>ref|NM_204104.1| Gallus gallus retina and anterior neural fold homeobox (RAX), mRNA
          Length = 1230

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 77  ggcggcggcggccccatggct 97
           |||||||||||||||||||||
Sbjct: 993 ggcggcggcggccccatggct 973

>gb|AF420600.1| Gallus gallus homeobox transcription factor RAX1 (RAX1) mRNA,
           complete cds
          Length = 1230

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 77  ggcggcggcggccccatggct 97
           |||||||||||||||||||||
Sbjct: 993 ggcggcggcggccccatggct 973

>dbj|AB020318.1| Gallus gallus mRNA for homeobox protein cRax/Rax2/Rx2, complete cds
          Length = 1195

 Score = 42.1 bits (21), Expect = 0.98
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 77  ggcggcggcggccccatggct 97
           |||||||||||||||||||||
Sbjct: 826 ggcggcggcggccccatggct 806

>gb|DQ215052.1| Taeniopygia guttata clone 0058P0020B08 H2A histone family member
          V variant 1-like mRNA, complete sequence
          Length = 704

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 75 acggcggcggcggccccatggctg 98
          |||||||||||||| |||||||||
Sbjct: 31 acggcggcggcggcaccatggctg 54

>gb|DQ215051.1| Taeniopygia guttata clone 0061P0027A01 H2A histone family member
          V variant 1-like mRNA, complete sequence
          Length = 707

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 75 acggcggcggcggccccatggctg 98
          |||||||||||||| |||||||||
Sbjct: 34 acggcggcggcggcaccatggctg 57

>gb|DQ215050.1| Taeniopygia guttata clone 0058P0007H05 H2A histone family member
          V variant 1-like mRNA, complete sequence
          Length = 701

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 75 acggcggcggcggccccatggctg 98
          |||||||||||||| |||||||||
Sbjct: 28 acggcggcggcggcaccatggctg 51

>gb|DQ215048.1| Taeniopygia guttata clone 0058P0013F02 H2A histone family member
          V variant 1-like mRNA, complete sequence
          Length = 685

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 75 acggcggcggcggccccatggctg 98
          |||||||||||||| |||||||||
Sbjct: 11 acggcggcggcggcaccatggctg 34

>gb|DQ215047.1| Taeniopygia guttata clone 0058P0026B08 H2A histone family member
          V variant 1-like mRNA, complete sequence
          Length = 729

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 75 acggcggcggcggccccatggctg 98
          |||||||||||||| |||||||||
Sbjct: 56 acggcggcggcggcaccatggctg 79

>gb|AC135918.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0115F21, complete sequence
          Length = 128493

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 76    cggcggcggcggccccatggctgc 99
             ||||||||||||| ||||||||||
Sbjct: 49464 cggcggcggcggcgccatggctgc 49487

>ref|XM_364388.1| Magnaporthe grisea 70-15 predicted protein (MG09233.4) partial mRNA
          Length = 1641

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 76   cggcggcggcggccccatgg 95
            ||||||||||||||||||||
Sbjct: 1449 cggcggcggcggccccatgg 1468

>gb|AC141880.3| Mus musculus BAC clone RP24-220N1 from chromosome 15, complete sequence
          Length = 185646

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 81     gcggcggccccatggctgct 100
              ||||||||||||||||||||
Sbjct: 158189 gcggcggccccatggctgct 158208

>gb|AC125540.4| Mus musculus BAC clone RP23-229O18 from chromosome 15, complete sequence
          Length = 162455

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 81     gcggcggccccatggctgct 100
              ||||||||||||||||||||
Sbjct: 154499 gcggcggccccatggctgct 154480

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 72      accacggcggcggcggcccc 91
               ||||||||||||||||||||
Sbjct: 3148730 accacggcggcggcggcccc 3148749

>dbj|AK172262.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830111E09 product:unclassifiable, full
            insert sequence
          Length = 1610

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 81   gcggcggccccatggctgct 100
            ||||||||||||||||||||
Sbjct: 1553 gcggcggccccatggctgct 1534

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 76      cggcggcggcggccccatggctgc 99
               ||||||||||||| ||||||||||
Sbjct: 6486776 cggcggcggcggcgccatggctgc 6486799

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 73       ccacggcggcggcggcccca 92
                ||||||||||||||||||||
Sbjct: 27534420 ccacggcggcggcggcccca 27534439

>dbj|AP003706.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1125_C04
          Length = 98476

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    ccacggcggcggcggcccca 92
             ||||||||||||||||||||
Sbjct: 55123 ccacggcggcggcggcccca 55142

>dbj|AP003223.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0007F06
          Length = 150817

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 73   ccacggcggcggcggcccca 92
            ||||||||||||||||||||
Sbjct: 1714 ccacggcggcggcggcccca 1733

>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome
          Length = 2343476

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   gtgcctgcgatggaagagcc 290
             ||||||||||||||||||||
Sbjct: 41556 gtgcctgcgatggaagagcc 41575


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,372,287
Number of Sequences: 3902068
Number of extensions: 2372287
Number of successful extensions: 67527
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67166
Number of HSP's gapped (non-prelim): 361
length of query: 296
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 274
effective length of database: 17,147,199,772
effective search space: 4698332737528
effective search space used: 4698332737528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)