcctcttcctcttc 22038693 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 35456565 ctcttcctcttcctcttcctc 35456545 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctct 82 ||||||||||||||||||||| Sbjct: 33981169 tcttcctcttcctcttcctct 33981149 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 27707006 ctcttcctcttcctcttcctc 27706986 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 35456567 tcctcttcctcttcctcttc 35456548 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 35456356 tcctcttcctcttcctcttc 35456375 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 27707008 tcctcttcctcttcctcttc 27706989 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 27453875 tcctcttcctcttcctcttc 27453856 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 13707070 tcctcttcctcttcctcttc 13707051
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 35140979 gctcttcctcttcctcttcctcttc 35141003 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 35140986 ctcttcctcttcctcttcctcttc 35141009 Score = 44.1 bits (22), Expect = 0.36 Identities = 28/30 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccc 90 ||||||||||||||| |||||||| ||||| Sbjct: 31409981 ctcttcctcttcctcctcctcttcttcccc 31409952 Score = 40.1 bits (20), Expect = 5.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccctcc 93 |||||||| ||||| |||||||||||| |||| Sbjct: 20285569 tcttcctcctcctcctcctcttcgtcctctcc 20285600
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttcgtcccct 91 |||||||||||||||||||||| |||||| Sbjct: 15632083 cttcctcttcctcttcctcttcctcccct 15632111 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 ||||||||||||||||||||| ||||| Sbjct: 36280564 ctcttcctcttcctcttcctcgtcgtc 36280590 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctct 82 |||||||||||||||||||||| Sbjct: 42240173 ctcttcctcttcctcttcctct 42240194 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 15632087 ctcttcctcttcctcttcctc 15632107 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctct 82 ||||||||||||||||||||| Sbjct: 2644972 tcttcctcttcctcttcctct 2644952 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 42240171 tcctcttcctcttcctcttc 42240190 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 36888139 ctcttcctcttcctcttcct 36888158 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctc 81 |||||||||||||||||||| Sbjct: 36290190 tcttcctcttcctcttcctc 36290171 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 36280562 tcctcttcctcttcctcttc 36280581 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||| ||||||||||||| Sbjct: 33690417 ctcttcctctgcctcttcctcttc 33690440 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 32321476 ctcttcctcttcctcttcatcttc 32321499 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 58 cagctcttcctcttcctcttcctc 81 |||||||||||||| ||||||||| Sbjct: 24888576 cagctcttcctcttgctcttcctc 24888599 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctct 82 |||||||||||||||||||| Sbjct: 24111280 cttcctcttcctcttcctct 24111299 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 11492078 ctcttcctcttcctcttcct 11492059 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcg 85 ||||||||| |||||||||||||| Sbjct: 8133565 tcttcctctccctcttcctcttcg 8133542
>gb|AC154289.1| Mus musculus BAC clone RP23-449E11 from chromosome 16, complete sequence Length = 191617 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| ||| |||| Sbjct: 65108 ctcttcctcttcctcttcctcttcctcctctcc 65076 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 65138 ctcttcctcttcctcttcctcttc 65115 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 65132 ctcttcctcttcctcttcctcttc 65109 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 65126 ctcttcctcttcctcttcctcttc 65103 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 65120 ctcttcctcttcctcttcctcttc 65097 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 65114 ctcttcctcttcctcttcctcttc 65091 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ttcctcttcctcttcctcttc 84 ||||||||||||||||||||| Sbjct: 65141 ttcctcttcctcttcctcttc 65121 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 44541 tcctcttcctcttcctcttc 44522
>gb|AC159375.1| Pan troglodytes BAC clone CH251-557H18 from chromosome unknown, complete sequence Length = 184511 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 15465 ctcttcctcttcctcttcctcttcttctcctcc 15497 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 15460 tcttcctcttcctcttcctcttc 15482 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 15453 ctcttcttcttcctcttcctcttc 15476
>gb|AC046145.16|AC046145 Mus musculus 7 BAC RP23-306D24 (Roswell Park Cancer Institute Mouse BAC Library) complete sequence Length = 188606 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcg 85 ||||||||||||||||||||||||| Sbjct: 7596 ctcttcctcttcctcttcctcttcg 7572 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7602 ctcttcctcttcctcttcctcttc 7579 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 7604 tcctcttcctcttcctcttc 7585
>gb|AF516327.1| Mus musculus strain WB stem cell factor (Kitl) gene, intron 6, partial sequence Length = 408 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 166 ctcttcctcttcctcttcctcttcctctcctcc 198 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 160 ctcttcctcttcctcttcctcttc 183 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 154 ctcttcctcttcctcttcctcttc 177 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 152 tcctcttcctcttcctcttc 171
>gb|AF516326.1| Mus musculus strain C57BL/6 stem cell factor (Kitl) gene, intron 6, partial sequence Length = 450 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 208 ctcttcctcttcctcttcctcttcctctcctcc 240 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 202 ctcttcctcttcctcttcctcttc 225 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 200 tcctcttcctcttcctcttc 219
>gb|AC018634.3|AC018634 Human Chromosome 7 clone RP11-243E12, complete sequence Length = 174241 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||||| ||| ||||| Sbjct: 145198 tcttcctcttcctcttcctcttcttcctctccc 145230 Score = 48.1 bits (24), Expect = 0.023 Identities = 30/32 (93%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccctcc 93 ||||||||||||||||||||||| || ||||| Sbjct: 145726 tcttcctcttcctcttcctcttcttctcctcc 145757 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 145333 tcttcctcttcctcttcctcttc 145355 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtc 87 |||||||||||||||||| |||||||| Sbjct: 145063 ctcttcctcttcctcttcttcttcgtc 145089 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 36987 ctcttcctcttcctcttcctc 37007 Score = 40.1 bits (20), Expect = 5.7 Identities = 29/32 (90%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccctcc 93 ||||| ||||||||||||||||| || ||||| Sbjct: 145417 tcttcttcttcctcttcctcttcttctcctcc 145448 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 145311 ctcttcttcttcctcttcctcttc 145334 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 145191 ctcttcttcttcctcttcctcttc 145214
>dbj|AP002968.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0416G11 Length = 138858 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttcgtcccct 91 |||||||||||||||||||||| |||||| Sbjct: 69980 cttcctcttcctcttcctcttcctcccct 70008 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 69984 ctcttcctcttcctcttcctc 70004
>emb|AL929153.11| Mouse DNA sequence from clone RP23-55C8 on chromosome 2, complete sequence Length = 116887 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 18855 gctcttcctcttcctcttcctcttc 18831 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctc 81 |||||||||||||||||||||| Sbjct: 19743 gctcttcctcttcctcttcctc 19722 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctc 81 |||||||||||||||||||||| Sbjct: 19428 gctcttcctcttcctcttcctc 19407 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 18848 ctcttcctcttcctcttcctc 18828
>gb|AC153859.6| Mus musculus 10 BAC RP23-135F12 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 222182 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtccc 89 |||||||||||||||||||||||| |||| Sbjct: 151297 ctcttcctcttcctcttcctcttcctccc 151325 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 151291 ctcttcctcttcctcttcctcttc 151314 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 151285 ctcttcctcttcctcttcctcttc 151308 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 151279 ctcttcctcttcctcttcctcttc 151302 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 151273 ctcttcctcttcctcttcctcttc 151296 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 151267 ctcttcctcttcctcttcctcttc 151290 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 151261 ctcttcctcttcctcttcctcttc 151284 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 151255 ctcttcctcttcctcttcctcttc 151278 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 151253 tcctcttcctcttcctcttc 151272
>dbj|AK069703.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023027C22, full insert sequence Length = 2733 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 106 gctcttcctcttcctcttcctcttc 82 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99 ctcttcctcttcctcttcctcttc 76
>gb|AC117766.6| Mus musculus chromosome 1, clone RP24-507L6, complete sequence Length = 190180 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 141170 gctcttcctcttcctcttcctcttc 141146 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 141163 ctcttcctcttcctcttcctcttc 141140 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 141157 ctcttcctcttcctcttcctcttc 141134 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 141151 ctcttcctcttcctcttcctcttc 141128 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 141145 ctcttcctcttcctcttcctcttc 141122 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 141139 ctcttcctcttcctcttcctcttc 141116 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 141133 ctcttcctcttcctcttcctcttc 141110 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 141127 ctcttcctcttcctcttcctcttc 141104 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 141121 ctcttcctcttcctcttcttcttc 141098
>gb|AC153897.4| Mus musculus 10 BAC RP23-119E2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 209755 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 ||||||||||| |||||||||||| |||||||| Sbjct: 19133 ctcttcctctttctcttcctcttcttcccctcc 19165
>emb|CT030636.13| Mouse DNA sequence from clone RP23-432O2 on chromosome 17, complete sequence Length = 204320 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 57 gcagctcttcctcttcctcttcctc 81 ||||||||||||||||||||||||| Sbjct: 198548 gcagctcttcctcttcctcttcctc 198524 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctc 81 |||||||||||||||||||| Sbjct: 12993 tcttcctcttcctcttcctc 12974
>gb|AY106333.1| Zea mays PCO096720 mRNA sequence Length = 1098 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcg 85 ||||||||||||||||||||||||| Sbjct: 169 ctcttcctcttcctcttcctcttcg 145 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 171 tcctcttcctcttcctcttc 152
>emb|Z35899.1|SCYBR030W S.cerevisiae chromosome II reading frame ORF YBR030w Length = 2423 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcg 85 ||||||||||||||||||||||||| Sbjct: 1830 ctcttcctcttcctcttcctcttcg 1806
>gb|AC118005.9| Mus musculus chromosome 19, clone RP23-318J14, complete sequence Length = 195212 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 29036 ctcttcctcttcctcttcctcttcctctcctcc 29004 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29090 ctcttcctcttcctcttcctcttc 29067 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29084 ctcttcctcttcctcttcctcttc 29061 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29078 ctcttcctcttcctcttcctcttc 29055 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29072 ctcttcctcttcctcttcctcttc 29049 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29066 ctcttcctcttcctcttcctcttc 29043 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29060 ctcttcctcttcctcttcctcttc 29037 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29054 ctcttcctcttcctcttcctcttc 29031 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29048 ctcttcctcttcctcttcctcttc 29025 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29042 ctcttcctcttcctcttcctcttc 29019 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 29092 tcctcttcctcttcctcttc 29073
>emb|CT030660.14| Mouse DNA sequence from clone RP23-455F4 on chromosome 13, complete sequence Length = 174127 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 119179 ctcttcctcttcctcttcctcttcttctcctcc 119147 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 66101 ctcttcctcttcctcttcctcttcctctcctcc 66069 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 66149 ctcttcctcttcctcttcctcttc 66126 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 66143 ctcttcctcttcctcttcctcttc 66120 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 66137 ctcttcctcttcctcttcctcttc 66114 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 66131 ctcttcctcttcctcttcctcttc 66108 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 66125 ctcttcctcttcctcttcctcttc 66102 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 66119 ctcttcctcttcctcttcctcttc 66096 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 66113 ctcttcctcttcctcttcctcttc 66090 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 66107 ctcttcctcttcctcttcctcttc 66084 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 119184 tcttcctcttcctcttcctcttc 119162 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 66154 tcttcctcttcctcttcctcttc 66132
>dbj|AP003421.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-951E24, complete sequence Length = 114999 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||||| || |||||| Sbjct: 5149 tcttcctcttcctcttcctcttcctctcctccc 5117 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctct 82 |||||||||||||||||||||| Sbjct: 5144 ctcttcctcttcctcttcctct 5123
>emb|AL773595.10| Mouse DNA sequence from clone RP23-297I16 on chromosome 2, complete sequence Length = 173925 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 148053 ctcttcctcttcctcttcctcttcctctcctcc 148021 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 148077 ctcttcctcttcctcttcctcttc 148054 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 148071 ctcttcctcttcctcttcctcttc 148048 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 148065 ctcttcctcttcctcttcctcttc 148042 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 148059 ctcttcctcttcctcttcctcttc 148036 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 148082 tcttcctcttcctcttcctcttc 148060
>emb|BX000698.11| Mouse DNA sequence from clone RP23-460G6 on chromosome X, complete sequence Length = 76941 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 ||||||||||||||||||||| || |||||||| Sbjct: 15516 ctcttcctcttcctcttcctcctcctcccctcc 15548 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 15514 tcctcttcctcttcctcttc 15533
>emb|AL662966.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0035B13, complete sequence Length = 145234 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtccc 89 |||||||||||||||||||||||| |||| Sbjct: 132136 ctcttcctcttcctcttcctcttcctccc 132164 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 132130 ctcttcctcttcctcttcctcttc 132153
>emb|AL845267.2| Mouse DNA sequence from clone RP23-426D2 on chromosome 2, complete sequence Length = 216597 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 23160 ctcttcctcttcctcttcctcttcctctcctcc 23192 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 23156 cttcctcttcctcttcctcttc 23177
>gb|AC132354.2| Mus musculus BAC clone RP24-112H7 from 12, complete sequence Length = 180298 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 115475 ctcttcctcttcctcttcctcttcctctcctcc 115443 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115523 ctcttcctcttcctcttcctcttc 115500 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115517 ctcttcctcttcctcttcctcttc 115494 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115511 ctcttcctcttcctcttcctcttc 115488 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115505 ctcttcctcttcctcttcctcttc 115482 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115499 ctcttcctcttcctcttcctcttc 115476 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115493 ctcttcctcttcctcttcctcttc 115470 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115487 ctcttcctcttcctcttcctcttc 115464 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115481 ctcttcctcttcctcttcctcttc 115458 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 115528 tcttcctcttcctcttcctcttc 115506
>gb|AC137515.3| Mus musculus BAC clone RP23-258C20 from 1, complete sequence Length = 215582 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 61082 ctcttcctcttcctcttcctcttcttctcctcc 61050 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 61094 ctcttcctcttcctcttcctcttc 61071 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 61088 ctcttcctcttcctcttcctcttc 61065 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 61099 tcttcctcttcctcttcctcttc 61077 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 24583 ctcttcctcttcctcttcctc 24563 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 24585 tcctcttcctcttcctcttc 24566
>gb|AC124718.4| Mus musculus BAC clone RP23-373N7 from 1, complete sequence Length = 201807 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 37250 gctcttcctcttcctcttcctcttc 37226 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 37243 ctcttcctcttcctcttcctcttc 37220 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 37237 ctcttcctcttcctcttcctcttc 37214 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 37231 ctcttcctcttcctcttcctcttc 37208 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 37225 ctcttcctcttcctcttcctcttc 37202 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 37219 ctcttcctcttcctcttcctcttc 37196 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 37213 ctcttcctcttcctcttcctcttc 37190 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 37207 ctcttcctcttcctcttcctcttc 37184 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 37201 ctcttcctcttcctcttcttcttc 37178
>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence Length = 949626 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 850410 gctcttcctcttcctcttcctcttc 850386 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgt 86 ||||||||||||||||||||||||| Sbjct: 541099 tcttcctcttcctcttcctcttcgt 541075 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 850403 ctcttcctcttcctcttcttcttc 850380 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 541106 ctcttcatcttcctcttcctcttc 541083
>dbj|AP006132.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT41P23, TM0230, complete sequence Length = 91079 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 52724 gctcttcctcttcctcttcctcttc 52748 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctct 82 |||||||||||||||||||||| Sbjct: 52731 ctcttcctcttcctcttcctct 52752
>gb|AC154793.2| Mus musculus BAC clone RP23-88B6 from chromosome 13, complete sequence Length = 182356 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 168758 ctcttcctcttcctcttcctcttcctctcctcc 168790 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 115673 ctcttcctcttcctcttcctcttcttctcctcc 115705 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 168752 ctcttcctcttcctcttcctcttc 168775 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 168746 ctcttcctcttcctcttcctcttc 168769 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 168740 ctcttcctcttcctcttcctcttc 168763 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 168734 ctcttcctcttcctcttcctcttc 168757 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 168728 ctcttcctcttcctcttcctcttc 168751 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 168722 ctcttcctcttcctcttcctcttc 168745 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 168716 ctcttcctcttcctcttcctcttc 168739 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 168710 ctcttcctcttcctcttcctcttc 168733 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 168704 ctcttcctcttcctcttcctcttc 168727 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 168699 tcttcctcttcctcttcctcttc 168721 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 115668 tcttcctcttcctcttcctcttc 115690
>emb|AL732309.9| Mouse DNA sequence from clone RP23-132N23 on chromosome 2, complete sequence Length = 221859 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||||||||||||||||| ||| ||||| Sbjct: 12061 tcttcctcttcctcttcctcttcatcctctccc 12093
>emb|AJ249895.1|MMU249895 Mus musculus mas proto-oncogene and Igf2r gene for insulin-like growth factor type 2 and L41ps and Au76 pseudogenes Length = 138490 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 57 gcagctcttcctcttcctcttcctc 81 ||||||||||||||||||||||||| Sbjct: 42599 gcagctcttcctcttcctcttcctc 42623
>emb|AL844209.6| Mouse DNA sequence from clone RP23-105M20 on chromosome 2, complete sequence Length = 200361 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 78097 ctcttcctcttcctcttcctcttcctctcctcc 78065 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 78133 ctcttcctcttcctcttcctcttc 78110 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 78127 ctcttcctcttcctcttcctcttc 78104 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 78121 ctcttcctcttcctcttcctcttc 78098 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 78115 ctcttcctcttcctcttcctcttc 78092 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 78109 ctcttcctcttcctcttcctcttc 78086 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 78103 ctcttcctcttcctcttcctcttc 78080
>gb|AC167813.4| Mus musculus BAC clone RP24-233L18 from chromosome 7, complete sequence Length = 172485 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcg 85 ||||||||||||||||||||||||| Sbjct: 144728 ctcttcctcttcctcttcctcttcg 144704 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 144734 ctcttcctcttcctcttcctcttc 144711 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 144736 tcctcttcctcttcctcttc 144717
>gb|J03195.1|YSCRGL2 Yeast (S.cerevisiae) ribosomal protein L2 (ScrpL2A) gene, complete cds Length = 2268 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttcg 85 ||||||||||||||||||||||||| Sbjct: 201 ctcttcctcttcctcttcctcttcg 177
>emb|AL606984.20| Mouse DNA sequence from clone RP23-81D5 on chromosome 4, complete sequence Length = 104368 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 69912 ctcttcctcttcctcttcctcttcctctcctcc 69944 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttcgtcccctcc 93 |||||||||||||||||||||||| || ||||| Sbjct: 69859 ctcttcctcttcctcttcctcttcctctcctcc 69891 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 69906 ctcttcctcttcctcttcctcttc 69929 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 69900 ctcttcctcttcctcttcctcttc 69923 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 69853 ctcttcctcttcctcttcctcttc 69876 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 69847 ctcttcctcttcctcttcctcttc 69870 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 69898 tcctcttcctcttcctcttc 69917 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 69845 tcctcttcctcttcctcttc 69864
>emb|AL671869.11| Mouse DNA sequence from clone RP23-61O18 on chromosome 4, complete sequence Length = 61624 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 60 gctcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||||| Sbjct: 2258 gctcttcctcttcctcttcctcttc 2282 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2271 ctcttcctcttcctcttcctcttc 2294 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2265 ctcttcctcttcctcttcctcttc 2288 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 2277 ctcttcctcttcctcttcctc 2297
>gb|AC116136.9| Mus musculus chromosome 5, clone RP23-116G17, complete sequence Length = 212184 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 49861 ctcttcctcttcctcttcctcttc 49838 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 49855 ctcttcctcttcctcttcctcttc 49832 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 49849 ctcttcctcttcctcttcctcttc 49826 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 49866 tcttcctcttcctcttcctcttc 49844 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 49843 ctcttcctcttcctcttcttcttc 49820
>gb|AC113055.9| Mus musculus chromosome 5, clone RP23-251M20, complete sequence Length = 185733 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115944 ctcttcctcttcctcttcctcttc 115921 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 115938 ctcttcctcttcctcttcctcttc 115915 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 115949 tcttcctcttcctcttcctcttc 115927 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 115932 ctcttcctcttcctcttcctc 115912 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 115911 ctcttcctcttcctcttcctc 115891 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 115913 tcctcttcctcttcctcttc 115894
>gb|AC114644.10| Mus musculus chromosome 1, clone RP24-128L10, complete sequence Length = 137391 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 39689 ctcttcctcttcctcttcctcttc 39666 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 39683 ctcttcctcttcctcttcctcttc 39660 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 39677 ctcttcctcttcctcttcctcttc 39654 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 39671 ctcttcctcttcctcttcct 39652
>gb|AC116722.7| Mus musculus chromosome 3, clone RP23-257M16, complete sequence Length = 207409 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 44013 ctcttcctcttcctcttcctcttc 44036 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 44007 ctcttcctcttcctcttcctcttc 44030 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 44001 ctcttcctcttcctcttcctcttc 44024 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 43995 ctcttcctcttcctcttcctcttc 44018 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 43990 tcttcctcttcctcttcctcttc 44012
>gb|AC105976.13| Mus musculus chromosome 5, clone RP24-315H14, complete sequence Length = 188130 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 88710 ctcttcctcttcctcttcctcttc 88687 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 88704 ctcttcctcttcctcttcctcttc 88681 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 88715 tcttcctcttcctcttcctcttc 88693
>gb|AC115795.11| Mus musculus chromosome 5, clone RP23-400O10, complete sequence Length = 207103 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 199022 ctcttcctcttcctcttcctcttc 199045 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 199016 ctcttcctcttcctcttcctcttc 199039 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 199010 ctcttcctcttcctcttcctcttc 199033 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 199004 ctcttcctcttcctcttcctcttc 199027 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 198998 ctcttcctcttcctcttcctcttc 199021 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 198992 ctcttcctcttcctcttcctcttc 199015 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 198986 ctcttcctcttcctcttcctcttc 199009 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 198981 tcttcctcttcctcttcctcttc 199003 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 198863 ctcttcctcttcctcttcctc 198883 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ttcctcttcctcttcctcttc 84 ||||||||||||||||||||| Sbjct: 198860 ttcctcttcctcttcctcttc 198880 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 199028 ctcttcctcttcctcttcttcttc 199051
>gb|AC153385.3| Mus musculus 6 BAC RP23-64D14 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 226269 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6092 ctcttcctcttcctcttcctcttc 6115 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 6088 cttcctcttcctcttcctcttc 6109 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 6098 ctcttcctcttcctcttcttcttc 6121
>gb|AC130283.8| Mus musculus chromosome 15, clone RP23-136E18, complete sequence Length = 180660 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 103688 ctcttcctcttcctcttcctcttc 103665 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 103682 ctcttcctcttcctcttcctcttc 103659 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 103693 tcttcctcttcctcttcctcttc 103671
>gb|AC116759.13| Mus musculus chromosome 18, clone RP23-383E12, complete sequence Length = 203049 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 143075 ctcttcctcttcctcttcctcttc 143052 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 143069 ctcttcctcttcctcttcctcttc 143046 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ttcctcttcctcttcctcttc 84 ||||||||||||||||||||| Sbjct: 143078 ttcctcttcctcttcctcttc 143058
>gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, complete sequence Length = 190298 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8435 ctcttcctcttcctcttcctcttc 8458 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 8433 tcctcttcctcttcctcttc 8452
>gb|AC102672.13| Mus musculus chromosome 14, clone RP23-181E7, complete sequence Length = 208396 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 89553 ctcttcctcttcctcttcctcttc 89530 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 89547 ctcttcctcttcctcttcctcttc 89524 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 89541 ctcttcctcttcctcttcctcttc 89518 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 89535 ctcttcctcttcctcttcctcttc 89512 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 89529 ctcttcctcttcctcttcctcttc 89506 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 89558 tcttcctcttcctcttcctcttc 89536 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 89523 ctcttcctcttcctcttcttcttc 89500
>gb|AC153799.1| Mus musculus BAC RP23-145M15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 207598 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 138109 ctcttcctcttcctcttcctcttc 138086 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 138103 ctcttcctcttcctcttcctcttc 138080 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 138097 ctcttcctcttcctcttcctcttc 138074 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 138091 ctcttcctcttcctcttcctcttc 138068 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 138085 ctcttcctcttcctcttcctcttc 138062 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 138079 ctcttcctcttcctcttcctcttc 138056 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5066 ctcttcctcttcctcttcctcttc 5089 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5060 ctcttcctcttcctcttcctcttc 5083 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5054 ctcttcctcttcctcttcctcttc 5077 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5048 ctcttcctcttcctcttcctcttc 5071 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5042 ctcttcctcttcctcttcctcttc 5065 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5036 ctcttcctcttcctcttcctcttc 5059 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5030 ctcttcctcttcctcttcctcttc 5053 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5024 ctcttcctcttcctcttcctcttc 5047 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5018 ctcttcctcttcctcttcctcttc 5041 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5012 ctcttcctcttcctcttcctcttc 5035 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5006 ctcttcctcttcctcttcctcttc 5029 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 5000 ctcttcctcttcctcttcctcttc 5023 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 5072 ctcttcctcttcctcttcctctt 5094 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||||||| |||||||| Sbjct: 138127 ctcttcctcttcctcctcctcttc 138104 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||| |||||||||||||| Sbjct: 138121 ctcttcctcctcctcttcctcttc 138098 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 138111 tcctcttcctcttcctcttc 138092 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 138073 ctcttcctcttcctcttcttcttc 138050 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 138067 ctcttcctcttcttcttcctcttc 138044 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 138061 ctcttcttcttcctcttcctcttc 138038
>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence Length = 152183 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 57202 ctcttcctcttcctcttcctcttc 57179 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 57196 ctcttcctcttcctcttcctcttc 57173 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 57207 tcttcctcttcctcttcctcttc 57185 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 57553 ctcttcctcttcttcttcctcttc 57530
>gb|AC130657.9| Mus musculus chromosome 1, clone RP23-307H3, complete sequence Length = 198570 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 196041 ctcttcctcttcctcttcctcttc 196064 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 196047 ctcttcctcttcctcttcctc 196067 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 196039 tcctcttcctcttcctcttc 196058
>gb|AC129583.15| Mus musculus chromosome 15, clone RP23-197P10, complete sequence Length = 206094 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 152436 ctcttcctcttcctcttcctcttc 152459 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 152430 ctcttcctcttcctcttcctcttc 152453 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 152424 ctcttcctcttcctcttcctcttc 152447 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 152418 ctcttcctcttcctcttcctcttc 152441 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 152412 ctcttcctcttcctcttcctcttc 152435 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 152406 ctcttcctcttcctcttcctcttc 152429 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 152400 ctcttcctcttcctcttcctcttc 152423 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 152394 ctcttcctcttcctcttcctcttc 152417 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 152389 tcttcctcttcctcttcctcttc 152411 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 152442 ctcttcctcttcctcttcctc 152462
>gb|AC126539.9| Mus musculus chromosome 8, clone RP24-112G5, complete sequence Length = 158710 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129724 ctcttcctcttcctcttcctcttc 129747 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129718 ctcttcctcttcctcttcctcttc 129741 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129712 ctcttcctcttcctcttcctcttc 129735 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ttcctcttcctcttcctcttc 84 ||||||||||||||||||||| Sbjct: 129709 ttcctcttcctcttcctcttc 129729 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 129730 ctcttcctcttcctcttcttcttc 129753
>gb|AF539999.1| Mamestra configurata nucleopolyhedrovirus A 90/4, complete genome Length = 153656 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 52481 ctcttcctcttcctcttcctcttc 52504 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 52476 tcttcctcttcctcttcctcttc 52498
>gb|AC160134.2| Mus musculus BAC clone RP23-139G11 from chromosome 9, complete sequence Length = 176272 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164790 ctcttcctcttcctcttcctcttc 164767 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164784 ctcttcctcttcctcttcctcttc 164761 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164778 ctcttcctcttcctcttcctcttc 164755 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164772 ctcttcctcttcctcttcctcttc 164749 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164745 ctcttcctcttcctcttcctcttc 164722 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164709 ctcttcctcttcctcttcctcttc 164686 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 164703 ctcttcctcttcctcttcctcttc 164680 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 164795 tcttcctcttcctcttcctcttc 164773 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 164766 ctcttcctcttcctcttcctc 164746 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 164739 ctcttcctcttcctcttcctc 164719 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 164747 tcctcttcctcttcctcttc 164728 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 164711 tcctcttcctcttcctcttc 164692 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 164697 ctcttcctcttcctcttcttcttc 164674
>gb|AC152987.1| Mus musculus 6 BAC RP23-133N21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 196532 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 166978 ctcttcctcttcctcttcctcttc 166955 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 166972 ctcttcctcttcctcttcctcttc 166949 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 166966 ctcttcctcttcctcttcctcttc 166943 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 166960 ctcttcctcttcctcttcctcttc 166937 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 166983 tcttcctcttcctcttcctcttc 166961 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 166954 ctcttcctcttcctcttcttcttc 166931
>gb|AC108914.8| Mus musculus chromosome 1, clone RP23-435E15, complete sequence Length = 212494 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 196788 ctcttcctcttcctcttcctcttc 196765 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 196782 ctcttcctcttcctcttcctcttc 196759 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 196776 ctcttcctcttcctcttcctcttc 196753 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 196793 tcttcctcttcctcttcctcttc 196771 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 196770 ctcttcctcttcctcttcctctt 196748
>gb|AC165256.2| Mus musculus BAC clone RP23-216O10 from chromosome 9, complete sequence Length = 231728 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208507 ctcttcctcttcctcttcctcttc 208484 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208501 ctcttcctcttcctcttcctcttc 208478 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208495 ctcttcctcttcctcttcctcttc 208472 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208489 ctcttcctcttcctcttcctcttc 208466 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208483 ctcttcctcttcctcttcctcttc 208460 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208477 ctcttcctcttcctcttcctcttc 208454 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208471 ctcttcctcttcctcttcctcttc 208448 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208465 ctcttcctcttcctcttcctcttc 208442 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208459 ctcttcctcttcctcttcctcttc 208436 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 208453 ctcttcctcttcctcttcctcttc 208430 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 208545 tcttcctcttcctcttcctcttc 208523 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 208540 ctcttcctcttcctcttcctc 208520 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 146207 ctcttcctcttcctcttcctc 146187 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 208509 tcctcttcctcttcctcttc 208490 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 208447 ctcttcctcttcctcttcttcttc 208424 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 146209 tcctcttcctcttcctcttc 146190
>gb|AC131995.14| Mus musculus chromosome 1, clone RP24-338G10, complete sequence Length = 153731 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22421 ctcttcctcttcctcttcctcttc 22444 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22415 ctcttcctcttcctcttcctcttc 22438 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22409 ctcttcctcttcctcttcctcttc 22432 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22403 ctcttcctcttcctcttcctcttc 22426 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22397 ctcttcctcttcctcttcctcttc 22420 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 22392 tcttcctcttcctcttcctcttc 22414 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 7351 tcttcctcttcctcttcctcttc 7329 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 7346 ctcttcctcttcctcttcctc 7326 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||||||||| |||||| Sbjct: 20598 ctcttcctcttcctctttctcttc 20621
>gb|AC116505.13| Mus musculus chromosome 5, clone RP24-302O2, complete sequence Length = 178695 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142915 ctcttcctcttcctcttcctcttc 142938 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142909 ctcttcctcttcctcttcctcttc 142932 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142903 ctcttcctcttcctcttcctcttc 142926 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142897 ctcttcctcttcctcttcctcttc 142920 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142891 ctcttcctcttcctcttcctcttc 142914 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142885 ctcttcctcttcctcttcctcttc 142908 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142879 ctcttcctcttcctcttcctcttc 142902 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142873 ctcttcctcttcctcttcctcttc 142896 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142867 ctcttcctcttcctcttcctcttc 142890 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 142861 ctcttcctcttcctcttcctcttc 142884 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 142856 tcttcctcttcctcttcctcttc 142878 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 142921 ctcttcctcttcctcttcttcttc 142944
>gb|AC152957.1| Mus musculus 6 BAC RP23-353I5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 203225 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 65855 ctcttcctcttcctcttcctcttc 65878 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 66103 tcttcctcttcctcttcctcttc 66125 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 65850 tcttcctcttcctcttcctcttc 65872 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 66108 ctcttcctcttcctcttcctc 66128 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 65861 ctcttcctcttcctcttcctc 65881
>gb|AC112139.31| Mus musculus strain C57BL/6J clone rp23-170m6 map 6, complete sequence Length = 203032 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 183510 ctcttcctcttcctcttcctcttc 183533 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 183504 ctcttcctcttcctcttcctcttc 183527 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 183498 ctcttcctcttcctcttcctcttc 183521 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 183492 ctcttcctcttcctcttcctcttc 183515 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 183486 ctcttcctcttcctcttcctcttc 183509 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 183516 ctcttcctcttcctcttcttcttc 183539
>gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosome 13, complete sequence Length = 187080 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7351 ctcttcctcttcctcttcctcttc 7328 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7345 ctcttcctcttcctcttcctcttc 7322 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7339 ctcttcctcttcctcttcctcttc 7316 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7333 ctcttcctcttcctcttcctcttc 7310 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7327 ctcttcctcttcctcttcctcttc 7304 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7321 ctcttcctcttcctcttcctcttc 7298 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7315 ctcttcctcttcctcttcctcttc 7292 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7309 ctcttcctcttcctcttcctcttc 7286 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7303 ctcttcctcttcctcttcctcttc 7280 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7297 ctcttcctcttcctcttcctcttc 7274 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 7356 tcttcctcttcctcttcctcttc 7334 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||| |||||||||||||| Sbjct: 64626 ctcttcctcctcctcttcctcttc 64649
>gb|AC121304.7| Mus musculus chromosome 3, clone RP24-63C3, complete sequence Length = 192911 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99779 ctcttcctcttcctcttcctcttc 99756 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99773 ctcttcctcttcctcttcctcttc 99750 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99767 ctcttcctcttcctcttcctcttc 99744 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99761 ctcttcctcttcctcttcctcttc 99738 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99755 ctcttcctcttcctcttcctcttc 99732 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99581 ctcttcctcttcctcttcctcttc 99558 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99575 ctcttcctcttcctcttcctcttc 99552 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99569 ctcttcctcttcctcttcctcttc 99546 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99563 ctcttcctcttcctcttcctcttc 99540 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99557 ctcttcctcttcctcttcctcttc 99534 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99551 ctcttcctcttcctcttcctcttc 99528 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99545 ctcttcctcttcctcttcctcttc 99522 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 99539 ctcttcctcttcctcttcctcttc 99516 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 99784 tcttcctcttcctcttcctcttc 99762 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 99749 ctcttcctcttcctcttcttcttc 99726 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 99583 tcctcttcctcttcctcttc 99564 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 99533 ctcttcctcttcctcttcttcttc 99510
>gb|AC166709.9| Mus musculus chromosome 1, clone RP23-406B10, complete sequence Length = 175924 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129817 ctcttcctcttcctcttcctcttc 129840 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129811 ctcttcctcttcctcttcctcttc 129834 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129805 ctcttcctcttcctcttcctcttc 129828 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129799 ctcttcctcttcctcttcctcttc 129822 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 129793 ctcttcctcttcctcttcctcttc 129816 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 129788 tcttcctcttcctcttcctcttc 129810 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 129823 ctcttcctcttcctcttcct 129842
>gb|AC101277.16| Mus musculus chromosome 1, clone RP23-101P2, complete sequence Length = 207021 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 162864 ctcttcctcttcctcttcctcttc 162841 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 162858 ctcttcctcttcctcttcctcttc 162835 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 162852 ctcttcctcttcctcttcctcttc 162829 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||| |||||||||||||| Sbjct: 162876 ctcttcctcctcctcttcctcttc 162853 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 162866 tcctcttcctcttcctcttc 162847 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 162846 ctcttcctcttcctcttcttcttc 162823
>gb|AC167143.2| Mus musculus BAC clone RP23-38J9 from chromosome 3, complete sequence Length = 187770 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93645 ctcttcctcttcctcttcctcttc 93668 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93639 ctcttcctcttcctcttcctcttc 93662 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93633 ctcttcctcttcctcttcctcttc 93656 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93627 ctcttcctcttcctcttcctcttc 93650 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93621 ctcttcctcttcctcttcctcttc 93644 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93615 ctcttcctcttcctcttcctcttc 93638 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93609 ctcttcctcttcctcttcctcttc 93632 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93603 ctcttcctcttcctcttcctcttc 93626 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93597 ctcttcctcttcctcttcctcttc 93620 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93591 ctcttcctcttcctcttcctcttc 93614 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93585 ctcttcctcttcctcttcctcttc 93608 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93579 ctcttcctcttcctcttcctcttc 93602 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 93573 ctcttcctcttcctcttcctcttc 93596 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 93568 tcttcctcttcctcttcctcttc 93590 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 93651 ctcttcctcttcctcttcttcttc 93674
>gb|AC141887.5| Mus musculus BAC clone RP23-478L20 from chromosome 7, complete sequence Length = 163916 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133823 ctcttcctcttcctcttcctcttc 133800 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133817 ctcttcctcttcctcttcctcttc 133794 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133811 ctcttcctcttcctcttcctcttc 133788 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133805 ctcttcctcttcctcttcctcttc 133782 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133799 ctcttcctcttcctcttcctcttc 133776 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133772 ctcttcctcttcctcttcctcttc 133749 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133766 ctcttcctcttcctcttcctcttc 133743 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 133828 tcttcctcttcctcttcctcttc 133806 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 133777 tcttcctcttcctcttcctcttc 133755 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 133760 ctcttcctcttcctcttcttcttc 133737
>gb|AC164116.4| Mus musculus BAC clone RP24-242F4 from chromosome 13, complete sequence Length = 155449 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80957 ctcttcctcttcctcttcctcttc 80980 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80951 ctcttcctcttcctcttcctcttc 80974 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 80945 ctcttcctcttcctcttcctcttc 80968 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 80941 cttcctcttcctcttcctcttc 80962 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 80963 ctcttcctcttcctcttcct 80982
>gb|AC102130.7| Mus musculus chromosome 3, clone RP23-223I2, complete sequence Length = 176409 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 44745 ctcttcctcttcctcttcctcttc 44722 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 44739 ctcttcctcttcctcttcctcttc 44716 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 44750 tcttcctcttcctcttcctcttc 44728 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 44733 ctcttcctcttcctcttcctc 44713 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 44811 ctcttcctcttcttcttcctcttc 44788 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctc 81 |||||||||||||||||||| Sbjct: 44780 tcttcctcttcctcttcctc 44761 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||||||| |||||||| Sbjct: 44727 ctcttcctcttcctcctcctcttc 44704
>gb|AC123613.16| Mus musculus chromosome 1, clone RP23-434L2, complete sequence Length = 204785 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 117668 ctcttcctcttcctcttcctcttc 117645 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 117662 ctcttcctcttcctcttcctcttc 117639 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 117656 ctcttcctcttcctcttcctcttc 117633 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 117650 ctcttcctcttcctcttcctcttc 117627 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 117644 ctcttcctcttcctcttcctcttc 117621 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 117638 ctcttcctcttcctcttcctcttc 117615 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 117632 ctcttcctcttcctcttcctctt 117610 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||| |||||||||||||||||| Sbjct: 117674 ctctttctcttcctcttcctcttc 117651
>gb|AC170599.2| Mus musculus BAC clone RP23-369P2 from chromosome 6, complete sequence Length = 182608 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22244 ctcttcctcttcctcttcctcttc 22267 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 22250 ctcttcctcttcctcttcctc 22270 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 ttcctcttcctcttcctcttc 84 ||||||||||||||||||||| Sbjct: 22241 ttcctcttcctcttcctcttc 22261
>gb|AC164011.2| Mus musculus chromosome 18, clone RP24-190N20, complete sequence Length = 167980 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 121113 ctcttcctcttcctcttcctcttc 121136 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 121107 ctcttcctcttcctcttcctcttc 121130 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 121067 cttcctcttcctcttcctcttc 121088 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 121071 ctcttcctcttcctcttcctc 121091 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 121119 ctcttcctcttcctcttcct 121138 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 121105 tcctcttcctcttcctcttc 121124
>gb|AC161184.5| Mus musculus chromosome 8, clone RP24-210P13, complete sequence Length = 156491 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 84081 ctcttcctcttcctcttcctcttc 84104 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 84075 ctcttcctcttcctcttcctcttc 84098 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 84069 ctcttcctcttcctcttcctcttc 84092 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 84063 ctcttcctcttcctcttcctcttc 84086 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2909 ctcttcctcttcctcttcctcttc 2932 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2903 ctcttcctcttcctcttcctcttc 2926 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2897 ctcttcctcttcctcttcctcttc 2920 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 2891 ctcttcctcttcctcttcctcttc 2914 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 84087 ctcttcctcttcctcttcctctt 84109
>gb|AC170589.2| Mus musculus chromosome 3, clone wi1-2412A20, complete sequence Length = 44506 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29561 ctcttcctcttcctcttcctcttc 29538 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 29555 ctcttcctcttcctcttcctc 29535
>gb|AC166039.6| Mus musculus chromosome 8, clone RP23-285M10, complete sequence Length = 168321 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 136312 ctcttcctcttcctcttcctcttc 136335 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 136306 ctcttcctcttcctcttcctcttc 136329 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 136300 ctcttcctcttcctcttcctcttc 136323 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 39068 ctcttcctcttcctcttcctcttc 39091 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 39062 ctcttcctcttcctcttcctcttc 39085 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 39056 ctcttcctcttcctcttcctcttc 39079 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 39050 ctcttcctcttcctcttcctcttc 39073 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 39044 ctcttcctcttcctcttcctcttc 39067 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 136318 ctcttcctcttcctcttcctctt 136340 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||| |||||||||||||||||| Sbjct: 136294 ctctttctcttcctcttcctcttc 136317
>gb|AC163102.5| Mus musculus chromosome 18, clone RP23-270E10, complete sequence Length = 179127 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 42106 ctcttcctcttcctcttcctcttc 42083 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 42100 ctcttcctcttcctcttcctcttc 42077 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 42111 tcttcctcttcctcttcctcttc 42089 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 42094 ctcttcctcttcctcttcttcttc 42071
>gb|AC117757.23| Mus musculus chromosome 1, clone RP24-420I4, complete sequence Length = 183087 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133482 ctcttcctcttcctcttcctcttc 133459 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133476 ctcttcctcttcctcttcctcttc 133453 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133470 ctcttcctcttcctcttcctcttc 133447 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133464 ctcttcctcttcctcttcctcttc 133441 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133458 ctcttcctcttcctcttcctcttc 133435 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 133452 ctcttcctcttcctcttcctcttc 133429 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 133487 tcttcctcttcctcttcctcttc 133465 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 133446 ctcttcctcttcctcttcctc 133426
>gb|AC102481.10| Mus musculus chromosome 1, clone RP24-427A3, complete sequence Length = 145973 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 48800 ctcttcctcttcctcttcctcttc 48777 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 48794 ctcttcctcttcctcttcctcttc 48771 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 48788 ctcttcctcttcctcttcctcttc 48765 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 48805 tcttcctcttcctcttcctcttc 48783
>gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, complete sequence Length = 192819 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 71870 ctcttcctcttcctcttcctcttc 71847 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 71874 cttcctcttcctcttcctcttc 71853 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 71864 ctcttcctcttcctcttcctc 71844
>gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, complete sequence Length = 171409 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 50537 ctcttcctcttcctcttcctcttc 50514 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22360 ctcttcctcttcctcttcctcttc 22383 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22354 ctcttcctcttcctcttcctcttc 22377 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22348 ctcttcctcttcctcttcctcttc 22371 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22342 ctcttcctcttcctcttcctcttc 22365 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22336 ctcttcctcttcctcttcctcttc 22359 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22330 ctcttcctcttcctcttcctcttc 22353 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22324 ctcttcctcttcctcttcctcttc 22347 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 22318 ctcttcctcttcctcttcctcttc 22341 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 50531 ctcttcctcttcctcttcctc 50511 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 50539 tcctcttcctcttcctcttc 50520 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 22366 ctcttcctcttcctcttcttcttc 22389 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 22316 tcctcttcctcttcctcttc 22335
>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence Length = 175318 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47233 ctcttcctcttcctcttcctcttc 47256 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47227 ctcttcctcttcctcttcctcttc 47250 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47221 ctcttcctcttcctcttcctcttc 47244 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47215 ctcttcctcttcctcttcctcttc 47238 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47209 ctcttcctcttcctcttcctcttc 47232 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47203 ctcttcctcttcctcttcctcttc 47226 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47107 ctcttcctcttcctcttcctcttc 47130 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47101 ctcttcctcttcctcttcctcttc 47124 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 47198 tcttcctcttcctcttcctcttc 47220 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 47096 tcttcctcttcctcttcctcttc 47118
>gb|AC153973.33| Mus musculus 10 BAC RP24-158P6 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 164139 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 125619 ctcttcctcttcctcttcctcttc 125596 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 125613 ctcttcctcttcctcttcctcttc 125590 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 125607 ctcttcctcttcctcttcctcttc 125584 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 125601 ctcttcctcttcctcttcctc 125581 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 125621 tcctcttcctcttcctcttc 125602
>ref|XM_632638.1| Dictyostelium discoideum structural maintenance of chromosome protein (DDB0219935), partial mRNA Length = 4248 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 126 ctcttcctcttcctcttcctcttc 103 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 120 ctcttcctcttcctcttcctcttc 97 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 179 tcttcctcttcctcttcctcttc 157 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||| |||||||||||||| Sbjct: 138 ctcttcctcctcctcttcctcttc 115 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 128 tcctcttcctcttcctcttc 109
>gb|AC100500.10| Mus musculus chromosome 3, clone RP23-143I10, complete sequence Length = 179369 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47616 ctcttcctcttcctcttcctcttc 47639 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47610 ctcttcctcttcctcttcctcttc 47633 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47604 ctcttcctcttcctcttcctcttc 47627 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47598 ctcttcctcttcctcttcctcttc 47621 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47592 ctcttcctcttcctcttcctcttc 47615 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47586 ctcttcctcttcctcttcctcttc 47609 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47580 ctcttcctcttcctcttcctcttc 47603 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 47574 ctcttcctcttcctcttcctcttc 47597 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 47569 tcttcctcttcctcttcctcttc 47591 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttcgtcccctccc 94 ||||||||| ||||||||||||| ||| ||||| Sbjct: 131011 tcttcctctccctcttcctcttcttcctctccc 130979 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 47622 ctcttcctcttcctcttcttcttc 47645
>gb|AC111028.10| Mus musculus chromosome 8, clone RP23-221P20, complete sequence Length = 193256 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6215 ctcttcctcttcctcttcctcttc 6192 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6209 ctcttcctcttcctcttcctcttc 6186 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6203 ctcttcctcttcctcttcctcttc 6180 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6197 ctcttcctcttcctcttcctcttc 6174 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6191 ctcttcctcttcctcttcctcttc 6168 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6185 ctcttcctcttcctcttcctcttc 6162 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6179 ctcttcctcttcctcttcctcttc 6156 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 6173 ctcttcctcttcctcttcctcttc 6150 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 6220 tcttcctcttcctcttcctcttc 6198 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 6167 ctcttcctcttcctcttcctc 6147
>gb|AC124828.14| Mus musculus chromosome 5, clone RP24-126A19, complete sequence Length = 188504 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 14676 ctcttcctcttcctcttcctcttc 14653 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 14670 ctcttcctcttcctcttcctcttc 14647 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 14664 ctcttcctcttcctcttcctcttc 14641 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 14658 ctcttcctcttcctcttcctcttc 14635 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 14680 cttcctcttcctcttcctcttc 14659 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 14652 ctcttcctcttcctcttcctc 14632
>gb|AC103399.9| Mus musculus chromosome 3, clone RP23-310N18, complete sequence Length = 154918 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 53610 ctcttcctcttcctcttcctcttc 53587 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 53604 ctcttcctcttcctcttcctcttc 53581 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 53598 ctcttcctcttcctcttcctcttc 53575 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 53592 ctcttcctcttcctcttcctcttc 53569 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 53586 ctcttcctcttcctcttcctcttc 53563 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 53580 ctcttcctcttcctcttcctcttc 53557 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 53574 ctcttcctcttcctcttcctcttc 53551 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 53568 ctcttcctcttcctcttcctcttc 53545 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 53615 tcttcctcttcctcttcctcttc 53593 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 53562 ctcttcctcttcctcttcttcttc 53539
>gb|AC115006.12| Mus musculus chromosome 8, clone RP24-184D21, complete sequence Length = 163874 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 27377 ctcttcctcttcctcttcctcttc 27354 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 27371 ctcttcctcttcctcttcctcttc 27348 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 27365 ctcttcctcttcctcttcctcttc 27342 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 27359 ctcttcctcttcctcttcctcttc 27336 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 27353 ctcttcctcttcctcttcctcttc 27330 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||| ||||||||||||||||||| Sbjct: 27383 ctctgcctcttcctcttcctcttc 27360 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 27347 ctcttcctcttcctcttcttcttc 27324
>gb|AC115749.12| Mus musculus chromosome 3, clone RP23-14C17, complete sequence Length = 230988 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109397 ctcttcctcttcctcttcctcttc 109374 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 109391 ctcttcctcttcctcttcctcttc 109368 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 109399 tcctcttcctcttcctcttc 109380 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 109385 ctcttcctcttcctcttcttcttc 109362
>ref|XM_642353.1| Dictyostelium discoideum SMAD/FHA domain-containing protein (DDB0220692), partial mRNA Length = 2190 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 1005 ctcttcctcttcctcttcctcttc 982 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 1010 tcttcctcttcctcttcctcttc 988
>gb|AC121851.4| Mus musculus chromosome 8 clone RP24-92F5, complete sequence Length = 184603 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134931 ctcttcctcttcctcttcctcttc 134908 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134925 ctcttcctcttcctcttcctcttc 134902 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134919 ctcttcctcttcctcttcctcttc 134896 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134913 ctcttcctcttcctcttcctcttc 134890 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134907 ctcttcctcttcctcttcctcttc 134884 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134901 ctcttcctcttcctcttcctcttc 134878 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134895 ctcttcctcttcctcttcctcttc 134872 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134889 ctcttcctcttcctcttcctcttc 134866 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134883 ctcttcctcttcctcttcctcttc 134860 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 134877 ctcttcctcttcctcttcctcttc 134854 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 134936 tcttcctcttcctcttcctcttc 134914 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 134871 ctcttcctcttcctcttcttcttc 134848
>gb|AC122011.3| Mus musculus chromosome 10 clone RP24-352E6, complete sequence Length = 181468 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 34840 ctcttcctcttcctcttcctcttc 34817 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 34834 ctcttcctcttcctcttcctcttc 34811 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 34828 ctcttcctcttcctcttcctcttc 34805 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 34822 ctcttcctcttcctcttcctcttc 34799 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 34816 ctcttcctcttcctcttcctcttc 34793 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 34842 tcctcttcctcttcctcttc 34823 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 34810 ctcttcctcttcctcttcttcttc 34787
>gb|AC113538.14| Mus musculus chromosome 8, clone RP23-118F24, complete sequence Length = 206380 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 94487 ctcttcctcttcctcttcctcttc 94464 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 94481 ctcttcctcttcctcttcctcttc 94458 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 94492 tcttcctcttcctcttcctcttc 94470 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 94505 ctcttcctcttcatcttcctcttc 94482 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 94499 ctcttcatcttcctcttcctcttc 94476
>gb|AC102525.8| Mus musculus chromosome 8, clone RP24-133K20, complete sequence Length = 162463 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 138460 ctcttcctcttcctcttcctcttc 138437 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 138454 ctcttcctcttcctcttcctcttc 138431 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 138465 tcttcctcttcctcttcctcttc 138443 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 138478 ctcttcctcttcatcttcctcttc 138455 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||| ||||||||||||||||| Sbjct: 138472 ctcttcatcttcctcttcctcttc 138449
>gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete sequence Length = 146712 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 41809 ctcttcctcttcctcttcctcttc 41786 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 41803 ctcttcctcttcctcttcctcttc 41780 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 41797 ctcttcctcttcctcttcctc 41777 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 41811 tcctcttcctcttcctcttc 41792
>gb|AC109196.12| Mus musculus chromosome 5, clone RP23-313F5, complete sequence Length = 205369 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 18396 ctcttcctcttcctcttcctcttc 18419 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 18390 ctcttcctcttcctcttcctcttc 18413 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 18384 ctcttcctcttcctcttcctcttc 18407 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 18378 ctcttcctcttcctcttcctcttc 18401 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 18373 tcttcctcttcctcttcctcttc 18395 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 18402 ctcttcctcttcctcttcttcttc 18425
>ref|XM_638718.1| Dictyostelium discoideum hypothetical protein (DDB0167422), partial mRNA Length = 1920 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 339 ctcttcctcttcctcttcctcttc 316 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 344 tcttcctcttcctcttcctcttc 322 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 333 ctcttcctcttcctcttcttcttc 310
>gb|AC110525.10| Mus musculus chromosome 8, clone RP23-82N11, complete sequence Length = 153281 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 139159 ctcttcctcttcctcttcctcttc 139136 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 63 cttcctcttcctcttcctcttc 84 |||||||||||||||||||||| Sbjct: 139163 cttcctcttcctcttcctcttc 139142 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||||| |||||||||| Sbjct: 139177 ctcttcctcttccacttcctcttc 139154 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||| |||||||||||||||| Sbjct: 139171 ctcttccacttcctcttcctcttc 139148 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcct 80 |||||||||||||||||||| Sbjct: 139153 ctcttcctcttcctcttcct 139134
>ref|XM_630629.1| Dictyostelium discoideum pantothenate kinase (DDB0231513), partial mRNA Length = 2058 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 300 ctcttcctcttcctcttcctcttc 323 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 295 tcttcctcttcctcttcctcttc 317
>gb|AC165975.4| Mus musculus BAC clone RP23-3L23 from chromosome 5, complete sequence Length = 259091 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 125482 ctcttcctcttcctcttcctcttc 125505 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 125476 ctcttcctcttcctcttcctcttc 125499 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 125470 ctcttcctcttcctcttcctcttc 125493 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 125464 ctcttcctcttcctcttcctcttc 125487 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||| ||||||||||| Sbjct: 125494 ctcttcctcttcttcttcctcttc 125517 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 125488 ctcttcctcttcctcttcttcttc 125511
>gb|AC154387.2| Mus musculus BAC clone RP23-10K1 from chromosome 16, complete sequence Length = 212628 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 118698 ctcttcctcttcctcttcctcttc 118721 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 118692 ctcttcctcttcctcttcctcttc 118715 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 118686 ctcttcctcttcctcttcctcttc 118709 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 118704 ctcttcctcttcctcttcctc 118724
>gb|AC166170.4| Mus musculus BAC clone RP23-174N23 from chromosome 6, complete sequence Length = 216743 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 189554 ctcttcctcttcctcttcctcttc 189577 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 189548 ctcttcctcttcctcttcctcttc 189571 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 189542 ctcttcctcttcctcttcctcttc 189565 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 189536 ctcttcctcttcctcttcctcttc 189559 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 189530 ctcttcctcttcctcttcctcttc 189553 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 189524 ctcttcctcttcctcttcctcttc 189547 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 189518 ctcttcctcttcctcttcctcttc 189541 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 189512 ctcttcctcttcctcttcctcttc 189535 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 189510 tcctcttcctcttcctcttc 189529
>gb|AC166826.4| Mus musculus BAC clone RP23-370K22 from chromosome 16, complete sequence Length = 180840 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 137798 ctcttcctcttcctcttcctcttc 137821 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 137792 ctcttcctcttcctcttcctcttc 137815 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 137786 ctcttcctcttcctcttcctcttc 137809 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 137781 tcttcctcttcctcttcctcttc 137803
>gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosome 16, complete sequence Length = 186202 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 10764 ctcttcctcttcctcttcctcttc 10741 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 10769 tcttcctcttcctcttcctcttc 10747 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 10742 tcttcctcttcctcttcctcttc 10720 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 10737 ctcttcctcttcctcttcctctt 10715
>gb|AC160118.2| Mus musculus BAC clone RP23-440L7 from chromosome 9, complete sequence Length = 198672 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8030 ctcttcctcttcctcttcctcttc 8007 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8024 ctcttcctcttcctcttcctcttc 8001 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8018 ctcttcctcttcctcttcctcttc 7995 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8012 ctcttcctcttcctcttcctcttc 7989 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 8035 tcttcctcttcctcttcctcttc 8013 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctct 82 |||||||||||||||||||||| Sbjct: 8006 ctcttcctcttcctcttcctct 7985
>gb|AC154842.2| Mus musculus BAC clone RP23-55C11 from chromosome 17, complete sequence Length = 252431 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 98889 ctcttcctcttcctcttcctcttc 98866 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 98883 ctcttcctcttcctcttcctcttc 98860 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 98877 ctcttcctcttcctcttcctcttc 98854 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 98871 ctcttcctcttcctcttcctcttc 98848 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 98865 ctcttcctcttcctcttcctcttc 98842 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 98859 ctcttcctcttcctcttcctcttc 98836 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 98894 tcttcctcttcctcttcctcttc 98872 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 98853 ctcttcctcttcctcttcctctt 98831
>gb|AC165356.5| Mus musculus BAC clone RP23-142E18 from chromosome 7, complete sequence Length = 207936 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 92694 ctcttcctcttcctcttcctcttc 92671 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 92688 ctcttcctcttcctcttcctcttc 92665 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 92682 ctcttcctcttcctcttcctcttc 92659 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 92676 ctcttcctcttcctcttcctcttc 92653 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 92670 ctcttcctcttcctcttcctcttc 92647 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 92664 ctcttcctcttcctcttcctcttc 92641 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 92658 ctcttcctcttcctcttcctcttc 92635 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 92652 ctcttcctcttcctcttcctcttc 92629 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 92646 ctcttcctcttcctcttcctcttc 92623 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 92699 tcttcctcttcctcttcctcttc 92677 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 92640 ctcttcctcttcctcttcttcttc 92617
>gb|AC165426.3| Mus musculus BAC clone RP23-157G2 from chromosome 5, complete sequence Length = 245594 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 231576 ctcttcctcttcctcttcctcttc 231553 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 231570 ctcttcctcttcctcttcctcttc 231547 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 231564 ctcttcctcttcctcttcctcttc 231541 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 231581 tcttcctcttcctcttcctcttc 231559 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 60 gctcttcctcttcctcttcctcttc 84 |||| |||||||||||||||||||| Sbjct: 231683 gctcctcctcttcctcttcctcttc 231659 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 231558 ctcttcctcttcctcttcttcttc 231535
>gb|AC154400.2| Mus musculus BAC clone RP23-163P4 from chromosome 16, complete sequence Length = 180951 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 95463 ctcttcctcttcctcttcctcttc 95440 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 95457 ctcttcctcttcctcttcctcttc 95434 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 95451 ctcttcctcttcctcttcctcttc 95428 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 95468 tcttcctcttcctcttcctcttc 95446 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 95445 ctcttcctcttcctcttcttcttc 95422
>gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome 12, complete sequence Length = 199262 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 29426 ctcttcctcttcctcttcctcttc 29403 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 29428 tcctcttcctcttcctcttc 29409
>gb|AC166159.2| Mus musculus BAC clone RP24-129B16 from chromosome 15, complete sequence Length = 216481 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96584 ctcttcctcttcctcttcctcttc 96607 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96578 ctcttcctcttcctcttcctcttc 96601 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96572 ctcttcctcttcctcttcctcttc 96595 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96566 ctcttcctcttcctcttcctcttc 96589 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96560 ctcttcctcttcctcttcctcttc 96583 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96554 ctcttcctcttcctcttcctcttc 96577 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96548 ctcttcctcttcctcttcctcttc 96571 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96542 ctcttcctcttcctcttcctcttc 96565 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96536 ctcttcctcttcctcttcctcttc 96559 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96530 ctcttcctcttcctcttcctcttc 96553 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96524 ctcttcctcttcctcttcctcttc 96547 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96518 ctcttcctcttcctcttcctcttc 96541 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96512 ctcttcctcttcctcttcctcttc 96535 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96506 ctcttcctcttcctcttcctcttc 96529 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96500 ctcttcctcttcctcttcctcttc 96523 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 96494 ctcttcctcttcctcttcctcttc 96517 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 96489 tcttcctcttcctcttcctcttc 96511 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 96590 ctcttcctcttcctcttcttcttc 96613
>gb|AC167973.4| Mus musculus BAC clone RP23-453B4 from chromosome 9, complete sequence Length = 182190 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 86277 ctcttcctcttcctcttcctcttc 86254 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 86301 ctcttcctcttcctcttcctctt 86279 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 ttcctcttcctcttcctcttc 84 ||||||||||||||||||||| Sbjct: 86304 ttcctcttcctcttcctcttc 86284 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 86271 ctcttcctcttcctcttcctc 86251 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||||||||| |||||| Sbjct: 86295 ctcttcctcttcctctttctcttc 86272 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||| |||||||||||| Sbjct: 86289 ctcttcctctttctcttcctcttc 86266 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||| |||||||||||||||||| Sbjct: 86283 ctctttctcttcctcttcctcttc 86260
>gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome 17, complete sequence Length = 202649 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127259 ctcttcctcttcctcttcctcttc 127282 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127253 ctcttcctcttcctcttcctcttc 127276 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127247 ctcttcctcttcctcttcctcttc 127270 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127241 ctcttcctcttcctcttcctcttc 127264 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127235 ctcttcctcttcctcttcctcttc 127258 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127229 ctcttcctcttcctcttcctcttc 127252 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127223 ctcttcctcttcctcttcctcttc 127246 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 127217 ctcttcctcttcctcttcctcttc 127240 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctctt 83 ||||||||||||||||||||||| Sbjct: 127265 ctcttcctcttcctcttcctctt 127287
>gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosome 13, complete sequence Length = 162597 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8182 ctcttcctcttcctcttcctcttc 8205 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8176 ctcttcctcttcctcttcctcttc 8199 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8170 ctcttcctcttcctcttcctcttc 8193 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8164 ctcttcctcttcctcttcctcttc 8187 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8158 ctcttcctcttcctcttcctcttc 8181 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8152 ctcttcctcttcctcttcctcttc 8175 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8146 ctcttcctcttcctcttcctcttc 8169 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8008 ctcttcctcttcctcttcctcttc 8031 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 8002 ctcttcctcttcctcttcctcttc 8025 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7996 ctcttcctcttcctcttcctcttc 8019 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7912 ctcttcctcttcctcttcctcttc 7935 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7882 ctcttcctcttcctcttcctcttc 7905 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7876 ctcttcctcttcctcttcctcttc 7899 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7768 ctcttcctcttcctcttcctcttc 7791 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||||||||| Sbjct: 7762 ctcttcctcttcctcttcctcttc 7785 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 28110 tcttcctcttcctcttcctcttc 28132 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctcttc 84 ||||||||||||||||||||||| Sbjct: 8141 tcttcctcttcctcttcctcttc 8163 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctc 81 ||||||||||||||||||||| Sbjct: 7888 ctcttcctcttcctcttcctc 7908 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctc 81 |||||||||||||||||||| Sbjct: 28295 tcttcctcttcctcttcctc 28314 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 28115 ctcttcctcttcctcttcttcttc 28138 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 8188 ctcttcctcttcctcttcttcttc 8211 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 8014 ctcttcctcttcctcttcttcttc 8037 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 7994 tcctcttcctcttcctcttc 8013 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||| |||||||||||||| Sbjct: 7984 ctcttcctcctcctcttcctcttc 8007 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 7918 ctcttcctcttcctcttcttcttc 7941 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 7910 tcctcttcctcttcctcttc 7929 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||| |||||||||||||| Sbjct: 7900 ctcttcctcctcctcttcctcttc 7923 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 ||||||||||||||| |||||||| Sbjct: 7894 ctcttcctcttcctcctcctcttc 7917 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 7874 tcctcttcctcttcctcttc 7893 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 61 ctcttcctcttcctcttcctcttc 84 |||||||||||||||||| ||||| Sbjct: 7774 ctcttcctcttcctcttcttcttc 7797 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 tcctcttcctcttcctcttc 84 |||||||||||||||||||| Sbjct: 7760 tcctcttcctcttcctcttc 7779 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 62 tcttcctcttcctcttcctc 81 |||||||||||||||||||| Sbjct: 7622 tcttcctcttcctcttcctc 7641 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,375,956 Number of Sequences: 3902068 Number of extensions: 3375956 Number of successful extensions: 203068 Number of sequences better than 10.0: 6062 Number of HSP's better than 10.0 without gapping: 6094 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 143777 Number of HSP's gapped (non-prelim): 53152 length of query: 422 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 400 effective length of database: 17,147,199,772 effective search space: 6858879908800 effective search space used: 6858879908800 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
