Clone Name | bastl05d06 |
---|---|
Clone Library Name | barley_pub |
>dbj|AK129661.1| Homo sapiens cDNA FLJ26150 fis, clone ADG00494 Length = 1815 Score = 42.1 bits (21), Expect = 0.15 Identities = 24/25 (96%) Strand = Plus / Plus Query: 25 ttcaaaacaaacttcgccaaacttc 49 |||||||||||||| |||||||||| Sbjct: 974 ttcaaaacaaacttggccaaacttc 998
>emb|AL163193.5|HS73E6 Homo sapiens chromosome 9 BAC RP11-73E6, complete sequence Length = 175931 Score = 42.1 bits (21), Expect = 0.15 Identities = 24/25 (96%) Strand = Plus / Minus Query: 25 ttcaaaacaaacttcgccaaacttc 49 |||||||||||||| |||||||||| Sbjct: 83866 ttcaaaacaaacttggccaaacttc 83842
>dbj|AB218617.1| Rattus norvegicus genomic DNA, chromosome 4, clone: CH230-65K18, complete sequence Length = 193613 Score = 40.1 bits (20), Expect = 0.58 Identities = 20/20 (100%) Strand = Plus / Minus Query: 3 tttctgctctcggttctctg 22 |||||||||||||||||||| Sbjct: 130457 tttctgctctcggttctctg 130438
>gb|AC017099.11| Homo sapiens BAC clone RP11-542D13 from 2, complete sequence Length = 230426 Score = 40.1 bits (20), Expect = 0.58 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 ttctctgtcttcaaaacaaa 35 |||||||||||||||||||| Sbjct: 95840 ttctctgtcttcaaaacaaa 95859
>gb|AC013272.5| Homo sapiens BAC clone RP11-401C13 from 2, complete sequence Length = 172705 Score = 40.1 bits (20), Expect = 0.58 Identities = 20/20 (100%) Strand = Plus / Minus Query: 16 ttctctgtcttcaaaacaaa 35 |||||||||||||||||||| Sbjct: 115529 ttctctgtcttcaaaacaaa 115510
>gb|AC018892.8| Homo sapiens BAC clone RP11-499E14 from 2, complete sequence Length = 191055 Score = 40.1 bits (20), Expect = 0.58 Identities = 20/20 (100%) Strand = Plus / Minus Query: 16 ttctctgtcttcaaaacaaa 35 |||||||||||||||||||| Sbjct: 92702 ttctctgtcttcaaaacaaa 92683
>gb|AC160020.1| Homo sapiens BAC clone RP11-540L21 from 2, complete sequence Length = 202084 Score = 40.1 bits (20), Expect = 0.58 Identities = 20/20 (100%) Strand = Plus / Minus Query: 16 ttctctgtcttcaaaacaaa 35 |||||||||||||||||||| Sbjct: 36178 ttctctgtcttcaaaacaaa 36159
>gb|AC148026.2| Homo sapiens BAC clone RP11-625I24 from 2, complete sequence Length = 159856 Score = 40.1 bits (20), Expect = 0.58 Identities = 20/20 (100%) Strand = Plus / Minus Query: 16 ttctctgtcttcaaaacaaa 35 |||||||||||||||||||| Sbjct: 63183 ttctctgtcttcaaaacaaa 63164
>gb|DQ213530.1| Taeniopygia guttata clone 0058P0012H02 nuclear receptor subfamily 2 group F member 2-like mRNA, complete sequence Length = 1369 Score = 38.2 bits (19), Expect = 2.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 40 gccaaacttcctcttcccccttt 62 |||||||||||| |||||||||| Sbjct: 90 gccaaacttcctgttcccccttt 68
>gb|AC165329.8| Mus musculus chromosome 3, clone wi1-298L18, complete sequence Length = 40686 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaac 36 ||||||||||||||||||| Sbjct: 27441 ctctgtcttcaaaacaaac 27423
>gb|AC079855.8| Homo sapiens BAC clone RP11-332L16 from 7, complete sequence Length = 143146 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaac 36 ||||||||||||||||||| Sbjct: 117983 ctctgtcttcaaaacaaac 118001
>emb|CT009769.4| Mouse DNA sequence from clone RP23-44C21 on chromosome 9, complete sequence Length = 197074 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 42 caaacttcctcttccccct 60 ||||||||||||||||||| Sbjct: 67771 caaacttcctcttccccct 67753
>gb|AC123855.4| Mus musculus BAC clone RP23-328J17 from chromosome 12, complete sequence Length = 205684 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 27 caaaacaaacttcgccaaa 45 ||||||||||||||||||| Sbjct: 29773 caaaacaaacttcgccaaa 29791
>gb|AC118224.8| Mus musculus chromosome 10, clone RP23-341N20, complete sequence Length = 205533 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 tctgtcttcaaaacaaact 37 ||||||||||||||||||| Sbjct: 6358 tctgtcttcaaaacaaact 6376
>gb|AF022967.1| Caenorhabditis elegans cosmid C13A2, complete sequence Length = 35348 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 gttctctgtcttcaaaaca 33 ||||||||||||||||||| Sbjct: 11151 gttctctgtcttcaaaaca 11169
>emb|AL157763.6| Human DNA sequence from clone RP11-27D9 on chromosome 13q31.2-32.1, complete sequence Length = 51700 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 16 ttctctgtcttcaaaacaa 34 ||||||||||||||||||| Sbjct: 48014 ttctctgtcttcaaaacaa 48032
>ref|XM_791733.1| PREDICTED: Strongylocentrotus purpuratus similar to ankyrin repeat and FYVE domain containing 1 isoform 1 (LOC592196), mRNA Length = 4983 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 6 ctgctctcggttctctgtc 24 ||||||||||||||||||| Sbjct: 1369 ctgctctcggttctctgtc 1351
>gb|AC153539.7| Mus musculus 10 BAC RP23-245C19 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 230854 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 tctgtcttcaaaacaaact 37 ||||||||||||||||||| Sbjct: 36350 tctgtcttcaaaacaaact 36332
>gb|AC107383.3| Homo sapiens BAC clone RP11-125C20 from 4, complete sequence Length = 173808 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 tctctgtcttcaaaacaaa 35 ||||||||||||||||||| Sbjct: 121739 tctctgtcttcaaaacaaa 121757
>gb|AC162806.4| Mus musculus BAC clone RP23-95E13 from chromosome 9, complete sequence Length = 165949 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 20 ctgtcttcaaaacaaactt 38 ||||||||||||||||||| Sbjct: 18781 ctgtcttcaaaacaaactt 18799
>gb|AC140363.3| Mus musculus BAC clone RP23-212M11 from 9, complete sequence Length = 217832 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 20 ctgtcttcaaaacaaactt 38 ||||||||||||||||||| Sbjct: 41812 ctgtcttcaaaacaaactt 41794
>gb|AC157571.6| Mus musculus BAC clone RP23-111F7 from chromosome 12, complete sequence Length = 208117 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 27 caaaacaaacttcgccaaa 45 ||||||||||||||||||| Sbjct: 197051 caaaacaaacttcgccaaa 197069
>emb|AL365326.14| Mouse DNA sequence from clone RP23-381K21 on chromosome 1, complete sequence Length = 189860 Score = 38.2 bits (19), Expect = 2.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 tctgtcttcaaaacaaact 37 ||||||||||||||||||| Sbjct: 75809 tctgtcttcaaaacaaact 75791
>gb|DQ217936.1| Homo sapiens heat shock protein 60 (HSPD1) gene, complete cds Length = 17229 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 14966 ctctgtcttcaaaacaaa 14949
>gb|AC136971.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0032K12, complete sequence Length = 166936 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 19 tctgtcttcaaaacaaac 36 |||||||||||||||||| Sbjct: 62711 tctgtcttcaaaacaaac 62728
>gb|AC116712.11| Mus musculus chromosome 1, clone RP23-105A17, complete sequence Length = 179782 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 4 ttctgctctcggttctct 21 |||||||||||||||||| Sbjct: 42621 ttctgctctcggttctct 42638
>gb|BC076854.1| Xenopus laevis hypothetical protein LOC445833, mRNA (cDNA clone IMAGE:6637969), partial cds Length = 1769 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 41 ccaaacttcctcttcccc 58 |||||||||||||||||| Sbjct: 599 ccaaacttcctcttcccc 582
>gb|AC147885.2| Xenopus tropicalis clone CH216-12C9, complete sequence Length = 222162 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 41 ccaaacttcctcttcccc 58 |||||||||||||||||| Sbjct: 102334 ccaaacttcctcttcccc 102317
>gb|AC149545.1| Populus trichocarpa clone Pop1-71J23, complete sequence Length = 103543 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 9 ctctcggttctctgtctt 26 |||||||||||||||||| Sbjct: 8848 ctctcggttctctgtctt 8865
>ref|XM_710814.1| Candida albicans SC5314 hypothetical protein (CaO19_8052), mRNA Length = 2253 Score = 36.2 bits (18), Expect = 9.1 Identities = 21/22 (95%) Strand = Plus / Plus Query: 16 ttctctgtcttcaaaacaaact 37 ||||| |||||||||||||||| Sbjct: 1083 ttctcagtcttcaaaacaaact 1104
>ref|XM_710764.1| Candida albicans SC5314 hypothetical protein (CaO19_422), mRNA Length = 2256 Score = 36.2 bits (18), Expect = 9.1 Identities = 21/22 (95%) Strand = Plus / Plus Query: 16 ttctctgtcttcaaaacaaact 37 ||||| |||||||||||||||| Sbjct: 1074 ttctcagtcttcaaaacaaact 1095
>gb|AC110038.25| Mus musculus chromosome 1, clone RP23-258M15, complete sequence Length = 232830 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 79895 ctctgtcttcaaaacaaa 79912
>gb|AC025778.8| Homo sapiens chromosome 16 clone CTD-2504F3, complete sequence Length = 208417 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 29790 ctctgtcttcaaaacaaa 29773
>gb|AC124560.4| Mus musculus BAC clone RP23-166O22 from chromosome 5, complete sequence Length = 222593 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 17 tctctgtcttcaaaacaa 34 |||||||||||||||||| Sbjct: 177457 tctctgtcttcaaaacaa 177474
>gb|AC110534.11| Mus musculus chromosome 17, clone RP23-174D11, complete sequence Length = 174600 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 91044 ctctgtcttcaaaacaaa 91061
>emb|CR293534.5| Zebrafish DNA sequence from clone CH211-13J1 in linkage group 6, complete sequence Length = 109426 Score = 36.2 bits (18), Expect = 9.1 Identities = 21/22 (95%) Strand = Plus / Plus Query: 2 ctttctgctctcggttctctgt 23 ||||||||||||| |||||||| Sbjct: 30318 ctttctgctctcgtttctctgt 30339
>gb|AC113595.11| Mus musculus chromosome 15, clone RP23-373B5, complete sequence Length = 235814 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 122404 ctctgtcttcaaaacaaa 122387
>gb|AC158751.7| Mus musculus chromosome 7, clone RP23-413C19, complete sequence Length = 198442 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 53327 ctctgtcttcaaaacaaa 53344
>gb|BC007182.1| Mus musculus mRNA similar to hypothetical protein, MGC:7002 (cDNA clone IMAGE:3590667) Length = 2117 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 1670 ctctgtcttcaaaacaaa 1653
>emb|CR848007.6| Human DNA sequence from clone RP11-115C9 on chromosome 9 Contains a calponin 2 (CNN2) pseudogene, a novel zinc finger pseudogene, a pseudogene similar to part of cytochrome P450, subfamily IVF, a chromosome 2 open reading frame 14 (C2orf14) pseudogene, a pseudogene similar to part of sorting nexin associated golgi protein 1 (SNAG1), a melanoma antigen (LOC51152) pseudogene, four novel pseudogenes and an ankyrin repeat domain 20A (ANKRD20A) pseudogene, complete sequence Length = 149891 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 118449 ctctgtcttcaaaacaaa 118466
>gb|BC003314.1| Mus musculus apolipoprotein B editing complex 3, mRNA (cDNA clone MGC:7002 IMAGE:3155422), complete cds Length = 1948 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 1515 ctctgtcttcaaaacaaa 1498
>emb|AL365338.17| Human DNA sequence from clone RP11-123N4 on chromosome 9 Contain the 3' end of the gene for rab6 GTPase activating protein (GAP and centrosome-associated) (GAPCENA), a pseudogene similar to part of thyroid receptor interacting protein 15 (TRIP15), the 3' end of the STRBP gene for spermatid perinuclear RNA binding protein (FLJ11307), a novel gene (GL012) and a CpG island, complete sequence Length = 150230 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 16 ttctctgtcttcaaaaca 33 |||||||||||||||||| Sbjct: 117560 ttctctgtcttcaaaaca 117577
>gb|AC025853.17| Homo sapiens chromosome 8, clone RP11-353K12, complete sequence Length = 173681 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 164181 ctctgtcttcaaaacaaa 164198 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 19 tctgtcttcaaaacaaac 36 |||||||||||||||||| Sbjct: 44512 tctgtcttcaaaacaaac 44495
>emb|AL035681.13|HS756G23 Human DNA sequence from clone RP4-756G23 on chromosome 22q13.31-13.33, complete sequence Length = 89948 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 19694 ctctgtcttcaaaacaaa 19711
>emb|CR318674.9| Zebrafish DNA sequence from clone DKEY-210I3 in linkage group 23, complete sequence Length = 86079 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 21 tgtcttcaaaacaaactt 38 |||||||||||||||||| Sbjct: 6428 tgtcttcaaaacaaactt 6445
>gb|AC166574.1| Mus musculus BAC clone RP23-131O4 from chromosome 14, complete sequence Length = 220918 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 157977 ctctgtcttcaaaacaaa 157994
>emb|AJ250915.1|HSA250915 Homo sapiens p10 gene for chaperonin 10 (Hsp10 protein) and p60 gene for chaperonin 60 (Hsp60 protein) Length = 16986 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 15981 ctctgtcttcaaaacaaa 15964
>emb|BX649563.5| Human DNA sequence from clone RP11-213O5 on chromosome 9 Contains a pseudogene similar to part of a novel protein (DKFZp434A171), a pseudogene similar to part of meprin A, alpha (PABA peptide hydrolase) (MEP1A), a pseudogene similar to part of a novel transmembrane receptor protein and two novel pseudogenes, complete sequence Length = 189495 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 2425 ctctgtcttcaaaacaaa 2442
>emb|BX322638.6| Zebrafish DNA sequence from clone DKEYP-114C5 in linkage group 11, complete sequence Length = 85185 Score = 36.2 bits (18), Expect = 9.1 Identities = 21/22 (95%) Strand = Plus / Plus Query: 41 ccaaacttcctcttcccccttt 62 ||||||||||||||||| |||| Sbjct: 6424 ccaaacttcctcttcccacttt 6445
>gb|AC104627.8| Drosophila melanogaster X BAC RP98-4A11 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 187921 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 45 acttcctcttcccccttt 62 |||||||||||||||||| Sbjct: 126751 acttcctcttcccccttt 126768
>gb|AC110011.3| Homo sapiens chromosome 5 clone RP11-536N17, complete sequence Length = 85975 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 19 tctgtcttcaaaacaaac 36 |||||||||||||||||| Sbjct: 84448 tctgtcttcaaaacaaac 84431
>gb|AC103693.2| Homo sapiens chromosome 18, clone CTD-2522C24, complete sequence Length = 193404 Score = 36.2 bits (18), Expect = 9.1 Identities = 21/22 (95%) Strand = Plus / Minus Query: 41 ccaaacttcctcttcccccttt 62 ||||||||||||||||| |||| Sbjct: 160471 ccaaacttcctcttccctcttt 160450
>gb|AC090152.4| Homo sapiens chromosome 8, clone RP11-554M1, complete sequence Length = 118755 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 40294 ctctgtcttcaaaacaaa 40311
>dbj|AK154035.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430026K09 product:Warning: possibly chimeric clone, full insert sequence Length = 2718 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 1538 ctctgtcttcaaaacaaa 1521
>gb|AC100802.2| Homo sapiens chromosome 8, clone CTB-2109K7, complete sequence Length = 203506 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 191871 ctctgtcttcaaaacaaa 191854
>dbj|AK153719.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630059M22 product:apolipoprotein B editing complex 3, full insert sequence Length = 1967 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 1384 ctctgtcttcaaaacaaa 1367
>gb|AC010746.8| Homo sapiens BAC clone RP11-550E21 from 2, complete sequence Length = 229379 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 223138 ctctgtcttcaaaacaaa 223155
>ref|XM_683537.1| PREDICTED: Danio rerio similar to spindle assembly associated Sfi1 homolog isoform a (LOC560147), mRNA Length = 4518 Score = 36.2 bits (18), Expect = 9.1 Identities = 21/22 (95%) Strand = Plus / Minus Query: 2 ctttctgctctcggttctctgt 23 ||||||||||||| |||||||| Sbjct: 1402 ctttctgctctcgtttctctgt 1381
>ref|NM_030255.2| Mus musculus apolipoprotein B editing complex 3 (Apobec3), mRNA Length = 1967 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 1384 ctctgtcttcaaaacaaa 1367
>dbj|AK167986.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730045D21 product:apolipoprotein B editing complex 3, full insert sequence Length = 1843 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 1440 ctctgtcttcaaaacaaa 1423
>gb|AC161454.3| Mus musculus BAC clone RP23-332F10 from chromosome 3, complete sequence Length = 228486 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 12392 ctctgtcttcaaaacaaa 12375
>gb|AC158313.7| Mus musculus chromosome 8, clone RP23-246H16, complete sequence Length = 168864 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 70174 ctctgtcttcaaaacaaa 70191
>gb|AC008821.6| Homo sapiens chromosome 5 clone CTD-2129G21, complete sequence Length = 184111 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 44 aacttcctcttccccctt 61 |||||||||||||||||| Sbjct: 100231 aacttcctcttccccctt 100214
>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII, complete sequence Length = 1476513 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 33 aaacttcgccaaacttcc 50 |||||||||||||||||| Sbjct: 50657 aaacttcgccaaacttcc 50640
>gb|AC158233.2| Mus musculus BAC clone RP23-240E15 from chromosome 3, complete sequence Length = 209923 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 31695 ctctgtcttcaaaacaaa 31712
>dbj|AK049256.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:C330017K03 product:hypothetical protein, MGC:7002, full insert sequence Length = 1802 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 1394 ctctgtcttcaaaacaaa 1377
>dbj|AK044394.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library, clone:A930010L09 product:hypothetical protein, MGC:7002, full insert sequence Length = 2782 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 1847 ctctgtcttcaaaacaaa 1830
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 19 tctgtcttcaaaacaaac 36 |||||||||||||||||| Sbjct: 6937453 tctgtcttcaaaacaaac 6937470
>gb|AC008245.6| Homo sapiens chromosome 18, clone RP11-146N18, complete sequence Length = 183749 Score = 36.2 bits (18), Expect = 9.1 Identities = 21/22 (95%) Strand = Plus / Minus Query: 41 ccaaacttcctcttcccccttt 62 ||||||||||||||||| |||| Sbjct: 626 ccaaacttcctcttccctcttt 605
>gb|AC007821.4|AC007821 Drosophila melanogaster, chromosome 3R, region 99F-100A, BAC clone BACR48I02, complete sequence Length = 163741 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 39 cgccaaacttcctcttcc 56 |||||||||||||||||| Sbjct: 116800 cgccaaacttcctcttcc 116817
>gb|AC154337.2| Mus musculus BAC clone RP23-254P20 from chromosome 17, complete sequence Length = 182101 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 16 ttctctgtcttcaaaaca 33 |||||||||||||||||| Sbjct: 24210 ttctctgtcttcaaaaca 24227
>gb|AC008592.4|AC008592 Homo sapiens chromosome 5 clone CTC-576H9, complete sequence Length = 192670 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 44 aacttcctcttccccctt 61 |||||||||||||||||| Sbjct: 180888 aacttcctcttccccctt 180871
>gb|AC136624.3| Homo sapiens chromosome 16 clone RP11-517A5, complete sequence Length = 211896 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 142160 ctctgtcttcaaaacaaa 142143
>gb|AC092960.3| Homo sapiens 3 BAC RP11-393B14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 172507 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 7787 ctctgtcttcaaaacaaa 7804
>gb|AC073611.29| Homo sapiens 12 BAC RP11-680A11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 106551 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 89419 ctctgtcttcaaaacaaa 89402
>gb|AC022966.13| Homo sapiens chromosome 17, clone RP11-323N12, complete sequence Length = 184139 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 167039 ctctgtcttcaaaacaaa 167056
>gb|AC130465.2| Homo sapiens chromosome 16 clone CTA-962B4, complete sequence Length = 173911 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 40741 ctctgtcttcaaaacaaa 40758
>gb|U91318.1|HUU91318 Human chromosome 16 BAC clone CIT987SK-A-962B4, complete sequence Length = 172984 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 40741 ctctgtcttcaaaacaaa 40758
>ref|NM_211378.1| Eremothecium gossypii AGL351Wp (AGL351W), mRNA Length = 1668 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 33 aaacttcgccaaacttcc 50 |||||||||||||||||| Sbjct: 901 aaacttcgccaaacttcc 884
>emb|AL513406.1|CNS07EFT Human DNA sequence chromosome 8 of Homo sapiens (human) Length = 204955 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 167020 ctctgtcttcaaaacaaa 167037
>gb|AC007172.6|AC007172 Homo sapiens chromosome 9, clone hRPK.538_E_7, complete sequence Length = 168535 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 16 ttctctgtcttcaaaaca 33 |||||||||||||||||| Sbjct: 39363 ttctctgtcttcaaaaca 39346
>gb|AE003775.2| Drosophila melanogaster chromosome 3R, section 113 of 118 of the complete sequence Length = 236096 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 39 cgccaaacttcctcttcc 56 |||||||||||||||||| Sbjct: 133455 cgccaaacttcctcttcc 133472
>dbj|AP006545.1| Homo sapiens genomic DNA, chromosome 8p11.21, clone: KB1836B05, complete sequence Length = 156888 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 62193 ctctgtcttcaaaacaaa 62176
>gb|AE003490.3| Drosophila melanogaster chromosome X, section 42 of 74 of the complete sequence Length = 302665 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 45 acttcctcttcccccttt 62 |||||||||||||||||| Sbjct: 208322 acttcctcttcccccttt 208339
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 19 tctgtcttcaaaacaaac 36 |||||||||||||||||| Sbjct: 7003920 tctgtcttcaaaacaaac 7003937
>gb|AC147266.6| Mus musculus BAC clone RP24-246F6 from 8, complete sequence Length = 228955 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 22 gtcttcaaaacaaacttc 39 |||||||||||||||||| Sbjct: 220914 gtcttcaaaacaaacttc 220897
>gb|AC123825.5| Mus musculus BAC clone RP24-93F18 from 8, complete sequence Length = 236875 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 22 gtcttcaaaacaaacttc 39 |||||||||||||||||| Sbjct: 104878 gtcttcaaaacaaacttc 104895
>emb|AL356805.5|CNS05TDN Human chromosome 14 DNA sequence BAC R-33N16 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 158838 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 18 ctctgtcttcaaaacaaa 35 |||||||||||||||||| Sbjct: 92714 ctctgtcttcaaaacaaa 92697
>gb|AC008429.6| Homo sapiens chromosome 5 clone CTC-308K20, complete sequence Length = 159423 Score = 36.2 bits (18), Expect = 9.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 19 tctgtcttcaaaacaaac 36 |||||||||||||||||| Sbjct: 8537 tctgtcttcaaaacaaac 8520 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 825,363 Number of Sequences: 3902068 Number of extensions: 825363 Number of successful extensions: 61239 Number of sequences better than 10.0: 89 Number of HSP's better than 10.0 without gapping: 89 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 61072 Number of HSP's gapped (non-prelim): 167 length of query: 62 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 41 effective length of database: 17,151,101,840 effective search space: 703195175440 effective search space used: 703195175440 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)