>ref|XM_483229.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2900

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 76/88 (86%), Gaps = 4/88 (4%)
 Strand = Plus / Plus

                                                                       
Query: 152 cacccgtctcggacccaggaccccatcgggctggatctagggtt-gcaaggggaggggtt 210
           |||||||||||| ||| ||||||||  |||||||||||||| || || |||   ||||||
Sbjct: 181 cacccgtctcggccccgggaccccactgggctggatctaggtttggcgagg---ggggtt 237

                                       
Query: 211 ctggaggcctccgccacgatggaggcgg 238
           ||||| ||||||||| ||||||||||||
Sbjct: 238 ctggaagcctccgccgcgatggaggcgg 265



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 264 cttcaaggccgacttcaccgactccggcgcctaccagctccgggagcgcatgcgggagaa 323
           ||||||||||||| |||||| | |||||| |  ||||||| | |||||| ||||||||||
Sbjct: 303 cttcaaggccgacctcaccggcgccggcgtcgtccagctcagcgagcgcgtgcgggagaa 362

                        
Query: 324 gctgcgtgagttc 336
           |||||| ||||||
Sbjct: 363 gctgcgggagttc 375

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 76/88 (86%), Gaps = 4/88 (4%)
 Strand = Plus / Plus

                                                                            
Query: 152      cacccgtctcggacccaggaccccatcgggctggatctagggtt-gcaaggggaggggtt 210
                |||||||||||| ||| ||||||||  |||||||||||||| || || |||   ||||||
Sbjct: 24931653 cacccgtctcggccccgggaccccactgggctggatctaggtttggcgagg---ggggtt 24931709

                                            
Query: 211      ctggaggcctccgccacgatggaggcgg 238
                ||||| ||||||||| ||||||||||||
Sbjct: 24931710 ctggaagcctccgccgcgatggaggcgg 24931737



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                            
Query: 264      cttcaaggccgacttcaccgactccggcgcctaccagctccgggagcgcatgcgggagaa 323
                ||||||||||||| |||||| | |||||| |  ||||||| | |||||| ||||||||||
Sbjct: 24931775 cttcaaggccgacctcaccggcgccggcgtcgtccagctcagcgagcgcgtgcgggagaa 24931834

                             
Query: 324      gctgcgtgagttc 336
                |||||| ||||||
Sbjct: 24931835 gctgcgggagttc 24931847

>dbj|AP003883.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1134_H03
          Length = 135914

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 76/88 (86%), Gaps = 4/88 (4%)
 Strand = Plus / Plus

                                                                         
Query: 152   cacccgtctcggacccaggaccccatcgggctggatctagggtt-gcaaggggaggggtt 210
             |||||||||||| ||| ||||||||  |||||||||||||| || || |||   ||||||
Sbjct: 33368 cacccgtctcggccccgggaccccactgggctggatctaggtttggcgagg---ggggtt 33424

                                         
Query: 211   ctggaggcctccgccacgatggaggcgg 238
             ||||| ||||||||| ||||||||||||
Sbjct: 33425 ctggaagcctccgccgcgatggaggcgg 33452



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 264   cttcaaggccgacttcaccgactccggcgcctaccagctccgggagcgcatgcgggagaa 323
             ||||||||||||| |||||| | |||||| |  ||||||| | |||||| ||||||||||
Sbjct: 33490 cttcaaggccgacctcaccggcgccggcgtcgtccagctcagcgagcgcgtgcgggagaa 33549

                          
Query: 324   gctgcgtgagttc 336
             |||||| ||||||
Sbjct: 33550 gctgcgggagttc 33562

>dbj|AK064868.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000I21, full
           insert sequence
          Length = 2901

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 76/88 (86%), Gaps = 4/88 (4%)
 Strand = Plus / Plus

                                                                       
Query: 152 cacccgtctcggacccaggaccccatcgggctggatctagggtt-gcaaggggaggggtt 210
           |||||||||||| ||| ||||||||  |||||||||||||| || || |||   ||||||
Sbjct: 181 cacccgtctcggccccgggaccccactgggctggatctaggtttggcgagg---ggggtt 237

                                       
Query: 211 ctggaggcctccgccacgatggaggcgg 238
           ||||| ||||||||| ||||||||||||
Sbjct: 238 ctggaagcctccgccgcgatggaggcgg 265



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 264 cttcaaggccgacttcaccgactccggcgcctaccagctccgggagcgcatgcgggagaa 323
           ||||||||||||| |||||| | |||||| |  ||||||| | |||||| ||||||||||
Sbjct: 303 cttcaaggccgacctcaccggcgccggcgtcgtccagctcagcgagcgcgtgcgggagaa 362

                        
Query: 324 gctgcgtgagttc 336
           |||||| ||||||
Sbjct: 363 gctgcgggagttc 375

>gb|AC162379.2| Mus musculus BAC clone RP23-132A15 from chromosome 12, complete
             sequence
          Length = 238126

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    accccatccccacgctccagg 37
             |||||||||||||||||||||
Sbjct: 22191 accccatccccacgctccagg 22171

>ref|XM_592247.2| PREDICTED: Bos taurus similar to zinc finger, FYVE domain containing
            26 (LOC514402), mRNA
          Length = 7731

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2789 accccatccccacgctccagg 2809

>gb|AC158527.2| Mus musculus BAC clone RP23-266E16 from chromosome 12, complete
             sequence
          Length = 218736

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    accccatccccacgctccagg 37
             |||||||||||||||||||||
Sbjct: 91822 accccatccccacgctccagg 91802

>ref|XM_990628.1| PREDICTED: Mus musculus zinc finger, FYVE domain containing 26,
            transcript variant 5 (Zfyve26), mRNA
          Length = 4863

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2967 accccatccccacgctccagg 2987

>ref|XM_990599.1| PREDICTED: Mus musculus zinc finger, FYVE domain containing 26,
            transcript variant 4 (Zfyve26), mRNA
          Length = 9393

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2967 accccatccccacgctccagg 2987

>ref|XM_919000.2| PREDICTED: Mus musculus zinc finger, FYVE domain containing 26,
            transcript variant 11 (Zfyve26), mRNA
          Length = 4863

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2967 accccatccccacgctccagg 2987

>ref|XM_904819.2| PREDICTED: Mus musculus zinc finger, FYVE domain containing 26,
            transcript variant 10 (Zfyve26), mRNA
          Length = 9393

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2967 accccatccccacgctccagg 2987

>ref|XM_899272.2| PREDICTED: Mus musculus zinc finger, FYVE domain containing 26,
            transcript variant 2 (Zfyve26), mRNA
          Length = 4863

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2967 accccatccccacgctccagg 2987

>ref|XM_986993.1| PREDICTED: Mus musculus zinc finger, FYVE domain containing 26,
            transcript variant 9 (Zfyve26), mRNA
          Length = 9393

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2967 accccatccccacgctccagg 2987

>gb|AC112791.3| Mus musculus BAC clone RP23-182O1 from 13, complete sequence
          Length = 208443

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 392    gcgaggacgaggccaggaagg 412
              |||||||||||||||||||||
Sbjct: 206848 gcgaggacgaggccaggaagg 206868

>gb|AC114827.4| Mus musculus BAC clone RP24-447F21 from 13, complete sequence
          Length = 157432

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 392  gcgaggacgaggccaggaagg 412
            |||||||||||||||||||||
Sbjct: 2968 gcgaggacgaggccaggaagg 2988

>dbj|AK220333.1| Mus musculus mRNA for mKIAA0321 protein
          Length = 9339

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2916 accccatccccacgctccagg 2936

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 261     catcttcaaggccgacttcaccgac 285
               |||||||||||||||| ||||||||
Sbjct: 3089134 catcttcaaggccgacatcaccgac 3089158

>dbj|AK132344.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:4022426B02 product:Hypothetical
            arginine-rich region containing protein, full insert
            sequence
          Length = 4831

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2935 accccatccccacgctccagg 2955

>dbj|AK041668.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A630028O16 product:hypothetical
            Arginine-rich region containing protein, full insert
            sequence
          Length = 4434

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 17   accccatccccacgctccagg 37
            |||||||||||||||||||||
Sbjct: 2942 accccatccccacgctccagg 2962

>emb|AL591790.1|SME591790 Sinorhizobium meliloti 1021 complete chromosome; segment 9/12
          Length = 323450

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 261    catcttcaaggccgacttcaccga 284
              |||||||||||||||| |||||||
Sbjct: 129757 catcttcaaggccgacatcaccga 129780

>gb|AC019043.8| Homo sapiens BAC clone RP11-11B21 from 7, complete sequence
          Length = 211680

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    gcgcccaggcgcctcctccc 56
             ||||||||||||||||||||
Sbjct: 34847 gcgcccaggcgcctcctccc 34828

>emb|AL359741.9| Human DNA sequence from clone RP11-161P17 on chromosome 13 Contains a
             novel pseudogene, complete sequence
          Length = 139877

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 40    cccaggcgcctcctcccggc 59
             ||||||||||||||||||||
Sbjct: 93098 cccaggcgcctcctcccggc 93079

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 282     cgactccggcgcctaccagctccg 305
               ||||||| ||||||||||||||||
Sbjct: 3577059 cgactcccgcgcctaccagctccg 3577082

>emb|AL662875.14| Mouse DNA sequence from clone RP23-67E18 on chromosome 11 Contains the 3'
              end of the gene for the likely ortholog of H. sapiens
              C/EBP-induced protein (5730593F17Rik), the Ugalt2 gene for
              UDP-galactose translocator 2, the Spop gene for
              speckle-type POZ protein, the Nxph3 gene for neurexophilin
              3, the Ngfr gene for nerve growth factor receptor (TNFR
              superfamily, member 16), the 5' end of a novel gene and a
              CpG island, complete sequence
          Length = 255199

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 29     cgctccaggcgcccaggcgcctcc 52
              |||||| |||||||||||||||||
Sbjct: 142512 cgctcctggcgcccaggcgcctcc 142535

>gb|AC107462.5| Homo sapiens BAC clone RP11-338B9 from 4, complete sequence
          Length = 192173

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 371    tgcttctcaggaatggaaaa 390
              ||||||||||||||||||||
Sbjct: 111640 tgcttctcaggaatggaaaa 111621

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 392     gcgaggacgaggccaggaag 411
               ||||||||||||||||||||
Sbjct: 3008541 gcgaggacgaggccaggaag 3008560

>gb|U63518.1|SAU63518 Streptomyces arenae malate synthase (aceB) gene, complete cds
          Length = 3147

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 52  ctcccggctgcgccgaactc 71
           ||||||||||||||||||||
Sbjct: 510 ctcccggctgcgccgaactc 491


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,631,974
Number of Sequences: 3902068
Number of extensions: 2631974
Number of successful extensions: 55847
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55589
Number of HSP's gapped (non-prelim): 258
length of query: 418
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 396
effective length of database: 17,147,199,772
effective search space: 6790291109712
effective search space used: 6790291109712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)