| Clone Name | bastl07f06 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_204104.1| Gallus gallus retina and anterior neural fold homeobox (RAX), mRNA Length = 1230 Score = 42.1 bits (21), Expect = 0.98 Identities = 21/21 (100%) Strand = Plus / Minus Query: 77 ggcggcggcggccccatggct 97 ||||||||||||||||||||| Sbjct: 993 ggcggcggcggccccatggct 973
>gb|AF420600.1| Gallus gallus homeobox transcription factor RAX1 (RAX1) mRNA, complete cds Length = 1230 Score = 42.1 bits (21), Expect = 0.98 Identities = 21/21 (100%) Strand = Plus / Minus Query: 77 ggcggcggcggccccatggct 97 ||||||||||||||||||||| Sbjct: 993 ggcggcggcggccccatggct 973
>dbj|AB020318.1| Gallus gallus mRNA for homeobox protein cRax/Rax2/Rx2, complete cds Length = 1195 Score = 42.1 bits (21), Expect = 0.98 Identities = 21/21 (100%) Strand = Plus / Minus Query: 77 ggcggcggcggccccatggct 97 ||||||||||||||||||||| Sbjct: 826 ggcggcggcggccccatggct 806
>gb|DQ215052.1| Taeniopygia guttata clone 0058P0020B08 H2A histone family member V variant 1-like mRNA, complete sequence Length = 704 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 75 acggcggcggcggccccatggctg 98 |||||||||||||| ||||||||| Sbjct: 31 acggcggcggcggcaccatggctg 54
>gb|DQ215051.1| Taeniopygia guttata clone 0061P0027A01 H2A histone family member V variant 1-like mRNA, complete sequence Length = 707 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 75 acggcggcggcggccccatggctg 98 |||||||||||||| ||||||||| Sbjct: 34 acggcggcggcggcaccatggctg 57
>gb|DQ215050.1| Taeniopygia guttata clone 0058P0007H05 H2A histone family member V variant 1-like mRNA, complete sequence Length = 701 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 75 acggcggcggcggccccatggctg 98 |||||||||||||| ||||||||| Sbjct: 28 acggcggcggcggcaccatggctg 51
>gb|DQ215048.1| Taeniopygia guttata clone 0058P0013F02 H2A histone family member V variant 1-like mRNA, complete sequence Length = 685 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 75 acggcggcggcggccccatggctg 98 |||||||||||||| ||||||||| Sbjct: 11 acggcggcggcggcaccatggctg 34
>gb|DQ215047.1| Taeniopygia guttata clone 0058P0026B08 H2A histone family member V variant 1-like mRNA, complete sequence Length = 729 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 75 acggcggcggcggccccatggctg 98 |||||||||||||| ||||||||| Sbjct: 56 acggcggcggcggcaccatggctg 79
>gb|AC135918.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0115F21, complete sequence Length = 128493 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 76 cggcggcggcggccccatggctgc 99 ||||||||||||| |||||||||| Sbjct: 49464 cggcggcggcggcgccatggctgc 49487
>ref|XM_364388.1| Magnaporthe grisea 70-15 predicted protein (MG09233.4) partial mRNA Length = 1641 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 76 cggcggcggcggccccatgg 95 |||||||||||||||||||| Sbjct: 1449 cggcggcggcggccccatgg 1468
>gb|AC141880.3| Mus musculus BAC clone RP24-220N1 from chromosome 15, complete sequence Length = 185646 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 81 gcggcggccccatggctgct 100 |||||||||||||||||||| Sbjct: 158189 gcggcggccccatggctgct 158208
>gb|AC125540.4| Mus musculus BAC clone RP23-229O18 from chromosome 15, complete sequence Length = 162455 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 gcggcggccccatggctgct 100 |||||||||||||||||||| Sbjct: 154499 gcggcggccccatggctgct 154480
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 72 accacggcggcggcggcccc 91 |||||||||||||||||||| Sbjct: 3148730 accacggcggcggcggcccc 3148749
>dbj|AK172262.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830111E09 product:unclassifiable, full insert sequence Length = 1610 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 81 gcggcggccccatggctgct 100 |||||||||||||||||||| Sbjct: 1553 gcggcggccccatggctgct 1534
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 76 cggcggcggcggccccatggctgc 99 ||||||||||||| |||||||||| Sbjct: 6486776 cggcggcggcggcgccatggctgc 6486799
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 ccacggcggcggcggcccca 92 |||||||||||||||||||| Sbjct: 27534420 ccacggcggcggcggcccca 27534439
>dbj|AP003706.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1125_C04 Length = 98476 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 ccacggcggcggcggcccca 92 |||||||||||||||||||| Sbjct: 55123 ccacggcggcggcggcccca 55142
>dbj|AP003223.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0007F06 Length = 150817 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 ccacggcggcggcggcccca 92 |||||||||||||||||||| Sbjct: 1714 ccacggcggcggcggcccca 1733
>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome Length = 2343476 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 271 gtgcctgcgatggaagagcc 290 |||||||||||||||||||| Sbjct: 41556 gtgcctgcgatggaagagcc 41575 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,372,287 Number of Sequences: 3902068 Number of extensions: 2372287 Number of successful extensions: 67527 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 67166 Number of HSP's gapped (non-prelim): 361 length of query: 296 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 274 effective length of database: 17,147,199,772 effective search space: 4698332737528 effective search space used: 4698332737528 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)