>emb|Y18577.1|FTR18577 Flaveria trinervia mRNA for ZF-HD homeobox protein (hb1 gene) clone
           FtHB1
          Length = 1364

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 139 tcgccaccggcgtcgactccgc 160
           ||||||||||||||||||||||
Sbjct: 771 tcgccaccggcgtcgactccgc 792

>gb|AF466199.1| Sorghum bicolor putative receptor protein kinase,
             aminoalcoholphosphotransferase, putative growth-regulating
             factor 1, putative GAG-POL precursor, putative GAG-POL
             precursor, putative RIRE2 orf3, putative anthocyanin
             regulatory C1, putative protein T30F21.6, putative copia
             polyprotein, putative copia polyprotein, putative protein
             NP_196765.1, and gb protein genes, complete cds; and
             putative zinc finger protein gene, partial cds
          Length = 144159

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 137   cctcgccaccggcgtcgactccgcg 161
             ||||||||||||||||||| |||||
Sbjct: 37403 cctcgccaccggcgtcgacaccgcg 37427

>gb|AY530952.1| Zea mays unknown (Z576C20.2), putative heme oxygenase 1 (Z576C20.3),
             anthocyanin biosynthesis regulatory protein Pl1_B73
             (Z576C20.4), putative growth-regulating factor 1
             (Z576C20.6), and putative aminoalcoholphosphotransferase
             (Z576C20.14) genes, complete cds; and putative receptor
             protein kinase (Z576C20.21) gene, partial cds
          Length = 155173

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 137   cctcgccaccggcgtcgactccgcg 161
             ||||||||||||||||||| |||||
Sbjct: 52025 cctcgccaccggcgtcgacaccgcg 52001

>gb|AY530951.1| Zea mays putative growth-regulating factor 1 (Z214A02.12), putative 40S
             ribosomal protein S8 (Z214A02.25), and putative casein
             kinase I (Z214A02.27) genes, complete cds
          Length = 158797

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 137   cctcgccaccggcgtcgactccgcg 161
             ||||||||||||||||||| |||||
Sbjct: 57189 cctcgccaccggcgtcgacaccgcg 57165

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 231     gctcgagcggcagctcgacta 251
               |||||||||||||||||||||
Sbjct: 1436910 gctcgagcggcagctcgacta 1436930

>ref|NM_001030553.1| Gallus gallus fem-1 homolog b (C. elegans) (FEM1B), mRNA
          Length = 3358

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 318  tctggggatctggttctgat 337
            ||||||||||||||||||||
Sbjct: 1899 tctggggatctggttctgat 1880

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 230    cgctcgagcggcagctcgac 249
              ||||||||||||||||||||
Sbjct: 175887 cgctcgagcggcagctcgac 175906

>ref|NM_172267.2| Mus musculus phytanoyl-CoA dioxygenase domain containing 1
           (Phyhd1), mRNA
          Length = 1348

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 321 ggggatctggttctgatccatgga 344
           |||| |||||||||||||||||||
Sbjct: 826 gggggtctggttctgatccatgga 849

>gb|AC161931.6| Mus musculus chromosome 3, clone RP23-290N20, complete sequence
          Length = 186062

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 323    ggatctggttctgatccatg 342
              ||||||||||||||||||||
Sbjct: 166221 ggatctggttctgatccatg 166240

>emb|AL353725.14| Human DNA sequence from clone RP11-218C11 on chromosome 10, complete
             sequence
          Length = 61524

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 190   aaggaggggcccgggagtgt 209
             ||||||||||||||||||||
Sbjct: 59451 aaggaggggcccgggagtgt 59470

>emb|AJ719529.1| Gallus gallus mRNA for hypothetical protein, clone 3b14
          Length = 3358

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 318  tctggggatctggttctgat 337
            ||||||||||||||||||||
Sbjct: 1899 tctggggatctggttctgat 1880

>dbj|AK138607.1| Mus musculus adult male spinal cord cDNA, RIKEN full-length
           enriched library, clone:A330074F16 product:leucine-rich
           repeat-containing 8, full insert sequence
          Length = 1350

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 321 ggggatctggttctgatccatgga 344
           |||| |||||||||||||||||||
Sbjct: 847 gggggtctggttctgatccatgga 870

>dbj|AK005293.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
            library, clone:1500019N11 product:leucine-rich
            repeat-containing 8, full insert sequence
          Length = 1671

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 321  ggggatctggttctgatccatgga 344
            |||| |||||||||||||||||||
Sbjct: 1173 gggggtctggttctgatccatgga 1196

>gb|AC101891.8| Mus musculus chromosome 3, clone RP23-468J10, complete sequence
          Length = 174044

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 323    ggatctggttctgatccatg 342
              ||||||||||||||||||||
Sbjct: 157712 ggatctggttctgatccatg 157693

>gb|BC039982.1| Mus musculus phytanoyl-CoA dioxygenase domain containing 1, mRNA
           (cDNA clone IMAGE:4953035), complete cds
          Length = 1333

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 321 ggggatctggttctgatccatgga 344
           |||| |||||||||||||||||||
Sbjct: 814 gggggtctggttctgatccatgga 837

>ref|XM_238162.3| PREDICTED: Rattus norvegicus protein tyrosine phosphatase, receptor
            type, f polypeptide (PTPRF), interacting protein, alpha 1
            (predicted) (Ppfia1_predicted), mRNA
          Length = 4423

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 276  gcggctggctatccaagaga 295
            ||||||||||||||||||||
Sbjct: 3222 gcggctggctatccaagaga 3241

>gb|AC132956.4| Mus musculus BAC clone RP23-106K20 from chromosome 7, complete sequence
          Length = 195204

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 325   atctggttctgatccatgga 344
             ||||||||||||||||||||
Sbjct: 95199 atctggttctgatccatgga 95218

>gb|AC175034.1| Mus musculus BAC clone RP23-204E23 from chromosome 7, complete sequence
          Length = 208487

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 325   atctggttctgatccatgga 344
             ||||||||||||||||||||
Sbjct: 15470 atctggttctgatccatgga 15451

>gb|AC145294.4| Mus musculus BAC clone RP23-88B16 from 7, complete sequence
          Length = 217265

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 325  atctggttctgatccatgga 344
            ||||||||||||||||||||
Sbjct: 4286 atctggttctgatccatgga 4305

>gb|BC048152.1| Mus musculus leucine rich repeat containing 8A, mRNA (cDNA clone
            MGC:61242 IMAGE:5708850), complete cds
          Length = 4344

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 321  ggggatctggttctgatccatgga 344
            |||| |||||||||||||||||||
Sbjct: 3817 gggggtctggttctgatccatgga 3840

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 142     ccaccggcgtcgactccgcggccg 165
               ||||||||||||| ||||||||||
Sbjct: 4800759 ccaccggcgtcgattccgcggccg 4800736

>gb|U02079.1|MMU02079 Mus musculus T cell transcription factor NFAT1 isoform A mRNA,
            complete cds
          Length = 3419

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 321  ggggatctggttctgatccatgga 344
            |||| |||||||||||||||||||
Sbjct: 3214 gggggtctggttctgatccatgga 3191

>emb|AL954388.5| Mouse DNA sequence from clone RP23-395P6 on chromosome 2, complete
            sequence
          Length = 131825

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 321  ggggatctggttctgatccatgga 344
            |||| |||||||||||||||||||
Sbjct: 5034 gggggtctggttctgatccatgga 5057


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,514,445
Number of Sequences: 3902068
Number of extensions: 2514445
Number of successful extensions: 43342
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43167
Number of HSP's gapped (non-prelim): 175
length of query: 404
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 382
effective length of database: 17,147,199,772
effective search space: 6550230312904
effective search space used: 6550230312904
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)