| Clone Name | bastl05d08 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 246 cggcggcgatggaccaggtgcagcggaagagcagcctgaggtcgc 290 ||||||||||||| ||||||| ||||||||| ||||||||||||| Sbjct: 27136582 cggcggcgatggagcaggtgcggcggaagagtagcctgaggtcgc 27136626 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 357 tcgacggcaacggcaacggc 376 |||||||||||||||||||| Sbjct: 25922650 tcgacggcaacggcaacggc 25922669 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 320 cccggcctcggcgagcggcg 339 |||||||||||||||||||| Sbjct: 24103365 cccggcctcggcgagcggcg 24103346
>dbj|AP004858.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1725_H08 Length = 155431 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 246 cggcggcgatggaccaggtgcagcggaagagcagcctgaggtcgc 290 ||||||||||||| ||||||| ||||||||| ||||||||||||| Sbjct: 33031 cggcggcgatggagcaggtgcggcggaagagtagcctgaggtcgc 33075
>dbj|AP004139.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1486_E07 Length = 110494 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 246 cggcggcgatggaccaggtgcagcggaagagcagcctgaggtcgc 290 ||||||||||||| ||||||| ||||||||| ||||||||||||| Sbjct: 108231 cggcggcgatggagcaggtgcggcggaagagtagcctgaggtcgc 108275
>dbj|AK101871.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033070F06, full insert sequence Length = 3349 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 246 cggcggcgatggaccaggtgcagcggaagagcagcctgaggtcgc 290 ||||||||||||| ||||||| ||||||||| ||||||||||||| Sbjct: 86 cggcggcgatggagcaggtgcggcggaagagtagcctgaggtcgc 130
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 351 tcaagatcgacggcaacggcaacggcaacggc 382 |||||||| ||||||||||||||||||||||| Sbjct: 4907932 tcaagatcaacggcaacggcaacggcaacggc 4907901 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 351 tcaagatcgacggcaacggcaacggcaacggc 382 |||||||| ||||||||||||||||||||||| Sbjct: 2530856 tcaagatcaacggcaacggcaacggcaacggc 2530887 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 4907917 acggcaacggcaacggcaacggc 4907895 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2530889 acggcaacggcaacggcaacggc 2530911 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2530883 acggcaacggcaacggcaacggc 2530905 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2530877 acggcaacggcaacggcaacggc 2530899 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2530871 acggcaacggcaacggcaacggc 2530893 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 2528903 acggcaacggcaacggcaacg 2528883 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 4907911 acggcaacggcaacggcaac 4907892 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 2530895 acggcaacggcaacggcaac 2530914 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 2256098 gcaacggcaacggcaacggc 2256079
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 358 cgacggcaacggcaacggcaacggc 382 ||||||||||||||||||||||||| Sbjct: 7055284 cgacggcaacggcaacggcaacggc 7055260 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 733838 acggcaacggcaacggcaacggc 733860 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 733832 acggcaacggcaacggcaacggc 733854 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 733827 cggcaacggcaacggcaacggc 733848 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacgg 381 ||||||||||||||||||||| Sbjct: 8706410 cggcaacggcaacggcaacgg 8706430 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacgg 381 ||||||||||||||||||||| Sbjct: 8706248 cggcaacggcaacggcaacgg 8706268 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 5145273 acggcaacggcaacggcaacg 5145253 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 8706511 acggcaacggcaacggcaac 8706530 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 397 cgtccccggcgccgacgtcggcgg 420 |||||||||| ||||||||||||| Sbjct: 7131244 cgtccccggctccgacgtcggcgg 7131221 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 365 aacggcaacggcaacggccc 384 |||||||||||||||||||| Sbjct: 3308956 aacggcaacggcaacggccc 3308975 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 733844 acggcaacggcaacggcaac 733863
>emb|AJ303031.1|MMU303031 Mycosphaerella musicola microsatellite flanking region, clone MmSSR21 Length = 638 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggcc 383 |||||||||||||||||||||||| Sbjct: 255 acggcaacggcaacggcaacggcc 278 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 249 acggcaacggcaacggcaacggc 271 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 243 acggcaacggcaacggcaacggc 265 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 238 cggcaacggcaacggcaacggc 259
>gb|J02527.1|DROGART Drosophila melanogaster Gart polypeptide gene, complete cds, alternatively spliced and pupal cuticle protein gene, complete cds Length = 9953 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 359 gacggcaacggcaacggcaacggc 382 |||||||||||||||||||||||| Sbjct: 2902 gacggcaacggcaacggcaacggc 2879 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 2895 acggcaacggcaacggcaac 2876
>gb|AY190947.1| Drosophila pseudoobscura clone DPSF01_40_G23 (D1426) genomic sequence Length = 42336 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 358 cgacggcaacggcaacggcaacgg 381 |||||||||||||||||||||||| Sbjct: 33518 cgacggcaacggcaacggcaacgg 33541 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 359 gacggcaacggcaacggcaacggc 382 |||||| ||||||||||||||||| Sbjct: 33513 gacggcgacggcaacggcaacggc 33536
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggcc 383 |||||||||||||||||||||||| Sbjct: 1919986 acggcaacggcaacggcaacggcc 1919963 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 1919991 cggcaacggcaacggcaacggc 1919970
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2801730 acggcaacggcaacggcaacggc 2801708 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2801724 acggcaacggcaacggcaacggc 2801702 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2801718 acggcaacggcaacggcaacggc 2801696 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2801712 acggcaacggcaacggcaacggc 2801690 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 2801734 ggcaacggcaacggcaacggc 2801714
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 10390 acggcaacggcaacggcaacggc 10368 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 10384 acggcaacggcaacggcaacg 10364
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 522910 acggcaacggcaacggcaacggc 522932 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 522905 cggcaacggcaacggcaacggc 522926
>gb|AY685231.1| Neurospora crassa F-box/WD-40 repeat-containing protein (fwd-1) mRNA, complete cds Length = 3033 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2674 acggcaacggcaacggcaacggc 2696
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1401572 acggcaacggcaacggcaacggc 1401550 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 1401566 acggcaacggcaacggcaacgg 1401545 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 1401576 ggcaacggcaacggcaacggc 1401556
>ref|XM_323892.1| Neurospora crassa OR74A hypothetical protein (NCU04540.1) partial mRNA Length = 3033 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2674 acggcaacggcaacggcaacggc 2696
>ref|XM_950887.1| Neurospora crassa OR74A hypothetical protein (NCU04540.1) partial mRNA Length = 3033 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2674 acggcaacggcaacggcaacggc 2696
>ref|XM_952082.1| Neurospora crassa OR74A hypothetical protein (NCU01752.1) partial mRNA Length = 1854 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1307 acggcaacggcaacggcaacggc 1329 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1301 acggcaacggcaacggcaacggc 1323 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1295 acggcaacggcaacggcaacggc 1317 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 1313 acggcaacggcaacggcaacgg 1334
>ref|XM_954064.1| Neurospora crassa OR74A hypothetical protein (NCU09213.1) partial mRNA Length = 1263 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 986 acggcaacggcaacggcaacggc 1008 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 982 ggcaacggcaacggcaacggc 1002
>ref|XM_954186.1| Neurospora crassa OR74A hypothetical protein (NCU08189.1) partial mRNA Length = 1155 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggcc 383 ||||||||||||||||||||||| Sbjct: 60 cggcaacggcaacggcaacggcc 82
>ref|XM_956291.1| Neurospora crassa OR74A hypothetical protein ( (AL451021) related to QID3 protein [Neurospora crassa OR74A] ) (NCU01298.1) partial mRNA Length = 699 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 176 acggcaacggcaacggcaacggc 198
>ref|XM_956346.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial mRNA Length = 2178 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1871 acggcaacggcaacggcaacggc 1893
>ref|XM_326790.1| Neurospora crassa OR74A hypothetical protein ( (AL451021) related to QID3 protein [Neurospora crassa OR74A] ) (NCU01298.1) partial mRNA Length = 699 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 176 acggcaacggcaacggcaacggc 198
>ref|XM_326845.1| Neurospora crassa OR74A hypothetical protein (NCU01353.1) partial mRNA Length = 2178 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1871 acggcaacggcaacggcaacggc 1893
>ref|XM_328190.1| Neurospora crassa OR74A hypothetical protein (NCU01752.1) partial mRNA Length = 1854 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1307 acggcaacggcaacggcaacggc 1329 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1301 acggcaacggcaacggcaacggc 1323 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1295 acggcaacggcaacggcaacggc 1317 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 1313 acggcaacggcaacggcaacgg 1334
>ref|XM_328894.1| Neurospora crassa OR74A hypothetical protein (NCU08189.1) partial mRNA Length = 1155 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggcc 383 ||||||||||||||||||||||| Sbjct: 60 cggcaacggcaacggcaacggcc 82
>ref|XM_331604.1| Neurospora crassa OR74A hypothetical protein (NCU09213.1) partial mRNA Length = 1263 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 986 acggcaacggcaacggcaacggc 1008 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 982 ggcaacggcaacggcaacggc 1002
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2142537 acggcaacggcaacggcaacggc 2142559 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2142531 acggcaacggcaacggcaacggc 2142553 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2142525 acggcaacggcaacggcaacggc 2142547 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2137075 acggcaacggcaacggcaacggc 2137053 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 2137080 cggcaacggcaacggcaacggc 2137059 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 2142521 ggcaacggcaacggcaacggc 2142541 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 2137069 acggcaacggcaacggcaacg 2137049 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 2142543 acggcaacggcaacggcaac 2142562 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacg 380 |||||||||||||||||||| Sbjct: 1416417 cggcaacggcaacggcaacg 1416436
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2981368 acggcaacggcaacggcaacggc 2981346 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2981362 acggcaacggcaacggcaacggc 2981340 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2981356 acggcaacggcaacggcaacggc 2981334 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggccc 384 |||||||||||||||||||||| Sbjct: 2126459 gcaacggcaacggcaacggccc 2126438 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 2981372 ggcaacggcaacggcaacggc 2981352
>ref|XM_718288.1| Candida albicans SC5314 hypothetical protein (CaO19_12351), mRNA Length = 1380 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 890 acggcaacggcaacggcaacggc 912 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 896 acggcaacggcaacggcaacgg 917
>ref|XM_715743.1| Candida albicans SC5314 tRNA splicing ligase Trl1p (CaO19_13864), mRNA Length = 2499 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 436 acggcaacggcaacggcaacggc 458
>ref|XM_705331.1| Candida albicans SC5314 hypothetical protein (CaO19.4553), mRNA Length = 2166 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1264 acggcaacggcaacggcaacggc 1286 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 1270 acggcaacggcaacggcaacg 1290
>gb|AC132297.4| Mus musculus chromosome 7 clone RP24-330M18, complete sequence Length = 152941 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 127064 acggcaacggcaacggcaacggc 127042 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 127067 gcaacggcaacggcaacggc 127048
>gb|AY341996.1| Drosophila miranda CG7255-like protein gene, partial cds Length = 639 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 512 acggcaacggcaacggcaacggc 534 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 518 acggcaacggcaacggcaac 537
>ref|XM_755711.1| Ustilago maydis 521 hypothetical protein (UM04657.1) partial mRNA Length = 5832 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 4835 acggcaacggcaacggcaacggc 4857 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 4841 acggcaacggcaacggcaacgg 4862
>ref|XM_883733.1| Candida albicans SC5314 hypothetical protein (CaJ7.0238) partial mRNA Length = 2499 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 436 acggcaacggcaacggcaacggc 458
>gb|AC123520.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0034O04, complete sequence Length = 164882 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 110669 acggcaacggcaacggcaacggc 110691
>ref|XM_716256.1| Candida albicans SC5314 tRNA splicing ligase Trl1p (TRL1) partial mRNA Length = 2499 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 436 acggcaacggcaacggcaacggc 458
>gb|AC098723.3| Mus musculus BAC clone RP23-3D10 from 7, complete sequence Length = 227968 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 105732 acggcaacggcaacggcaacggc 105754 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 105729 gcaacggcaacggcaacggc 105748
>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome Length = 3059876 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1879557 acggcaacggcaacggcaacggc 1879535 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1879551 acggcaacggcaacggcaacggc 1879529 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1879545 acggcaacggcaacggcaacggc 1879523 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1879539 acggcaacggcaacggcaacggc 1879517 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1879533 acggcaacggcaacggcaacggc 1879511 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1879527 acggcaacggcaacggcaacggc 1879505
>gb|AF440781.1| Streptomyces cinnamonensis polyether antibiotic monensin biosynthesis gene cluster, partial sequence Length = 103450 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 77511 acggcaacggcaacggcaacggc 77489 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 77505 acggcaacggcaacggcaacggc 77483 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 77499 acggcaacggcaacggcaacgg 77478
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 709725 acggcaacggcaacggcaacggc 709747 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 709719 acggcaacggcaacggcaacggc 709741 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 709713 acggcaacggcaacggcaacggc 709735 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 709707 acggcaacggcaacggcaacggc 709729 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 709701 acggcaacggcaacggcaacggc 709723 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 709695 acggcaacggcaacggcaacggc 709717 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 709690 cggcaacggcaacggcaacggc 709711
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 3305689 acggcaacggcaacggcaacggc 3305711 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 3305683 acggcaacggcaacggcaacggc 3305705 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1627482 acggcaacggcaacggcaacggc 1627504 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1627476 acggcaacggcaacggcaacggc 1627498 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1627470 acggcaacggcaacggcaacggc 1627492 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1627464 acggcaacggcaacggcaacggc 1627486 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1627458 acggcaacggcaacggcaacggc 1627480 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1627452 acggcaacggcaacggcaacggc 1627474 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 3305695 acggcaacggcaacggcaacg 3305715 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 1627488 acggcaacggcaacggcaacg 1627508
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2727407 acggcaacggcaacggcaacggc 2727429 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304198 acggcaacggcaacggcaacggc 304220 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304192 acggcaacggcaacggcaacggc 304214 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304186 acggcaacggcaacggcaacggc 304208 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304180 acggcaacggcaacggcaacggc 304202 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304174 acggcaacggcaacggcaacggc 304196 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304168 acggcaacggcaacggcaacggc 304190 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304162 acggcaacggcaacggcaacggc 304184 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304156 acggcaacggcaacggcaacggc 304178 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304150 acggcaacggcaacggcaacggc 304172 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304144 acggcaacggcaacggcaacggc 304166 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304138 acggcaacggcaacggcaacggc 304160 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304132 acggcaacggcaacggcaacggc 304154 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304126 acggcaacggcaacggcaacggc 304148 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304120 acggcaacggcaacggcaacggc 304142 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304114 acggcaacggcaacggcaacggc 304136 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304108 acggcaacggcaacggcaacggc 304130 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304102 acggcaacggcaacggcaacggc 304124 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304096 acggcaacggcaacggcaacggc 304118 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304090 acggcaacggcaacggcaacggc 304112 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304084 acggcaacggcaacggcaacggc 304106 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304078 acggcaacggcaacggcaacggc 304100 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304072 acggcaacggcaacggcaacggc 304094 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304066 acggcaacggcaacggcaacggc 304088 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304060 acggcaacggcaacggcaacggc 304082 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304054 acggcaacggcaacggcaacggc 304076 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304048 acggcaacggcaacggcaacggc 304070 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304042 acggcaacggcaacggcaacggc 304064 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304036 acggcaacggcaacggcaacggc 304058 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304030 acggcaacggcaacggcaacggc 304052 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304024 acggcaacggcaacggcaacggc 304046 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304018 acggcaacggcaacggcaacggc 304040 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304012 acggcaacggcaacggcaacggc 304034 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304006 acggcaacggcaacggcaacggc 304028 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 304000 acggcaacggcaacggcaacggc 304022 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 303994 acggcaacggcaacggcaacggc 304016 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 303988 acggcaacggcaacggcaacggc 304010 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 303982 acggcaacggcaacggcaacggc 304004 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 303976 acggcaacggcaacggcaacggc 303998 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 303970 acggcaacggcaacggcaacggc 303992 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 2727402 cggcaacggcaacggcaacggc 2727423 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 427424 cggcaacggcaacggcaacggc 427403 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 2727413 acggcaacggcaacggcaacg 2727433 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 303966 ggcaacggcaacggcaacggc 303986 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 304204 acggcaacggcaacggcaac 304223 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacg 380 |||||||||||||||||||| Sbjct: 298828 cggcaacggcaacggcaacg 298809
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2978237 acggcaacggcaacggcaacggc 2978215 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2978231 acggcaacggcaacggcaacggc 2978209 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2978225 acggcaacggcaacggcaacggc 2978203 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2978219 acggcaacggcaacggcaacggc 2978197 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2978213 acggcaacggcaacggcaacggc 2978191 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1716213 acggcaacggcaacggcaacggc 1716191 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1716207 acggcaacggcaacggcaacggc 1716185 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 2978242 cggcaacggcaacggcaacggc 2978221 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggccc 384 |||||||||||||||||||||| Sbjct: 2246763 gcaacggcaacggcaacggccc 2246784 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 358 cgacggcaacggcaacggcaacggc 382 |||| |||||||||||||||||||| Sbjct: 1716221 cgacagcaacggcaacggcaacggc 1716197 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 1716201 acggcaacggcaacggcaac 1716182
>emb|BX295539.1|NCB1D14 Neurospora crassa genomic DNA, BAC contig B1D14 Length = 138898 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 107426 acggcaacggcaacggcaacggc 107448 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 107422 ggcaacggcaacggcaacggc 107442
>emb|BX294016.1|NCB9K17 Neurospora crassa DNA linkage group V BAC clone B9K17 Length = 71774 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 59400 acggcaacggcaacggcaacggc 59422
>emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete genome; segment 19/29 Length = 311000 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 205483 acggcaacggcaacggcaacggc 205505 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 205477 acggcaacggcaacggcaacggc 205499 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 205472 cggcaacggcaacggcaacggc 205493
>emb|AL513465.1|NCB13A5 Neurospora crassa DNA linkage group V BAC clone B13A5 Length = 72305 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 56679 acggcaacggcaacggcaacggc 56701
>emb|AL451021.1|NC65E11 Neurospora crassa DNA linkage group V Cosmid contig 65E11 Length = 64884 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2946 acggcaacggcaacggcaacggc 2968
>emb|AL353822.2|NC15E6 Neurospora crassa DNA linkage group V Cosmid contig 15E6 Length = 61843 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 56975 acggcaacggcaacggcaacggc 56953
>emb|AL355926.1|NCB17C10 Neurospora crassa DNA linkage group II BAC clone B17C10 Length = 68484 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 59648 acggcaacggcaacggcaacggc 59670 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 59642 acggcaacggcaacggcaacggc 59664 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 59636 acggcaacggcaacggcaacggc 59658 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 59654 acggcaacggcaacggcaacgg 59675
>gb|AE012542.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 450 of 460 of the complete genome Length = 11491 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 8001 acggcaacggcaacggcaacggc 7979 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 7995 acggcaacggcaacggcaacggc 7973 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 8004 gcaacggcaacggcaacggc 7985
>gb|DQ378280.1| Drosophila virilis strain Tucson 15010-1001.10 fosmid 43O10, complete sequence Length = 40809 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 14055 acggcaacggcaacggcaacggc 14077 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 14052 gcaacggcaacggcaacggc 14071
>ref|NM_137678.2| Drosophila melanogaster Ipk1 CG30295-RA (Ipk1), mRNA Length = 2463 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1968 acggcaacggcaacggcaacggc 1990 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 1964 ggcaacggcaacggcaacggc 1984
>gb|AY061821.1| Drosophila melanogaster GH07317 full length cDNA Length = 2476 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1968 acggcaacggcaacggcaacggc 1990 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 1964 ggcaacggcaacggcaacggc 1984
>gb|AC012388.5| Drosophila melanogaster, chromosome 2R, region 57B-57B, BAC clone BACR10P16, complete sequence Length = 171972 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 92940 acggcaacggcaacggcaacggc 92962 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 92936 ggcaacggcaacggcaacggc 92956
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 5043695 acggcaacggcaacggcaacggc 5043673 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 5043689 acggcaacggcaacggcaacggc 5043667 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 5043698 gcaacggcaacggcaacggc 5043679
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 2220751 acggcaacggcaacggcaacggc 2220773 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 1561001 ggcaacggcaacggcaacggc 1561021 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 2220748 gcaacggcaacggcaacggc 2220767
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 5900785 acggcaacggcaacggcaacggc 5900807
>gb|AC008289.5|AC008289 Drosophila melanogaster, chromosome 2R, region 57B-57B, BAC clone BACR04E05, complete sequence Length = 163012 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 85387 acggcaacggcaacggcaacggc 85365 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 85391 ggcaacggcaacggcaacggc 85371
>gb|AC007760.6|AC007760 Drosophila melanogaster, chromosome 3R, region 89B-89B, BAC clone BACR37I18, complete sequence Length = 195037 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 105813 acggcaacggcaacggcaacggc 105835 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 105809 ggcaacggcaacggcaacggc 105829 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 105819 acggcaacggcaacggcaac 105838
>gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, region 57B6-57B13, BAC clone BACR10P11, complete sequence Length = 164035 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 158168 acggcaacggcaacggcaacggc 158146 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 158172 ggcaacggcaacggcaacggc 158152
>gb|AC007647.6|AC007647 Drosophila melanogaster, chromosome 3R, region 89B-89C, BAC clone BACR05P04, complete sequence Length = 194335 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 15776 acggcaacggcaacggcaacggc 15798 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 15772 ggcaacggcaacggcaacggc 15792 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 15782 acggcaacggcaacggcaac 15801
>gb|AF348415.2| Zea mays cytosolic aldehyde dehydrogenase RF2D (rf2d) mRNA, complete cds Length = 1901 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 136 acggcaacggcaacggcaacggc 158 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 130 acggcaacggcaacggcaacggc 152 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 127 gcaacggcaacggcaacggc 146
>gb|L13380.1|YSATRNALIG Candida albicans transfer RNA ligase gene, complete cds Length = 2763 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 556 acggcaacggcaacggcaacggc 578
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 1502002 acggcaacggcaacggcaacggc 1501980 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 1502007 cggcaacggcaacggcaacggc 1501986 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 5889526 ggcaacggcaacggcaacggc 5889546
>dbj|AK110643.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-169-D02, full insert sequence Length = 1044 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 271 acggcaacggcaacggcaacggc 293 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 656 cggcaacggcaacggcaacggc 677 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 661 acggcaacggcaacggcaac 680 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 277 acggcaacggcaacggcaac 296
>gb|AE003712.1| Drosophila melanogaster chromosome 3R, section 50 of 118 of the complete sequence Length = 226200 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 105225 acggcaacggcaacggcaacggc 105247 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 105221 ggcaacggcaacggcaacggc 105241 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 105231 acggcaacggcaacggcaac 105250
>gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60 of 73 of the complete sequence Length = 303438 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 93100 acggcaacggcaacggcaacggc 93122 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 93096 ggcaacggcaacggcaacggc 93116
>gb|AC004433.1|AC004433 Drosophila melanogaster, chromosome 2R, region 57B1-57B6, P1 clone DS03659, complete sequence Length = 85862 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 28558 acggcaacggcaacggcaacggc 28536 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 28562 ggcaacggcaacggcaacggc 28542
>gb|AY633955.1| Drosophila cardini strain Basse Pointe y protein (y) gene, partial cds Length = 663 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 156 acggcaacggcaacggcaacggc 178
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 5967262 acggcaacggcaacggcaacggc 5967284
>gb|AF042712.1|AF042712 Drosophila pseudoobscura even-skipped (eve) gene, stripe 2 enhancer region Length = 1027 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 347 acggcaacggcaacggcaacggc 325 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 352 cggcaacggcaacggcaacggc 331
>gb|AY279035.1| Zea mays F324 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279033.1| Zea mays F66 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279032.1| Zea mays line16 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279031.1| Zea mays F1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1145 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 137 acggcaacggcaacggcaacggc 159
>gb|AY279030.1| Zea mays line212 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279029.1| Zea mays Wis93-3520 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1222 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279028.1| Zea mays Wis94-443 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1209 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279023.1| Zea mays EP1 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1152 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279016.1| Zea mays F7025 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1463 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 132 acggcaacggcaacggcaacggc 154
>gb|AY279015.1| Zea mays F271 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1464 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 132 acggcaacggcaacggcaacggc 154
>gb|AY279014.1| Zea mays F2 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1434 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279013.1| Zea mays F286 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279012.1| Zea mays F564 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1150 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279010.1| Zea mays Quebec28 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1153 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279009.1| Zea mays Sibiriacka caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1182 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 140 acggcaacggcaacggcaacggc 162 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 134 acggcaacggcaacggcaacggc 156 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 128 acggcaacggcaacggcaacggc 150
>gb|AY279008.1| Zea mays PolarDent caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1206 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 142 acggcaacggcaacggcaacggc 164
>gb|AY279004.1| Zea mays isolate 3 caffeoyl CoA 3-O-methyltransferase (ccoaomt2) gene, complete cds Length = 1451 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 140 acggcaacggcaacggcaacggc 162 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 134 acggcaacggcaacggcaacggc 156 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 128 acggcaacggcaacggcaacggc 150
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome Length = 2519802 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19624 acggcaacggcaacggcaacggc 19646 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19618 acggcaacggcaacggcaacggc 19640 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19612 acggcaacggcaacggcaacggc 19634 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19606 acggcaacggcaacggcaacggc 19628 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19600 acggcaacggcaacggcaacggc 19622 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19594 acggcaacggcaacggcaacggc 19616 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19588 acggcaacggcaacggcaacggc 19610 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19582 acggcaacggcaacggcaacggc 19604 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19576 acggcaacggcaacggcaacggc 19598 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19570 acggcaacggcaacggcaacggc 19592 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19564 acggcaacggcaacggcaacggc 19586 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19558 acggcaacggcaacggcaacggc 19580 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19552 acggcaacggcaacggcaacggc 19574 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19546 acggcaacggcaacggcaacggc 19568 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19540 acggcaacggcaacggcaacggc 19562 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19534 acggcaacggcaacggcaacggc 19556 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19528 acggcaacggcaacggcaacggc 19550 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19522 acggcaacggcaacggcaacggc 19544 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19516 acggcaacggcaacggcaacggc 19538 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 19510 acggcaacggcaacggcaacggc 19532 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 19630 acggcaacggcaacggcaacg 19650 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 19506 ggcaacggcaacggcaacggc 19526
>gb|AC150275.2| Mus musculus BAC clone RP23-409M16 from 7, complete sequence Length = 224935 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 223642 acggcaacggcaacggcaacggc 223620 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 223645 gcaacggcaacggcaacggc 223626
>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence Length = 949626 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 458662 acggcaacggcaacggcaacggc 458684
>gb|AC167663.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940143D9, complete sequence Length = 118759 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 6050 acggcaacggcaacggcaacggc 6072 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 6046 ggcaacggcaacggcaacggc 6066
>gb|AC167560.3| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940139D9, complete sequence Length = 118752 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 6049 acggcaacggcaacggcaacggc 6071 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 6045 ggcaacggcaacggcaacggc 6065
>gb|AC167664.4| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940124D9, complete sequence Length = 118889 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 112710 acggcaacggcaacggcaacggc 112688 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 112714 ggcaacggcaacggcaacggc 112694
>dbj|AB073680.1| Turbo marmoratus mRNA for nacrein, complete cds Length = 1710 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 934 acggcaacggcaacggcaacggc 956 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggc 382 ||||||||||||||||||||||| Sbjct: 928 acggcaacggcaacggcaacggc 950 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 924 ggcaacggcaacggcaacggc 944
>ref|XM_480314.1| Oryza sativa (japonica cultivar-group), mRNA Length = 303 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 24 cggcaacggcaacggcaacggc 3
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 731616 cggcaacggcaacggcaacggc 731595 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 322 cggcctcggcgagcggcggg 341 |||||||||||||||||||| Sbjct: 17146395 cggcctcggcgagcggcggg 17146376 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 9571970 ggcaacggcaacggcaacgg 9571989
>ref|XM_752979.1| Ustilago maydis 521 hypothetical protein (UM01925.1) partial mRNA Length = 3153 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 1410 cggcaacggcaacggcaacggc 1431
>ref|XM_755102.1| Ustilago maydis 521 hypothetical protein (UM04048.1) partial mRNA Length = 1890 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 1837 cggcaacggcaacggcaacggc 1858
>ref|XM_755134.1| Ustilago maydis 521 hypothetical protein (UM04080.1) partial mRNA Length = 2019 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggccc 384 |||||||||||||||||||||| Sbjct: 224 gcaacggcaacggcaacggccc 245
>gb|AY333070.1| Drosophila virilis antennapedia (Antp), CG10013 (CG10013), CG31217 (CG31217), and ultrabithorax (Ubx) genes, complete cds Length = 308092 Score = 44.1 bits (22), Expect = 0.43 Identities = 25/26 (96%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacggcccc 385 |||||||||||||||||||| ||||| Sbjct: 224034 acggcaacggcaacggcaacagcccc 224009 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 235918 gcaacggcaacggcaacggc 235899 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 235915 acggcaacggcaacggcaac 235896
>ref|XM_502461.1| Yarrowia lipolytica CLIB122, YALI0D05841g predicted mRNA Length = 2430 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 1557 cggcaacggcaacggcaacggc 1578 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 1562 acggcaacggcaacggcaacg 1582
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 4874141 cggcaacggcaacggcaacggc 4874120 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 4874136 acggcaacggcaacggcaacg 4874116
>gb|AC130797.5| Chlamydomonas reinhardtii clone cr-1j6b, complete sequence Length = 80650 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 58507 acggcaacggcaacggcaacgg 58486
>gb|AC009459.6| Drosophila melanogaster, chromosome 2R, region 57E-57F, BAC clone BACR34C17, complete sequence Length = 167447 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 28462 cggcaacggcaacggcaacggc 28483
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 4282924 cggcaacggcaacggcaacggc 4282903
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 22761895 cggcaacggcaacggcaacggc 22761874 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 22761890 acggcaacggcaacggcaacg 22761870 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 18197372 gcaacggcaacggcaacggcc 18197352
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 24172891 cggcaacggcaacggcaacggc 24172870 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 24172886 acggcaacggcaacggcaac 24172867 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 ccccggcgccgacgtcggcg 419 |||||||||||||||||||| Sbjct: 19830922 ccccggcgccgacgtcggcg 19830903 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacg 380 |||||||||||||||||||| Sbjct: 8203415 cggcaacggcaacggcaacg 8203396
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 731614 cggcaacggcaacggcaacggc 731593 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 322 cggcctcggcgagcggcggg 341 |||||||||||||||||||| Sbjct: 17139964 cggcctcggcgagcggcggg 17139945 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 9570091 ggcaacggcaacggcaacgg 9570110
>gb|AC134237.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0090O10, complete sequence Length = 162132 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 27161 cggcaacggcaacggcaacggc 27140
>gb|AC121490.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0005F16, complete sequence Length = 160053 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 117497 cggcaacggcaacggcaacggc 117476
>dbj|AP005164.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0054L03 Length = 183623 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 45718 cggcaacggcaacggcaacggc 45697
>dbj|AP004781.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0691E09 Length = 149859 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 2980 cggcaacggcaacggcaacggc 2959 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 2975 acggcaacggcaacggcaac 2956
>dbj|AP003711.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0417G12 Length = 163568 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 106349 cggcaacggcaacggcaacggc 106328 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 106344 acggcaacggcaacggcaac 106325
>dbj|AP003866.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1092_A07 Length = 137081 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 81237 cggcaacggcaacggcaacggc 81216 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 81232 acggcaacggcaacggcaacg 81212
>gb|AF014927.1|AF014927 Chlamydomonas reinhardtii glutathione peroxidase homolog (gpxh) gene, complete cds Length = 4947 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 1450 acggcaacggcaacggcaacgg 1471
>dbj|AK073403.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042F02, full insert sequence Length = 2138 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 912 cggcaacggcaacggcaacggc 933 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 917 acggcaacggcaacggcaac 936
>emb|AJ390493.1|CAL390493 Candida albicans partial ecm21 gene for ECM21 protein Length = 515 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacgg 381 |||||||||||||||||||||| Sbjct: 77 acggcaacggcaacggcaacgg 98
>gb|AE003454.3| Drosophila melanogaster chromosome 2R, section 62 of 73 of the complete sequence Length = 313634 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 178998 cggcaacggcaacggcaacggc 179019
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 44.1 bits (22), Expect = 0.43 Identities = 22/22 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggc 382 |||||||||||||||||||||| Sbjct: 750765 cggcaacggcaacggcaacggc 750744 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 750760 acggcaacggcaacggcaacg 750740
>ref|NM_192679.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1461 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 407 gcaacggcaacggcaacggcc 427
>ref|XM_478172.1| Oryza sativa (japonica cultivar-group), mRNA Length = 817 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 175 gcaacggcaacggcaacggcc 155
>gb|AC112160.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1579_G03, complete sequence Length = 121466 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 359 gacggcaacggcaacggcaac 379 ||||||||||||||||||||| Sbjct: 35631 gacggcaacggcaacggcaac 35611
>ref|XM_359451.1| Magnaporthe grisea 70-15 hypothetical protein (MG05326.4) partial mRNA Length = 1512 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 179 acggcaacggcaacggcaacg 199 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 175 ggcaacggcaacggcaacggc 195
>gb|AY661657.1| Sorghum bicolor clone BAC 60H10, complete sequence Length = 125927 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 94927 acggcaacggcaacggcaacg 94947 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 94924 gcaacggcaacggcaacggc 94943
>ref|XM_957135.1| Neurospora crassa OR74A hypothetical protein (NCU06390.1) partial mRNA Length = 1977 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 1888 gcaacggcaacggcaacggcc 1908
>ref|XM_326244.1| Neurospora crassa OR74A hypothetical protein (NCU06390.1) partial mRNA Length = 1977 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 1888 gcaacggcaacggcaacggcc 1908
>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome Length = 2462499 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacgg 381 ||||||||||||||||||||| Sbjct: 44074 cggcaacggcaacggcaacgg 44054
>ref|XM_750841.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g15990) partial mRNA Length = 456 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacg 380 ||||||||||||||||||||| Sbjct: 224 acggcaacggcaacggcaacg 244 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 220 ggcaacggcaacggcaacggc 240
>gb|AC105515.5| Rattus norvegicus 14 BAC CH230-13H11 (Children's Hospital Oakland Research Institute) complete sequence Length = 221805 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 8188 ggcaacggcaacggcaacggc 8168
>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29 Length = 283100 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 318 cgcccggcctcggcgagcggc 338 ||||||||||||||||||||| Sbjct: 49426 cgcccggcctcggcgagcggc 49446
>gb|AY957386.1| Paracoccus haeundaensis astaxanthin biosynthesis gene cluster, complete sequence Length = 6227 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 246 cggcggcgatggaccaggtgcagcg 270 |||||||||||||||||| |||||| Sbjct: 4979 cggcggcgatggaccaggcgcagcg 4955
>dbj|AB206672.1| Paracoccus sp. N81106 carotenoid biosynthesis gene cluster (idi, crtW, crtZ, crtY, crtI, crtB, crtE, crtX), complete cds Length = 10074 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 246 cggcggcgatggaccaggtgcagcg 270 |||||||||||||||||| |||||| Sbjct: 6333 cggcggcgatggaccaggcgcagcg 6309
>gb|DQ350712.1| Ajellomyces capsulatus nitrosative stress induced transcription 6 (NIT6) gene, partial sequence Length = 2995 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 2974 ggcaacggcaacggcaacggc 2994
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacgg 381 ||||||||||||||||||||| Sbjct: 11756939 cggcaacggcaacggcaacgg 11756959
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 359 gacggcaacggcaacggcaac 379 ||||||||||||||||||||| Sbjct: 24149393 gacggcaacggcaacggcaac 24149373
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacgg 381 ||||||||||||||||||||| Sbjct: 40276076 cggcaacggcaacggcaacgg 40276056 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 23835526 gcaacggcaacggcaacggcc 23835546 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 389 cccttctccgtccccggcgccgacgtcg 416 |||| ||||||||||||||||| ||||| Sbjct: 24077861 ccctcctccgtccccggcgccgtcgtcg 24077888
>gb|AC008226.10|AC008226 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone BACR02B19, complete sequence Length = 171286 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 9258 ggcaacggcaacggcaacggc 9278 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 9262 acggcaacggcaacggcaac 9281
>gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone BACR01C11, complete sequence Length = 176991 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 155629 ggcaacggcaacggcaacggc 155649 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 155633 acggcaacggcaacggcaac 155652
>dbj|D58420.2|ATUCRTWA Paracoccus sp. N81106 crtW, crtZ, crtY, crtI, crtB genes, complete cds Length = 5382 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 246 cggcggcgatggaccaggtgcagcg 270 |||||||||||||||||| |||||| Sbjct: 4728 cggcggcgatggaccaggcgcagcg 4704
>dbj|AP006843.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1793G04 Length = 156714 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacgg 381 ||||||||||||||||||||| Sbjct: 141854 cggcaacggcaacggcaacgg 141834
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 385 cgcgcccttctccgtccccgg 405 ||||||||||||||||||||| Sbjct: 646016 cgcgcccttctccgtccccgg 646036
>dbj|AP005508.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0711F01 Length = 193091 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacgg 381 ||||||||||||||||||||| Sbjct: 191573 cggcaacggcaacggcaacgg 191593
>dbj|AP005190.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0477A12 Length = 138141 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 132678 gcaacggcaacggcaacggcc 132658
>dbj|AP003022.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0681B11 Length = 144091 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 116111 gcaacggcaacggcaacggcc 116131
>dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1218_C12 Length = 105861 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 615 gcaacggcaacggcaacggcc 595
>dbj|AK120689.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013169E21, full insert sequence Length = 2172 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacgg 381 ||||||||||||||||||||| Sbjct: 526 cggcaacggcaacggcaacgg 546
>dbj|AK120157.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013030D19, full insert sequence Length = 1665 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 449 gcaacggcaacggcaacggcc 469
>dbj|AK110890.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-172-H07, full insert sequence Length = 1680 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 1172 gcaacggcaacggcaacggcc 1152
>dbj|AK108737.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-150-D10, full insert sequence Length = 817 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggcc 383 ||||||||||||||||||||| Sbjct: 175 gcaacggcaacggcaacggcc 155
>emb|AJ330947.1|HSA330947 Homo sapiens genomic sequence surrounding NotI site, clone NL6-BF11RS Length = 763 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 307 gcaggccatggcgcccggcct 327 ||||||||||||||||||||| Sbjct: 212 gcaggccatggcgcccggcct 232
>gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12 of 118 of the complete sequence Length = 301379 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 207038 ggcaacggcaacggcaacggc 207058 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 207042 acggcaacggcaacggcaac 207061
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 358 cgacggcaacggcaacggcaacggc 382 |||||||||||||||||| |||||| Sbjct: 382526 cgacggcaacggcaacggaaacggc 382550 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 359 gacggcaacggcaacggcaacggc 382 ||||||||||||| |||||||||| Sbjct: 2426719 gacggcaacggcaccggcaacggc 2426742
>gb|AC147558.3| Mus musculus BAC clone RP23-470N2 from 8, complete sequence Length = 212626 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 137895 ggcaacggcaacggcaacggc 137875
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacggc 382 ||||||||||||||||||||| Sbjct: 4032494 ggcaacggcaacggcaacggc 4032514 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 4032498 acggcaacggcaacggcaac 4032517
>gb|AC152981.2| Mus musculus 10 BAC RP23-154M15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 200104 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 358 cgacggcaacggcaacggcaacggc 382 ||||||||||||||||||| ||||| Sbjct: 84230 cgacggcaacggcaacggcgacggc 84254 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 358 cgacggcaacggcaacggcaacggc 382 ||||||| ||||||||||||||||| Sbjct: 84224 cgacggcgacggcaacggcaacggc 84248
>dbj|AB012145.1| Streptomyces lividans mRNA encoding metallothionein-like domain, complete cds Length = 1109 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 318 cgcccggcctcggcgagcggc 338 ||||||||||||||||||||| Sbjct: 431 cgcccggcctcggcgagcggc 411
>ref|XM_467014.1| Oryza sativa (japonica cultivar-group), mRNA Length = 324 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 357 tcgacggcaacggcaacggc 376 |||||||||||||||||||| Sbjct: 221 tcgacggcaacggcaacggc 240
>ref|XM_466682.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1671 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 320 cccggcctcggcgagcggcg 339 |||||||||||||||||||| Sbjct: 1073 cccggcctcggcgagcggcg 1054
>ref|XM_506864.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1004_A05.15 mRNA Length = 1716 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 320 cccggcctcggcgagcggcg 339 |||||||||||||||||||| Sbjct: 1073 cccggcctcggcgagcggcg 1054
>ref|NM_192727.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 4299 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 389 cccttctccgtccccggcgccgacgtcg 416 |||| ||||||||||||||||| ||||| Sbjct: 237 ccctcctccgtccccggcgccgtcgtcg 210
>gb|AE001274.2| Leishmania major strain Friedlin chromosome 1, complete sequence Length = 268984 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 ccggcctcggcgagcggcgg 340 |||||||||||||||||||| Sbjct: 160132 ccggcctcggcgagcggcgg 160151
>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome Length = 943016 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 302 gacgagcaggccatggcgcccggc 325 |||| ||||||||||||||||||| Sbjct: 15363 gacgggcaggccatggcgcccggc 15386
>ref|XM_365446.1| Magnaporthe grisea 70-15 hypothetical protein (MG02148.4) partial mRNA Length = 2160 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 1622 acggcaacggcaacggcaac 1641 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 1619 gcaacggcaacggcaacggc 1638
>ref|XM_362442.1| Magnaporthe grisea 70-15 hypothetical protein (MG08025.4) partial mRNA Length = 4995 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 2347 ggcaacggcaacggcaacgg 2366
>gb|AE009066.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 92 of 256 of the complete sequence Length = 10606 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 307 gcaggccatggcgcccggcc 326 |||||||||||||||||||| Sbjct: 7514 gcaggccatggcgcccggcc 7533
>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome Length = 6093698 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 893839 gcaacggcaacggcaacggc 893820 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 893836 acggcaacggcaacggcaac 893817
>ref|XM_883507.1| Leishmania major strain Friedlin hypothetical protein (L7610.03) partial mRNA Length = 3840 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 359 gacggcaacggcaacggcaacggc 382 |||||||| ||||||||||||||| Sbjct: 3589 gacggcaatggcaacggcaacggc 3612
>ref|XM_751684.1| Ustilago maydis 521 hypothetical protein (UM00630.1) partial mRNA Length = 2568 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 2156 gcaacggcaacggcaacggc 2175
>ref|XM_752624.1| Ustilago maydis 521 hypothetical protein (UM01570.1) partial mRNA Length = 6954 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 1916 acggcaacggcaacggcaac 1935
>ref|XM_753523.1| Ustilago maydis 521 hypothetical protein (UM02469.1) partial mRNA Length = 849 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaacggcc 383 ||||||||||||||||| |||||| Sbjct: 701 acggcaacggcaacggccacggcc 724
>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end Length = 247462 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 359 gacggcaacggcaacggcaacggc 382 |||||||| ||||||||||||||| Sbjct: 121611 gacggcaatggcaacggcaacggc 121588
>ref|XM_385837.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05661.1) partial mRNA Length = 2184 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 35 acggcaacggcaacggcaac 54 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 32 gcaacggcaacggcaacggc 51
>ref|XM_381644.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01468.1) partial mRNA Length = 1380 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 953 acggcaacggcaacggcaac 972
>emb|AL591790.1|SME591790 Sinorhizobium meliloti 1021 complete chromosome; segment 9/12 Length = 323450 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 311 gccatggcgcccggcctcgg 330 |||||||||||||||||||| Sbjct: 135288 gccatggcgcccggcctcgg 135269
>gb|AC126929.3| Mus musculus BAC clone RP24-465A20 from chromosome 17, complete sequence Length = 168712 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 1 aacgcagagggagggaaggg 20 |||||||||||||||||||| Sbjct: 148443 aacgcagagggagggaaggg 148462
>gb|AY271618.1| Oryza sativa (indica cultivar-group) PDR-type ABC transporter 9 mRNA, complete cds Length = 4700 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 389 cccttctccgtccccggcgccgacgtcg 416 |||| ||||||||||||||||| ||||| Sbjct: 256 ccctcctccgtccccggcgccgtcgtcg 229
>gb|AC166543.2| Nectria haematococca clone JGIAYWI-5I13, complete sequence Length = 40607 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 19892 gcaacggcaacggcaacggc 19911
>emb|Z30236.1|NPHALCYA N.pharaonis (SP1/28) gene for halocyanin Length = 620 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 141 ggcaacggcaacggcaacgg 160
>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16 Length = 347137 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 364 caacggcaacggcaacggcc 383 |||||||||||||||||||| Sbjct: 86979 caacggcaacggcaacggcc 86998
>emb|BX284751.1|NCB24N11 Neurospora crassa DNA linkage group II BAC contig B24N11 Length = 129306 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 40487 gcaacggcaacggcaacggc 40506
>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete sequence Length = 153247 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 322 cggcctcggcgagcggcggg 341 |||||||||||||||||||| Sbjct: 37788 cggcctcggcgagcggcggg 37769
>emb|AL138972.1|DMBR25B3 Drosophila melanogaster BAC clone BACR25B3 Length = 154329 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 2579 acggcaacggcaacggcaac 2560
>emb|AL035245.1|DMBH61I5 Drosophila melanogaster BAC clone BACH61I5 Length = 29358 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 14578 acggcaacggcaacggcaac 14559
>gb|AC104054.6| Drosophila melanogaster X BAC RP98-21G11 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170347 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 58917 acggcaacggcaacggcaac 58898
>gb|AC105055.2| Drosophila melanogaster X BAC RP98-5N9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 169618 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 98610 acggcaacggcaacggcaac 98591
>tpg|BK002977.1| TPA: TPA_inf: Drosophila melanogaster HDC17114 (HDC17114) gene, complete cds Length = 924 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 833 acggcaacggcaacggcaac 814
>ref|NM_176746.1| Drosophila melanogaster forked CG5424-RC, transcript variant C (f), mRNA Length = 5587 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 3464 ggcaacggcaacggcaacgg 3483
>ref|NM_176745.1| Drosophila melanogaster forked CG5424-RD, transcript variant D (f), mRNA Length = 4968 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 2845 ggcaacggcaacggcaacgg 2864
>ref|NM_167563.2| Drosophila melanogaster forked CG5424-RA, transcript variant A (f), mRNA Length = 2540 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 417 ggcaacggcaacggcaacgg 436
>ref|NM_143605.2| Drosophila melanogaster CG11339-RA (CG11339), mRNA Length = 3855 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 1013 gcaacggcaacggcaacggc 1032
>ref|NM_078660.2| Drosophila melanogaster forked CG5424-RB, transcript variant B (f), mRNA Length = 5476 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 3353 ggcaacggcaacggcaacgg 3372
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 307 gcaggccatggcgcccggcc 326 |||||||||||||||||||| Sbjct: 1015329 gcaggccatggcgcccggcc 1015348
>gb|AF472590.1| Sinorhizobium meliloti JJ1c10 hypothetical transmembrane protein, hypothetical protein, hypothetical transmembrane protein, hypothetical protein, aspartate aminotransferase A (aatA), hypothetical protein, putative oxidoreductase protein, and putative oxidoreductase protein genes, complete cds; and putative transcription regulator protein gene, partial cds Length = 7402 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 311 gccatggcgcccggcctcgg 330 |||||||||||||||||||| Sbjct: 2996 gccatggcgcccggcctcgg 3015
>gb|AC084264.7| Homo sapiens chromosome 2, clone CTB-2122H5, complete sequence Length = 146957 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 92 ctccctcgtgaataccacca 111 |||||||||||||||||||| Sbjct: 107628 ctccctcgtgaataccacca 107609
>gb|AC013432.4| Drosophila melanogaster, chromosome X, region 15F-15F, BAC clone BACR01K05, complete sequence Length = 162761 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 125094 ggcaacggcaacggcaacgg 125075
>gb|AY029175.1| Cavia porcellus F-box protein OCP1 (OCP1) mRNA, complete cds Length = 1180 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 449 acggcgggcaggacgctgtc 468 |||||||||||||||||||| Sbjct: 891 acggcgggcaggacgctgtc 910
>gb|AC008326.9| Drosophila melanogaster, chromosome 2L, region 27C-27C, BAC clone BACR39J17, complete sequence Length = 148780 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 71735 acggcaacggcaacggcaac 71754
>gb|DQ355211.1| Phytophthora sojae cell 5A endo-1,4-betaglucanase (EGL-V.8) mRNA, complete cds Length = 1845 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 146 acggcaacggcaacggcaac 165
>tpg|BK001017.1| TPA: TPA_exp: Oryza sativa (japonica cultivar-group) isolate P0410E03.7 PDR3 ABC transporter (pdr3) gene, complete cds Length = 6575 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 389 cccttctccgtccccggcgccgacgtcg 416 |||| ||||||||||||||||| ||||| Sbjct: 237 ccctcctccgtccccggcgccgtcgtcg 210
>gb|AC148714.1| Macaca mulatta Major Histocompatibility Complex BAC MMU457P02, complete sequence Length = 159822 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 gcagagggagggaagggagc 23 |||||||||||||||||||| Sbjct: 30044 gcagagggagggaagggagc 30025
>gb|AC012096.8|AC012096 Drosophila melanogaster, chromosome X, region 15E-15F, BAC clone BACR18O02, complete sequence Length = 177793 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 126120 ggcaacggcaacggcaacgg 126139
>gb|AE006470.1| Chlorobium tepidum TLS, complete genome Length = 2154946 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 787953 acggcaacggcaacggcaac 787972
>gb|AC007977.12|AC007977 Drosophila melanogaster, chromosome 2L, region 27C-27C, BAC clone BACR13J07, complete sequence Length = 174287 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 128437 acggcaacggcaacggcaac 128456
>gb|AC010995.11|AC010995 Drosophila melanogaster, chromosome X, region 12A-12A, BAC clone BACR30C16, complete sequence Length = 185810 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggccc 384 ||||| |||||||||||||||||| Sbjct: 78702 cggcagcggcaacggcaacggccc 78679
>gb|AC008287.4|AC008287 Drosophila melanogaster, chromosome 3R, region 100C-100C, BAC clone BACR02G16, complete sequence Length = 177480 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 10519 gcaacggcaacggcaacggc 10538
>gb|AC105054.6| Homo sapiens BAC clone RP11-722I12 from 2, complete sequence Length = 203061 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 4 gcagagggagggaagggagc 23 |||||||||||||||||||| Sbjct: 74270 gcagagggagggaagggagc 74251
>gb|AC108222.4| Homo sapiens BAC clone RP11-1180N13 from 2, complete sequence Length = 21776 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 92 ctccctcgtgaataccacca 111 |||||||||||||||||||| Sbjct: 16085 ctccctcgtgaataccacca 16104
>dbj|AP002844.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0410E03 Length = 164839 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 389 cccttctccgtccccggcgccgacgtcg 416 |||| ||||||||||||||||| ||||| Sbjct: 53683 ccctcctccgtccccggcgccgtcgtcg 53710
>gb|AC137069.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0009C19, from chromosome 3, complete sequence Length = 131709 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 40716 ggcaacggcaacggcaacgg 40697
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 317 gcgcccggcctcggcgagcg 336 |||||||||||||||||||| Sbjct: 3790165 gcgcccggcctcggcgagcg 3790184
>dbj|AP004818.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0551A03 Length = 173027 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 400 ccccggcgccgacgtcggcg 419 |||||||||||||||||||| Sbjct: 97967 ccccggcgccgacgtcggcg 97948
>dbj|AP005619.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0624H09 Length = 158719 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacg 380 |||||||||||||||||||| Sbjct: 95778 cggcaacggcaacggcaacg 95759
>dbj|AP005291.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1282_H11 Length = 143314 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 357 tcgacggcaacggcaacggc 376 |||||||||||||||||||| Sbjct: 73991 tcgacggcaacggcaacggc 74010
>dbj|AP005286.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1004_A05 Length = 174290 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 320 cccggcctcggcgagcggcg 339 |||||||||||||||||||| Sbjct: 62106 cccggcctcggcgagcggcg 62087
>dbj|AK110597.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-168-G01, full insert sequence Length = 1311 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 621 ggcaacggcaacggcaacgg 640
>dbj|AK108390.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-142-F04, full insert sequence Length = 920 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 400 ccccggcgccgacgtcggcg 419 |||||||||||||||||||| Sbjct: 302 ccccggcgccgacgtcggcg 321
>dbj|AK104319.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-E04, full insert sequence Length = 1671 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 320 cccggcctcggcgagcggcg 339 |||||||||||||||||||| Sbjct: 1073 cccggcctcggcgagcggcg 1054
>emb|AJ325218.1|HSA325218 Homo sapiens genomic sequence surrounding NotI site, clone NL1-EG24C Length = 579 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 405 gcgccgacgtcggcggagcg 424 |||||||||||||||||||| Sbjct: 283 gcgccgacgtcggcggagcg 264
>dbj|AK060705.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-030-G09, full insert sequence Length = 1714 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 320 cccggcctcggcgagcggcg 339 |||||||||||||||||||| Sbjct: 1071 cccggcctcggcgagcggcg 1052
>gb|AY105287.1| Zea mays PCO135091 mRNA sequence Length = 825 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 766 acggcaacggcaacggcaac 785
>gb|AE003615.3| Drosophila melanogaster chromosome 2L, section 24 of 83 of the complete sequence Length = 270751 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 264931 acggcaacggcaacggcaac 264950
>gb|AE003777.3| Drosophila melanogaster chromosome 3R, section 115 of 118 of the complete sequence Length = 232290 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gcaacggcaacggcaacggc 382 |||||||||||||||||||| Sbjct: 225016 gcaacggcaacggcaacggc 225035
>gb|AE003505.3| Drosophila melanogaster chromosome X, section 57 of 74 of the complete sequence Length = 314205 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 41305 ggcaacggcaacggcaacgg 41324
>gb|AE003493.3| Drosophila melanogaster chromosome X, section 45 of 74 of the complete sequence Length = 307761 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 361 cggcaacggcaacggcaacggccc 384 ||||| |||||||||||||||||| Sbjct: 31409 cggcagcggcaacggcaacggccc 31386
>gb|AE003424.2| Drosophila melanogaster chromosome X, section 8 of 74 of the complete sequence Length = 274777 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 94247 acggcaacggcaacggcaac 94228
>gb|AE003422.2| Drosophila melanogaster chromosome X, section 6 of 74 of the complete sequence Length = 300933 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 225587 acggcaacggcaacggcaac 225568
>gb|AE004969.1| Neisseria gonorrhoeae FA 1090, complete genome Length = 2153922 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 358 cgacggcaacggcaacggcaacgg 381 ||||||| |||||||||||||||| Sbjct: 1073572 cgacggcgacggcaacggcaacgg 1073595 Score = 40.1 bits (20), Expect = 6.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 358 cgacggcaacggcaacggcaacgg 381 ||||||| |||||||||||||||| Sbjct: 461515 cgacggcgacggcaacggcaacgg 461492
>emb|AJ535046.1|OSA535046 Oryza sativa (japonica cultivar-group) pdr9 gene for PDR-like ABC transporter, exons 1-21 Length = 6575 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 389 cccttctccgtccccggcgccgacgtcg 416 |||| ||||||||||||||||| ||||| Sbjct: 237 ccctcctccgtccccggcgccgtcgtcg 210
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 445 gccgacggcgggcaggacgctgtcgacc 472 |||||||||||||| ||||||| ||||| Sbjct: 4473767 gccgacggcgggcaagacgctgccgacc 4473740
>gb|AE014295.3| Bifidobacterium longum NCC2705, complete genome Length = 2256640 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 361 cggcaacggcaacggcaacg 380 |||||||||||||||||||| Sbjct: 871513 cggcaacggcaacggcaacg 871532
>emb|X05177.1|DFUBX1 Drosophila funebris ubx (Ultrabithorax) gene 5' region Length = 3002 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 360 acggcaacggcaacggcaac 379 |||||||||||||||||||| Sbjct: 1109 acggcaacggcaacggcaac 1090
>emb|X69871.1|DMFORKEDA D.melanogaster putative f gene Length = 19408 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 15260 ggcaacggcaacggcaacgg 15279
>gb|AC091401.2| Sus scrofa clone RP44-198J22, complete sequence Length = 177559 Score = 40.1 bits (20), Expect = 6.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 59 ccgctccacgttccccgaaccctctccg 86 ||||||| ||||||||||||||||||| Sbjct: 36001 ccgctccctgttccccgaaccctctccg 35974
>dbj|D21203.2|DROFP Drosophila melanogaster forked mRNA for large Forked protein, complete cds Length = 5472 Score = 40.1 bits (20), Expect = 6.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 ggcaacggcaacggcaacgg 381 |||||||||||||||||||| Sbjct: 3353 ggcaacggcaacggcaacgg 3372 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,096,984 Number of Sequences: 3902068 Number of extensions: 3096984 Number of successful extensions: 83932 Number of sequences better than 10.0: 238 Number of HSP's better than 10.0 without gapping: 249 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 78194 Number of HSP's gapped (non-prelim): 5500 length of query: 497 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 475 effective length of database: 17,147,199,772 effective search space: 8144919891700 effective search space used: 8144919891700 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)