>ref|XM_867896.1| PREDICTED: Bos taurus similar to NHL repeat containing 2
          (LOC615956), mRNA
          Length = 1060

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 62 gcgccgccatgttctctccg 81
          ||||||||||||||||||||
Sbjct: 34 gcgccgccatgttctctccg 15

>emb|AL392087.7| Human DNA sequence from clone RP11-454H24 on chromosome 10 Contains
             part of a novel gene (KIAA0534), complete sequence
          Length = 193980

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   gtagtttgctagtttgcttt 357
             ||||||||||||||||||||
Sbjct: 25283 gtagtttgctagtttgcttt 25264

>emb|AL590464.1|SCO590464 Streptomyces coelicolor plasmid SCP1; segment 2/2
          Length = 178073

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 210    cctggtccagttcgccggtg 229
              ||||||||||||||||||||
Sbjct: 159938 cctggtccagttcgccggtg 159919

>emb|AL590463.1|SCO590463 Streptomyces coelicolor plasmid SCP1; segment 1/2
          Length = 178000

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   cctggtccagttcgccggtg 229
             ||||||||||||||||||||
Sbjct: 18136 cctggtccagttcgccggtg 18155

>gb|AC023302.9| Homo sapiens chromosome 15, clone RP11-28H5, complete sequence
          Length = 151927

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 399   tgctagtttgctagtctgat 418
             ||||||||||||||||||||
Sbjct: 62145 tgctagtttgctagtctgat 62126

>gb|AC027808.9| Homo sapiens chromosome 15, clone RP11-351M8, complete sequence
          Length = 221936

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 399  tgctagtttgctagtctgat 418
            ||||||||||||||||||||
Sbjct: 5116 tgctagtttgctagtctgat 5135

>dbj|AK119851.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-178-F09, full
            insert sequence
          Length = 2863

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 219  gttcgccggtgcgtcgcccg 238
            ||||||||||||||||||||
Sbjct: 2409 gttcgccggtgcgtcgcccg 2428

>emb|AL831761.9| Mouse DNA sequence from clone RP23-318H16 on chromosome 4, complete
             sequence
          Length = 179556

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   tttcctgtctcaccaggctg 296
             ||||||||||||||||||||
Sbjct: 44601 tttcctgtctcaccaggctg 44582


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,261,326
Number of Sequences: 3902068
Number of extensions: 2261326
Number of successful extensions: 45398
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45384
Number of HSP's gapped (non-prelim): 14
length of query: 467
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 445
effective length of database: 17,147,199,772
effective search space: 7630503898540
effective search space used: 7630503898540
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)