>gb|AY111306.1| Zea mays CL10099_1 mRNA sequence
          Length = 649

 Score =  172 bits (87), Expect = 6e-40
 Identities = 176/206 (85%)
 Strand = Plus / Plus

                                                                       
Query: 254 atggaggccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgcacc 313
           |||||| ||||||  |||||||||||||||||||||| ||||||| || |||||||| ||
Sbjct: 240 atggagcccgcgggcgcgcgcaaggagtggcgcgccgnccccgactcctcgctccgctcc 299

                                                                       
Query: 314 aatggcgccgaggatgccgcggagcgcatgaagatggcgcagtccgagggcagggccatc 373
           ||||||||||||||||||||||||| |  |||| ||| |||||| ||||   | || |||
Sbjct: 300 aatggcgccgaggatgccgcggagcacgggaagctggggcagtcggaggaacgagctatc 359

                                                                       
Query: 374 taccaggatgagtcgggagggctggacgacttctgctcgatcaccatcgatgggagcggt 433
           ||| |||| | | |||| || ||||| ||||||||| | |||||||| ||||||||||| 
Sbjct: 360 tacgaggaaggggcgggtggactggaggacttctgcgccatcaccattgatgggagcgga 419

                                     
Query: 434 gggctcagcgatgacatcctgcagca 459
           ||||||||||| ||||||||||||||
Sbjct: 420 gggctcagcgaggacatcctgcagca 445

>ref|XM_483606.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3172

 Score =  147 bits (74), Expect = 4e-32
 Identities = 167/198 (84%)
 Strand = Plus / Plus

                                                                       
Query: 254 atggaggccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgcacc 313
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 293 atggacgccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgctcc 352

                                                                       
Query: 314 aatggcgccgaggatgccgcggagcgcatgaagatggcgcagtccgagggcagggccatc 373
           ||||||||||| ||| ||| |||||     ||||||| ||| ||||||| ||| ||||| 
Sbjct: 353 aatggcgccgacgatcccggggagcatggcaagatggggcaatccgaggacagagccatg 412

                                                                       
Query: 374 taccaggatgagtcgggagggctggacgacttctgctcgatcaccatcgatgggagcggt 433
           ||| |||| | |   ||| | ||||| || | |||||||||||||||||| || ||||| 
Sbjct: 413 tacgaggacgggggtggaagactggatgattactgctcgatcaccatcgacggaagcggg 472

                             
Query: 434 gggctcagcgatgacatc 451
           || |||||||| ||||||
Sbjct: 473 ggcctcagcgaggacatc 490

>dbj|AK066525.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013072L17, full
           insert sequence
          Length = 3173

 Score =  147 bits (74), Expect = 4e-32
 Identities = 167/198 (84%)
 Strand = Plus / Plus

                                                                       
Query: 254 atggaggccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgcacc 313
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 293 atggacgccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgctcc 352

                                                                       
Query: 314 aatggcgccgaggatgccgcggagcgcatgaagatggcgcagtccgagggcagggccatc 373
           ||||||||||| ||| ||| |||||     ||||||| ||| ||||||| ||| ||||| 
Sbjct: 353 aatggcgccgacgatcccggggagcatggcaagatggggcaatccgaggacagagccatg 412

                                                                       
Query: 374 taccaggatgagtcgggagggctggacgacttctgctcgatcaccatcgatgggagcggt 433
           ||| |||| | |   ||| | ||||| || | |||||||||||||||||| || ||||| 
Sbjct: 413 tacgaggacgggggtggaagactggatgattactgctcgatcaccatcgacggaagcggg 472

                             
Query: 434 gggctcagcgatgacatc 451
           || |||||||| ||||||
Sbjct: 473 ggcctcagcgaggacatc 490

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  125 bits (63), Expect = 1e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                            
Query: 254      atggaggccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgcacc 313
                ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 27209483 atggacgccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgctcc 27209424

                           
Query: 314      aatggcgccga 324
                |||||||||||
Sbjct: 27209423 aatggcgccga 27209413



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                              
Query: 406      ctgctcgatcaccatcgatgggagcggtgggctcagcgatgacatc 451
                |||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 27209108 ctgctcgatcaccatcgacggaagcgggggcctcagcgaggacatc 27209063

>dbj|AP003914.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1521_G02
          Length = 117964

 Score =  125 bits (63), Expect = 1e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                          
Query: 254    atggaggccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgcacc 313
              ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 110516 atggacgccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgctcc 110457

                         
Query: 314    aatggcgccga 324
              |||||||||||
Sbjct: 110456 aatggcgccga 110446



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                            
Query: 406    ctgctcgatcaccatcgatgggagcggtgggctcagcgatgacatc 451
              |||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 110141 ctgctcgatcaccatcgacggaagcgggggcctcagcgaggacatc 110096

>dbj|AP004632.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0623F08
          Length = 154540

 Score =  125 bits (63), Expect = 1e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                         
Query: 254   atggaggccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgcacc 313
             ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 32686 atggacgccgcggcggcgcgcaaggagtggcgcgccgtccccgacgccccgctccgctcc 32627

                        
Query: 314   aatggcgccga 324
             |||||||||||
Sbjct: 32626 aatggcgccga 32616



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                           
Query: 406   ctgctcgatcaccatcgatgggagcggtgggctcagcgatgacatc 451
             |||||||||||||||||| || ||||| || |||||||| ||||||
Sbjct: 32311 ctgctcgatcaccatcgacggaagcgggggcctcagcgaggacatc 32266

>gb|AF305872.2| Homo sapiens chromosome 8 clone CTD-2182N23 map 8q24.3 , complete
              sequence
          Length = 134215

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 115    tccccccatcggcctccagcc 135
              |||||||||||||||||||||
Sbjct: 120748 tccccccatcggcctccagcc 120768

>gb|AF235100.4| Homo sapiens chromosome 8 clone RP11-98A24 map 8q24.3 , complete
             sequence
          Length = 129619

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 115   tccccccatcggcctccagcc 135
             |||||||||||||||||||||
Sbjct: 17626 tccccccatcggcctccagcc 17646

>gb|AC124316.32| Mus musculus chromosome 17, clone RP24-222O13, complete sequence
          Length = 223552

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 4      ggcatcccgccgcctcctctc 24
              |||||||||||||||||||||
Sbjct: 113989 ggcatcccgccgcctcctctc 114009

>gb|AF325196.1|AF325196 Triticum aestivum PST19 (Pst19), LRR19 (Lrr19), TAK19-1 (Tak19-1), and
             LRK19 (Lrk19) genes, complete cds
          Length = 35872

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 428   agcggtgggctcagcgatgacatcc 452
             |||||||||||| ||||||||||||
Sbjct: 17785 agcggtgggctcggcgatgacatcc 17809

>emb|Y18319.1|SLAP18319 Homo sapiens SLAP gene, clone SEQ.A1
          Length = 2939

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 115 tccccccatcggcctccagcc 135
           |||||||||||||||||||||
Sbjct: 842 tccccccatcggcctccagcc 822

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    ccatcggcctccagccggcg 139
              ||||||||||||||||||||
Sbjct: 831695 ccatcggcctccagccggcg 831676

>ref|XM_366100.1| Magnaporthe grisea 70-15 hypothetical protein (MG10320.4) partial
          mRNA
          Length = 2169

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 5  gcatcccgccgcctcctctc 24
          ||||||||||||||||||||
Sbjct: 46 gcatcccgccgcctcctctc 65

>gb|AY650399.1| Homo sapiens cell division cycle 34 (CDC34) gene, complete cds
          Length = 14358

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 348 tggcgcagtccgagggcagggcca 371
           |||| |||||||||||||||||||
Sbjct: 563 tggcacagtccgagggcagggcca 586

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 436     gctcagcgatgacatcctgc 455
               ||||||||||||||||||||
Sbjct: 4788440 gctcagcgatgacatcctgc 4788421

>gb|AC130551.4| Mus musculus BAC clone RP24-538J2 from chromosome 9, complete sequence
          Length = 189707

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 105    ccctagcccctccccccatc 124
              ||||||||||||||||||||
Sbjct: 188108 ccctagcccctccccccatc 188127

>emb|AL591784.1|SME591784 Sinorhizobium meliloti 1021 complete chromosome; segment 3/12
          Length = 300000

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 122    atcggcctccagccggcgct 141
              ||||||||||||||||||||
Sbjct: 119368 atcggcctccagccggcgct 119349

>gb|AC100550.7| Mus musculus chromosome 9, clone RP23-152P11, complete sequence
          Length = 188119

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 105  ccctagcccctccccccatc 124
            ||||||||||||||||||||
Sbjct: 8133 ccctagcccctccccccatc 8152

>emb|BX842574.1| Mycobacterium tuberculosis H37Rv complete genome; segment 3/13
          Length = 349564

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    ccatcggcctccagccggcg 139
              ||||||||||||||||||||
Sbjct: 145232 ccatcggcctccagccggcg 145213

>emb|BX248336.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 3/14
          Length = 320050

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    ccatcggcctccagccggcg 139
              ||||||||||||||||||||
Sbjct: 164327 ccatcggcctccagccggcg 164308

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 315     atggcgccgaggatgccgcg 334
               ||||||||||||||||||||
Sbjct: 2772107 atggcgccgaggatgccgcg 2772126

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 189     agccccgccgccagatcccg 208
               ||||||||||||||||||||
Sbjct: 1991878 agccccgccgccagatcccg 1991859

>gb|AC011531.7|AC011531 Homo sapiens chromosome 19 clone LLNLR-231G5, complete sequence
          Length = 36377

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 348   tggcgcagtccgagggcagggcca 371
             |||| |||||||||||||||||||
Sbjct: 19784 tggcacagtccgagggcagggcca 19807

>gb|U77912.1|MBU77912 Mycobacterium bovis MBE50a gene, partial cds; and MBE50b, MBE50c,
            preprotein translocase SecY subunit (secY), adenylate
            kinase (adk), methionine aminopeptidase (map), RNA
            polymerase ECF sigma factor (sigE50), MBE50d, and MBE50e
            genes, complete cds
          Length = 7163

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 120  ccatcggcctccagccggcg 139
            ||||||||||||||||||||
Sbjct: 6961 ccatcggcctccagccggcg 6942

>gb|AF478411.1| Chlamydomonas reinhardtii iron transporter Ftr1 (FTR1) mRNA,
           complete cds
          Length = 2833

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 124 cggcctccagccggcgcttc 143
           ||||||||||||||||||||
Sbjct: 619 cggcctccagccggcgcttc 600


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,489,898
Number of Sequences: 3902068
Number of extensions: 2489898
Number of successful extensions: 55931
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55485
Number of HSP's gapped (non-prelim): 445
length of query: 459
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 437
effective length of database: 17,147,199,772
effective search space: 7493326300364
effective search space used: 7493326300364
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)