ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bastl04d09 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK101405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037G17, full insert sequence Length = 3104 Score = 391 bits (197), Expect = e-105 Identities = 330/373 (88%), Gaps = 1/373 (0%) Strand = Plus / Plus Query: 131 gccaaaatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataat 190 ||||| ||||||||||| || | || ||||| ||| | |||||||||||||| ||||| Sbjct: 310 gccaagatggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataac 369 Query: 191 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcc 250 ||||||||||||||||| ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 370 attcgtaacatgtctgtcattgctcatgtcgaccatggcaagtccacgcttacagattcc 429 Query: 251 cttgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgat 310 ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| Sbjct: 430 cttgtggcagctgctgggattattgcccaggaagttgctggtgatgttcgcatgactgat 489 Query: 311 acccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttc 370 |||||||||||||| || |||||||||||||||||||| ||||| || |||||||||||| Sbjct: 490 acccgtgcagatgaagctgagcgtggtattacaatcaagtccactggcatctctcttttc 549 Query: 371 tatcagatgactcctgaatcacttgagatgtacaagggtgacagggatggggatgaatac 430 || |||||| | ||||||||| || | |||||||| || || || || |||| ||| Sbjct: 550 tacgagatgagtgatgaatcactcaagttatacaagggcgagagagacggaaatgagtac 609 Query: 431 ctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagctgct 489 |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| |||||| Sbjct: 610 ctgatcaaccttattgattcacctgggcacgttgatttttcttcggaggtcactgctgct 669 Query: 490 cttcgtatcactg 502 |||||||| |||| Sbjct: 670 cttcgtattactg 682
>dbj|AK101166.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028E07, full insert sequence Length = 3081 Score = 391 bits (197), Expect = e-105 Identities = 330/373 (88%), Gaps = 1/373 (0%) Strand = Plus / Plus Query: 131 gccaaaatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataat 190 ||||| ||||||||||| || | || ||||| ||| | |||||||||||||| ||||| Sbjct: 310 gccaagatggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataac 369 Query: 191 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcc 250 ||||||||||||||||| ||||||||||||||||| |||||||| |||||||| |||||| Sbjct: 370 attcgtaacatgtctgtcattgctcatgtcgaccatggcaagtccacgcttacagattcc 429 Query: 251 cttgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgat 310 ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| Sbjct: 430 cttgtggcagctgctgggattattgcccaggaagttgctggtgatgttcgcatgactgat 489 Query: 311 acccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttc 370 |||||||||||||| || |||||||||||||||||||| ||||| || |||||||||||| Sbjct: 490 acccgtgcagatgaagctgagcgtggtattacaatcaagtccactggcatctctcttttc 549 Query: 371 tatcagatgactcctgaatcacttgagatgtacaagggtgacagggatggggatgaatac 430 || |||||| | ||||||||| || | |||||||| || || || || |||| ||| Sbjct: 550 tacgagatgagtgatgaatcactcaagttatacaagggcgagagagacggaaatgagtac 609 Query: 431 ctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagctgct 489 |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| |||||| Sbjct: 610 ctgatcaaccttattgattcacctgggcacgttgatttttcttcggaggtcactgctgct 669 Query: 490 cttcgtatcactg 502 |||||||| |||| Sbjct: 670 cttcgtattactg 682
>ref|XM_471058.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2532 Score = 387 bits (195), Expect = e-104 Identities = 325/367 (88%), Gaps = 1/367 (0%) Strand = Plus / Plus Query: 137 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 196 ||||||||||| || | || ||||| ||| | |||||||||||||| ||||| |||||| Sbjct: 1 atggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataacattcgt 60 Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||||||||||||||| |||||||| |||||||| |||||||||||| Sbjct: 61 aacatgtctgtcattgctcatgtcgaccatggcaagtccacgcttacagattcccttgtg 120 Query: 257 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 316 ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| Sbjct: 121 gcagctgctgggattattgcccaggaagttgctggtgatgttcgcatgactgatacccgt 180 Query: 317 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttctatcag 376 |||||||| || |||||||||||||||||||| ||||| || |||||||||||||| || Sbjct: 181 gcagatgaagctgagcgtggtattacaatcaagtccactggcatctctcttttctacgag 240 Query: 377 atgactcctgaatcacttgagatgtacaagggtgacagggatggggatgaatacctgatc 436 |||| | ||||||||| || | |||||||| || || || || |||| ||||||||| Sbjct: 241 atgagtgatgaatcactcaagttatacaagggcgagagagacggaaatgagtacctgatc 300 Query: 437 aaccttattgattcacctggccacgttgacttttcttcgga-gtcacagctgctcttcgt 495 |||||||||||||||||||| |||||||| ||||||||||| ||||| |||||||||||| Sbjct: 301 aaccttattgattcacctgggcacgttgatttttcttcggaggtcactgctgctcttcgt 360 Query: 496 atcactg 502 || |||| Sbjct: 361 attactg 367
>ref|XM_465992.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2924 Score = 379 bits (191), Expect = e-102 Identities = 324/367 (88%), Gaps = 1/367 (0%) Strand = Plus / Plus Query: 137 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 196 ||||||||||| || | || ||||||||| | || ||||||||||| ||||| || ||| Sbjct: 160 atggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataacatccgt 219 Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 || ||||| || ||||||||||| |||||||| |||||||| ||||||||||| |||||| Sbjct: 220 aatatgtccgtcattgctcatgtggaccacggaaagtctacacttacggattctcttgtg 279 Query: 257 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 316 || |||||||| ||||| |||||||||||||| || |||||||||||||||||||||||| Sbjct: 280 gcggctgctggtattattgcccaggaagttgcgggtgatgttcgcatgactgatacccgt 339 Query: 317 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttctatcag 376 |||||||| || |||||||||||||||||||||||||| |||||||||||||||||| || Sbjct: 340 gcagatgaagctgagcgtggtattacaatcaaatccactggtatctctcttttctatgag 399 Query: 377 atgactcctgaatcacttgagatgtacaagggtgacagggatggggatgaatacctgatc 436 |||| | ||||||||| || ||||||||||||| || ||||| |||| ||||||||| Sbjct: 400 atgagtgatgaatcactcaagttgtacaagggtgagagagatggaaatgagtacctgatc 459 Query: 437 aaccttattgattcacctggccacgttgacttttcttcgga-gtcacagctgctcttcgt 495 |||||||||||||||||||| |||||||| ||||||||||| ||||| |||||||||||| Sbjct: 460 aaccttattgattcacctgggcacgttgatttttcttcggaggtcactgctgctcttcgt 519 Query: 496 atcactg 502 || |||| Sbjct: 520 attactg 526
>dbj|AK100313.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078M04, full insert sequence Length = 2923 Score = 379 bits (191), Expect = e-102 Identities = 324/367 (88%), Gaps = 1/367 (0%) Strand = Plus / Plus Query: 137 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 196 ||||||||||| || | || ||||||||| | || ||||||||||| ||||| || ||| Sbjct: 159 atggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataacatccgt 218 Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 || ||||| || ||||||||||| |||||||| |||||||| ||||||||||| |||||| Sbjct: 219 aatatgtccgtcattgctcatgtggaccacggaaagtctacacttacggattctcttgtg 278 Query: 257 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 316 || |||||||| ||||| |||||||||||||| || |||||||||||||||||||||||| Sbjct: 279 gcggctgctggtattattgcccaggaagttgcgggtgatgttcgcatgactgatacccgt 338 Query: 317 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttctatcag 376 |||||||| || |||||||||||||||||||||||||| |||||||||||||||||| || Sbjct: 339 gcagatgaagctgagcgtggtattacaatcaaatccactggtatctctcttttctatgag 398 Query: 377 atgactcctgaatcacttgagatgtacaagggtgacagggatggggatgaatacctgatc 436 |||| | ||||||||| || ||||||||||||| || ||||| |||| ||||||||| Sbjct: 399 atgagtgatgaatcactcaagttgtacaagggtgagagagatggaaatgagtacctgatc 458 Query: 437 aaccttattgattcacctggccacgttgacttttcttcgga-gtcacagctgctcttcgt 495 |||||||||||||||||||| |||||||| ||||||||||| ||||| |||||||||||| Sbjct: 459 aaccttattgattcacctgggcacgttgatttttcttcggaggtcactgctgctcttcgt 518 Query: 496 atcactg 502 || |||| Sbjct: 519 attactg 525
>gb|AY103807.1| Zea mays PCO130571 mRNA sequence Length = 2964 Score = 351 bits (177), Expect = 1e-93 Identities = 319/365 (87%), Gaps = 1/365 (0%) Strand = Plus / Plus Query: 137 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 196 ||||||||||| || || || |||||||||| || |||||||| || || || |||||| Sbjct: 150 atggtgaagttcacagctgaagagctccgcgctatcatggacaaaaagaacaacattcgt 209 Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||||||||| ||||| ||||||||||||||||| |||||||||||| Sbjct: 210 aacatgtctgtcattgctcatgtggaccatggcaagtctacgcttacagattcccttgtg 269 Query: 257 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 316 ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| || Sbjct: 270 gcagctgctgggattattgcccaggaagttgctggtgatgttcgcatgactgatactcgg 329 Query: 317 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttctatcag 376 |||||||| ||||||||||| |||||||||||||| || ||||||||||||| |||| || Sbjct: 330 gcagatgaagcagagcgtggcattacaatcaaatctactggtatctctctttactatgag 389 Query: 377 atgactcctgaatcacttgagatgtacaagggtgacagggatggggatgaatacctgatc 436 |||||| || ||||| ||| ||||||||||| || ||||| | ||||| ||||| Sbjct: 390 atgactgacgagtcactgaagaactacaagggtgagagagatggtaaccaatacttgatc 449 Query: 437 aaccttattgattcacctggccacgttgacttttcttcgg-agtcacagctgctcttcgt 495 ||||||||||| || ||||| |||||||| |||||||||| |||||||||||||||||| Sbjct: 450 aaccttattgactcgcctggacacgttgatttttcttcggaagtcacagctgctcttcgc 509 Query: 496 atcac 500 ||||| Sbjct: 510 atcac 514
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 321 bits (162), Expect = 1e-84 Identities = 247/274 (90%), Gaps = 1/274 (0%) Strand = Plus / Plus Query: 230 aagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgct 289 |||||||| ||||||||||| |||||||| |||||||| ||||| |||||||||||||| Sbjct: 18938507 aagtctacacttacggattctcttgtggcggctgctggtattattgcccaggaagttgcg 18938566 Query: 290 ggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaa 349 || |||||||||||||||||||||||||||||||| || ||||||||||||||||||||| Sbjct: 18938567 ggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatcaaa 18938626 Query: 350 tccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggt 409 ||||| |||||||||||||||||| |||||| | ||||||||| || ||||||||||| Sbjct: 18938627 tccactggtatctctcttttctatgagatgagtgatgaatcactcaagttgtacaagggt 18938686 Query: 410 gacagggatggggatgaatacctgatcaaccttattgattcacctggccacgttgacttt 469 || || ||||| |||| ||||||||||||||||||||||||||||| |||||||| ||| Sbjct: 18938687 gagagagatggaaatgagtacctgatcaaccttattgattcacctgggcacgttgatttt 18938746 Query: 470 tcttcgga-gtcacagctgctcttcgtatcactg 502 |||||||| ||||| |||||||||||||| |||| Sbjct: 18938747 tcttcggaggtcactgctgctcttcgtattactg 18938780 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 137 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 196 ||||||||||| || | || ||||||||| | || ||||||||||| ||||| || ||| Sbjct: 18937774 atggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataacatccgt 18937833 Query: 197 aacatgtctgttattgctcatgtcgaccacgg 228 || ||||| || ||||||||||| |||||||| Sbjct: 18937834 aatatgtccgtcattgctcatgtggaccacgg 18937865
>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0461D06 Length = 112895 Score = 321 bits (162), Expect = 1e-84 Identities = 247/274 (90%), Gaps = 1/274 (0%) Strand = Plus / Plus Query: 230 aagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgct 289 |||||||| ||||||||||| |||||||| |||||||| ||||| |||||||||||||| Sbjct: 102040 aagtctacacttacggattctcttgtggcggctgctggtattattgcccaggaagttgcg 102099 Query: 290 ggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaa 349 || |||||||||||||||||||||||||||||||| || ||||||||||||||||||||| Sbjct: 102100 ggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatcaaa 102159 Query: 350 tccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggt 409 ||||| |||||||||||||||||| |||||| | ||||||||| || ||||||||||| Sbjct: 102160 tccactggtatctctcttttctatgagatgagtgatgaatcactcaagttgtacaagggt 102219 Query: 410 gacagggatggggatgaatacctgatcaaccttattgattcacctggccacgttgacttt 469 || || ||||| |||| ||||||||||||||||||||||||||||| |||||||| ||| Sbjct: 102220 gagagagatggaaatgagtacctgatcaaccttattgattcacctgggcacgttgatttt 102279 Query: 470 tcttcgga-gtcacagctgctcttcgtatcactg 502 |||||||| ||||| |||||||||||||| |||| Sbjct: 102280 tcttcggaggtcactgctgctcttcgtattactg 102313 Score = 63.9 bits (32), Expect = 5e-07 Identities = 77/92 (83%) Strand = Plus / Plus Query: 137 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 196 ||||||||||| || | || ||||||||| | || ||||||||||| ||||| || ||| Sbjct: 101307 atggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataacatccgt 101366 Query: 197 aacatgtctgttattgctcatgtcgaccacgg 228 || ||||| || ||||||||||| |||||||| Sbjct: 101367 aatatgtccgtcattgctcatgtggaccacgg 101398
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 303 bits (153), Expect = 3e-79 Identities = 247/277 (89%), Gaps = 1/277 (0%) Strand = Plus / Plus Query: 227 ggcaagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagtt 286 |||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||| Sbjct: 1083036 ggcaagtccacgcttacagattcccttgtggcagctgctgggattattgcccaggaagtt 1083095 Query: 287 gctggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatc 346 ||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||| Sbjct: 1083096 gctggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatc 1083155 Query: 347 aaatccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaag 406 || ||||| || |||||||||||||| |||||| | ||||||||| || | |||||| Sbjct: 1083156 aagtccactggcatctctcttttctacgagatgagtgatgaatcactcaagttatacaag 1083215 Query: 407 ggtgacagggatggggatgaatacctgatcaaccttattgattcacctggccacgttgac 466 || || || || || |||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 1083216 ggcgagagagacggaaatgagtacctgatcaaccttattgattcacctgggcacgttgat 1083275 Query: 467 ttttcttcgga-gtcacagctgctcttcgtatcactg 502 ||||||||||| ||||| |||||||||||||| |||| Sbjct: 1083276 ttttcttcggaggtcactgctgctcttcgtattactg 1083312 Score = 93.7 bits (47), Expect = 5e-16 Identities = 83/95 (87%) Strand = Plus / Plus Query: 131 gccaaaatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataat 190 ||||| ||||||||||| || | || ||||| ||| | |||||||||||||| ||||| Sbjct: 1082071 gccaagatggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataac 1082130 Query: 191 attcgtaacatgtctgttattgctcatgtcgacca 225 ||||||||||||||||| ||||||||||||||||| Sbjct: 1082131 attcgtaacatgtctgtcattgctcatgtcgacca 1082165
>emb|AL606450.3|OSJN00001 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0020P07, complete sequence Length = 167895 Score = 303 bits (153), Expect = 3e-79 Identities = 247/277 (89%), Gaps = 1/277 (0%) Strand = Plus / Plus Query: 227 ggcaagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagtt 286 |||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||| Sbjct: 25405 ggcaagtccacgcttacagattcccttgtggcagctgctgggattattgcccaggaagtt 25464 Query: 287 gctggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatc 346 ||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||| Sbjct: 25465 gctggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatc 25524 Query: 347 aaatccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaag 406 || ||||| || |||||||||||||| |||||| | ||||||||| || | |||||| Sbjct: 25525 aagtccactggcatctctcttttctacgagatgagtgatgaatcactcaagttatacaag 25584 Query: 407 ggtgacagggatggggatgaatacctgatcaaccttattgattcacctggccacgttgac 466 || || || || || |||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 25585 ggcgagagagacggaaatgagtacctgatcaaccttattgattcacctgggcacgttgat 25644 Query: 467 ttttcttcgga-gtcacagctgctcttcgtatcactg 502 ||||||||||| ||||| |||||||||||||| |||| Sbjct: 25645 ttttcttcggaggtcactgctgctcttcgtattactg 25681 Score = 93.7 bits (47), Expect = 5e-16 Identities = 83/95 (87%) Strand = Plus / Plus Query: 131 gccaaaatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataat 190 ||||| ||||||||||| || | || ||||| ||| | |||||||||||||| ||||| Sbjct: 24440 gccaagatggtgaagttcacggttgaagagctgcgcaggattatggacaagaagaataac 24499 Query: 191 attcgtaacatgtctgttattgctcatgtcgacca 225 ||||||||||||||||| ||||||||||||||||| Sbjct: 24500 attcgtaacatgtctgtcattgctcatgtcgacca 24534
>ref|NM_191153.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2388 Score = 258 bits (130), Expect = 2e-65 Identities = 284/334 (85%), Gaps = 1/334 (0%) Strand = Plus / Plus Query: 170 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 229 |||||||||||||| |||| || ||||||||||||||| | |||||||| ||||| || Sbjct: 34 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggaccatgga 93 Query: 230 aagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgct 289 || ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| |||||| Sbjct: 94 aaatctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgct 153 Query: 290 ggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaa 349 || |||||||| |||||||||| ||| ||||||| ||||| |||||||||||||| ||| Sbjct: 154 ggtgatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaa 213 Query: 350 tccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggt 409 || || ||||||||||||| |||| |||||| | ||| ||||| | | ||||||||| Sbjct: 214 tctactggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggt 273 Query: 410 gacagggatggggatgaatacctgatcaaccttattgattcacctggccacgttgacttt 469 ||||| ||||| |||||||||| |||||||| ||||| |||||||| || || || ||| Sbjct: 274 gacagagatggaaatgaatacctaatcaacctcattgactcacctggacatgtcgatttt 333 Query: 470 tcttcgg-agtcacagctgctcttcgtatcactg 502 ||||||| ||||||||| || |||||||| |||| Sbjct: 334 tcttcggaagtcacagccgcacttcgtataactg 367
>dbj|AK063421.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-C05, full insert sequence Length = 2856 Score = 258 bits (130), Expect = 2e-65 Identities = 284/334 (85%), Gaps = 1/334 (0%) Strand = Plus / Plus Query: 170 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 229 |||||||||||||| |||| || ||||||||||||||| | |||||||| ||||| || Sbjct: 185 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggaccatgga 244 Query: 230 aagtctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgct 289 || ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| |||||| Sbjct: 245 aaatctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgct 304 Query: 290 ggggatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaa 349 || |||||||| |||||||||| ||| ||||||| ||||| |||||||||||||| ||| Sbjct: 305 ggtgatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaa 364 Query: 350 tccacgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggt 409 || || ||||||||||||| |||| |||||| | ||| ||||| | | ||||||||| Sbjct: 365 tctactggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggt 424 Query: 410 gacagggatggggatgaatacctgatcaaccttattgattcacctggccacgttgacttt 469 ||||| ||||| |||||||||| |||||||| ||||| |||||||| || || || ||| Sbjct: 425 gacagagatggaaatgaatacctaatcaacctcattgactcacctggacatgtcgatttt 484 Query: 470 tcttcgg-agtcacagctgctcttcgtatcactg 502 ||||||| ||||||||| || |||||||| |||| Sbjct: 485 tcttcggaagtcacagccgcacttcgtataactg 518
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 212 bits (107), Expect = 8e-52 Identities = 231/271 (85%), Gaps = 1/271 (0%) Strand = Plus / Plus Query: 233 tctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgctggg 292 ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| |||||||| Sbjct: 30987830 tctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgctggt 30987889 Query: 293 gatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaatcc 352 |||||||| |||||||||| ||| ||||||| ||||| |||||||||||||| ||||| Sbjct: 30987890 gatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaatct 30987949 Query: 353 acgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggtgac 412 || ||||||||||||| |||| |||||| | ||| ||||| | | |||||||||||| Sbjct: 30987950 actggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggtgac 30988009 Query: 413 agggatggggatgaatacctgatcaaccttattgattcacctggccacgttgacttttct 472 || ||||| |||||||||| |||||||| ||||| |||||||| || || || |||||| Sbjct: 30988010 agagatggaaatgaatacctaatcaacctcattgactcacctggacatgtcgatttttct 30988069 Query: 473 tcgg-agtcacagctgctcttcgtatcactg 502 |||| ||||||||| || |||||||| |||| Sbjct: 30988070 tcggaagtcacagccgcacttcgtataactg 30988100 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 170 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgacca 225 |||||||||||||| |||| || ||||||||||||||| | |||||||| ||||| Sbjct: 30987220 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggacca 30987275 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 131 gccaaaatggtgaagtttaccgcggaggagctccgcg 167 ||||| ||||||| |||||| |||||||||||||||| Sbjct: 30139918 gccaagatggtgaggtttacggcggaggagctccgcg 30139882
>dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0439E07 Length = 176486 Score = 212 bits (107), Expect = 8e-52 Identities = 231/271 (85%), Gaps = 1/271 (0%) Strand = Plus / Plus Query: 233 tctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgctggg 292 ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| |||||||| Sbjct: 44809 tctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgctggt 44868 Query: 293 gatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaatcc 352 |||||||| |||||||||| ||| ||||||| ||||| |||||||||||||| ||||| Sbjct: 44869 gatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaatct 44928 Query: 353 acgggtatctctcttttctatcagatgactcctgaatcacttgagatgtacaagggtgac 412 || ||||||||||||| |||| |||||| | ||| ||||| | | |||||||||||| Sbjct: 44929 actggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggtgac 44988 Query: 413 agggatggggatgaatacctgatcaaccttattgattcacctggccacgttgacttttct 472 || ||||| |||||||||| |||||||| ||||| |||||||| || || || |||||| Sbjct: 44989 agagatggaaatgaatacctaatcaacctcattgactcacctggacatgtcgatttttct 45048 Query: 473 tcgg-agtcacagctgctcttcgtatcactg 502 |||| ||||||||| || |||||||| |||| Sbjct: 45049 tcggaagtcacagccgcacttcgtataactg 45079 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 170 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgacca 225 |||||||||||||| |||| || ||||||||||||||| | |||||||| ||||| Sbjct: 44199 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggacca 44254
>gb|BT012802.1| Lycopersicon esculentum clone 113818R, mRNA sequence Length = 2816 Score = 149 bits (75), Expect = 1e-32 Identities = 261/319 (81%), Gaps = 3/319 (0%) Strand = Plus / Plus Query: 186 ataatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacgg 245 |||| |||||||| |||||||||||||||||||| ||||| || || ||||| ||||| | Sbjct: 122 ataacattcgtaatatgtctgttattgctcatgtggaccatggaaaatctacccttactg 181 Query: 246 attcccttgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatga 305 |||| || ||||| |||||||| || || || ||||||||||| || ||||| | |||| Sbjct: 182 attctctggtggcggctgctggtatcattgctcaggaagttgcaggtgatgtcagaatga 241 Query: 306 ctgatacccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctc 365 | ||||| |||||||||||||| ||||||||||| || ||||| ||||| ||||| || | Sbjct: 242 cagatacacgtgcagatgaggctgagcgtggtatcaccatcaagtccactggtatttcac 301 Query: 366 ttttctatcagatgactcctgaatcacttga-gatgtacaagggtgacagggatggggat 424 ||| ||| |||||||| ||| || ||||| || | |||||| || || ||||| | Sbjct: 302 tttactacgagatgactgatgactc-cttgaggaacttcaagggagagagaaatgggaac 360 Query: 425 gaatacctgatcaaccttattgattcacctggccacgttgacttttcttc-ggagtcaca 483 || ||||| |||||||| || ||||||||||| ||||||||||| || || | ||| || Sbjct: 361 gagtacctcatcaacctcatcgattcacctgggcacgttgacttctcatctgaagtgact 420 Query: 484 gctgctcttcgtatcactg 502 |||||||||||||| |||| Sbjct: 421 gctgctcttcgtattactg 439
>ref|NM_179487.1| Arabidopsis thaliana LOS1; GTP binding / translation elongation factor/ translation factor, nucleic acid binding AT1G56070 (LOS1) mRNA, complete cds Length = 2958 Score = 139 bits (70), Expect = 1e-29 Identities = 193/234 (82%) Strand = Plus / Plus Query: 133 caaaatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 192 |||||||||||||||||| || || ||||| || | ||||||||| | ||| | || || Sbjct: 108 caaaatggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacat 167 Query: 193 tcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 252 ||||| ||||||||||||||||||||||||||||| || || || ||||| ||||| | Sbjct: 168 ccgtaatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattcttt 227 Query: 253 tgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatac 312 || || |||||||| || || ||||| || |||||||| |||||||| ||||||||||| Sbjct: 228 ggttgctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgatac 287 Query: 313 ccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 366 | | || |||||||| || |||||||| || ||||| ||||| ||||| ||||| Sbjct: 288 cagagctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 341 Score = 71.9 bits (36), Expect = 2e-09 Identities = 67/76 (88%), Gaps = 1/76 (1%) Strand = Plus / Plus Query: 428 tacctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagct 486 ||||| ||||| ||||||||||||||||| ||||||||||||||||| || || || ||| Sbjct: 403 tacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttactgct 462 Query: 487 gctcttcgtatcactg 502 ||||| ||||| |||| Sbjct: 463 gctctccgtattactg 478
>gb|BT000722.1| Arabidopsis thaliana clone RAFL07-10-D07 (R10647) putative elongation factor (At1g56075) mRNA, complete cds Length = 2858 Score = 139 bits (70), Expect = 1e-29 Identities = 193/234 (82%) Strand = Plus / Plus Query: 133 caaaatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 192 |||||||||||||||||| || || ||||| || | ||||||||| | ||| | || || Sbjct: 72 caaaatggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacat 131 Query: 193 tcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 252 ||||| ||||||||||||||||||||||||||||| || || || ||||| ||||| | Sbjct: 132 ccgtaatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattcttt 191 Query: 253 tgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatac 312 || || |||||||| || || ||||| || |||||||| |||||||| ||||||||||| Sbjct: 192 ggttgctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgatac 251 Query: 313 ccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 366 | | || |||||||| || |||||||| || ||||| ||||| ||||| ||||| Sbjct: 252 cagagctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 305 Score = 71.9 bits (36), Expect = 2e-09 Identities = 67/76 (88%), Gaps = 1/76 (1%) Strand = Plus / Plus Query: 428 tacctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagct 486 ||||| ||||| ||||||||||||||||| ||||||||||||||||| || || || ||| Sbjct: 367 tacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttactgct 426 Query: 487 gctcttcgtatcactg 502 ||||| ||||| |||| Sbjct: 427 gctctccgtattactg 442
>gb|BT000661.1| Arabidopsis thaliana clone RAFL08-12-J19 (R11046) putative elongation factor (At1g56075) mRNA, complete cds Length = 2875 Score = 139 bits (70), Expect = 1e-29 Identities = 193/234 (82%) Strand = Plus / Plus Query: 133 caaaatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 192 |||||||||||||||||| || || ||||| || | ||||||||| | ||| | || || Sbjct: 108 caaaatggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacat 167 Query: 193 tcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 252 ||||| ||||||||||||||||||||||||||||| || || || ||||| ||||| | Sbjct: 168 ccgtaatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattcttt 227 Query: 253 tgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatac 312 || || |||||||| || || ||||| || |||||||| |||||||| ||||||||||| Sbjct: 228 ggttgctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgatac 287 Query: 313 ccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 366 | | || |||||||| || |||||||| || ||||| ||||| ||||| ||||| Sbjct: 288 cagagctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 341 Score = 71.9 bits (36), Expect = 2e-09 Identities = 67/76 (88%), Gaps = 1/76 (1%) Strand = Plus / Plus Query: 428 tacctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagct 486 ||||| ||||| ||||||||||||||||| ||||||||||||||||| || || || ||| Sbjct: 403 tacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttactgct 462 Query: 487 gctcttcgtatcactg 502 ||||| ||||| |||| Sbjct: 463 gctctccgtattactg 478
>gb|AF367331.1| Arabidopsis thaliana At1g56070/T6H22_13 mRNA, complete cds Length = 2756 Score = 139 bits (70), Expect = 1e-29 Identities = 193/234 (82%) Strand = Plus / Plus Query: 133 caaaatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 192 |||||||||||||||||| || || ||||| || | ||||||||| | ||| | || || Sbjct: 72 caaaatggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacat 131 Query: 193 tcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 252 ||||| ||||||||||||||||||||||||||||| || || || ||||| ||||| | Sbjct: 132 ccgtaatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattcttt 191 Query: 253 tgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatac 312 || || |||||||| || || ||||| || |||||||| |||||||| ||||||||||| Sbjct: 192 ggttgctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgatac 251 Query: 313 ccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 366 | | || |||||||| || |||||||| || ||||| ||||| ||||| ||||| Sbjct: 252 cagagctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 305 Score = 71.9 bits (36), Expect = 2e-09 Identities = 67/76 (88%), Gaps = 1/76 (1%) Strand = Plus / Plus Query: 428 tacctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagct 486 ||||| ||||| ||||||||||||||||| ||||||||||||||||| || || || ||| Sbjct: 367 tacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttactgct 426 Query: 487 gctcttcgtatcactg 502 ||||| ||||| |||| Sbjct: 427 gctctccgtattactg 442
>gb|AY054461.1| Arabidopsis thaliana elongation factor EF-2 (At1g56070; T6H22.13) mRNA, complete cds Length = 2719 Score = 139 bits (70), Expect = 1e-29 Identities = 193/234 (82%) Strand = Plus / Plus Query: 133 caaaatggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatat 192 |||||||||||||||||| || || ||||| || | ||||||||| | ||| | || || Sbjct: 72 caaaatggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacat 131 Query: 193 tcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 252 ||||| ||||||||||||||||||||||||||||| || || || ||||| ||||| | Sbjct: 132 ccgtaatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattcttt 191 Query: 253 tgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatac 312 || || |||||||| || || ||||| || |||||||| |||||||| ||||||||||| Sbjct: 192 ggttgctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgatac 251 Query: 313 ccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 366 | | || |||||||| || |||||||| || ||||| ||||| ||||| ||||| Sbjct: 252 cagagctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 305 Score = 71.9 bits (36), Expect = 2e-09 Identities = 67/76 (88%), Gaps = 1/76 (1%) Strand = Plus / Plus Query: 428 tacctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagct 486 ||||| ||||| ||||||||||||||||| ||||||||||||||||| || || || ||| Sbjct: 367 tacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttactgct 426 Query: 487 gctcttcgtatcactg 502 ||||| ||||| |||| Sbjct: 427 gctctccgtattactg 442
>gb|BT002714.1| Arabidopsis thaliana At1g56070/T6H22_13 gene, complete cds Length = 2532 Score = 131 bits (66), Expect = 2e-27 Identities = 189/230 (82%) Strand = Plus / Plus Query: 137 atggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgt 196 |||||||||||||| || || ||||| || | ||||||||| | ||| | || || ||| Sbjct: 1 atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 60 Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 || ||||||||||||||||||||||||||||| || || || ||||| ||||| | || Sbjct: 61 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 120 Query: 257 gcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgt 316 || |||||||| || || ||||| || |||||||| |||||||| |||||||||||| | Sbjct: 121 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 180 Query: 317 gcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 366 || |||||||| || |||||||| || ||||| ||||| ||||| ||||| Sbjct: 181 gctgatgaggctgaacgtggtatcactatcaagtccactggtatttctct 230 Score = 71.9 bits (36), Expect = 2e-09 Identities = 67/76 (88%), Gaps = 1/76 (1%) Strand = Plus / Plus Query: 428 tacctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagct 486 ||||| ||||| ||||||||||||||||| ||||||||||||||||| || || || ||| Sbjct: 292 tacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttactgct 351 Query: 487 gctcttcgtatcactg 502 ||||| ||||| |||| Sbjct: 352 gctctccgtattactg 367
>emb|Z97178.1|BVRNAEF2 Beta vulgaris cDNA for elongation factor 2 Length = 3001 Score = 119 bits (60), Expect = 9e-24 Identities = 156/188 (82%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccctt 253 ||||||||||||||||| || ||||| || ||||| || || ||||| || ||||| | Sbjct: 180 cgtaacatgtctgttatagcccatgtggatcacgggaaatcaacgctcacagattctttg 239 Query: 254 gtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacc 313 ||||| |||||||| || || |||||||| || ||||| ||||| || |||||||||||| Sbjct: 240 gtggctgctgctggtatcattgcccaggaggtggctggcgatgtacggatgactgatacc 299 Query: 314 cgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctctcttttctat 373 ||||| ||||| || || ||||||||||| ||||| ||||| || || ||||| | |||| Sbjct: 300 cgtgccgatgaagctgaacgtggtattaccatcaagtccactggaatttctctctactat 359 Query: 374 cagatgac 381 |||||||| Sbjct: 360 cagatgac 367 Score = 91.7 bits (46), Expect = 2e-15 Identities = 65/70 (92%), Gaps = 1/70 (1%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagctgctctt 492 ||||||||||||||||| ||||| |||||||||||||| || || ||||||||||||||| Sbjct: 420 atcaaccttattgattcccctgggcacgttgacttttcatcagaggtcacagctgctctt 479 Query: 493 cgtatcactg 502 |||||||||| Sbjct: 480 cgtatcactg 489
>dbj|AB026645.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGH6 Length = 81020 Score = 99.6 bits (50), Expect = 9e-18 Identities = 125/150 (83%) Strand = Plus / Plus Query: 233 tctacgcttacggattcccttgtggcagctgctgggattatcgcccaggaagttgctggg 292 ||||| ||||||||||| ||||| || |||||||| || || || || ||| ||| || Sbjct: 3664 tctacacttacggattcacttgttgctgctgctggtatcattgctcaagaaactgcgggt 3723 Query: 293 gatgttcgcatgactgatacccgtgcagatgaggcagagcgtggtattacaatcaaatcc 352 ||||| || ||||||||||| ||||| ||||||||||| |||||||| || ||||| ||| Sbjct: 3724 gatgtgcgtatgactgatactcgtgctgatgaggcagaacgtggtatcaccatcaagtcc 3783 Query: 353 acgggtatctctcttttctatcagatgact 382 || ||||||||||| | |||| |||||||| Sbjct: 3784 actggtatctctctctactatgagatgact 3813 Score = 89.7 bits (45), Expect = 8e-15 Identities = 73/81 (90%), Gaps = 1/81 (1%) Strand = Plus / Plus Query: 423 atgaatacctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtca 481 |||| |||||||||||||| ||||| || ||||| ||||||||||||||||| || |||| Sbjct: 3854 atgagtacctgatcaacctcattgactctcctggacacgttgacttttcttcagaggtca 3913 Query: 482 cagctgctcttcgtatcactg 502 |||||||||| |||||||||| Sbjct: 3914 cagctgctctccgtatcactg 3934
>gb|AC009894.2| Arabidopsis thaliana chromosome I BAC T6H22 genomic sequence, complete sequence Length = 96489 Score = 77.8 bits (39), Expect = 3e-11 Identities = 90/107 (84%) Strand = Plus / Plus Query: 260 gctgctgggattatcgcccaggaagttgctggggatgttcgcatgactgatacccgtgca 319 |||||||| || || ||||| || |||||||| |||||||| |||||||||||| | || Sbjct: 59122 gctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccagagct 59181 Query: 320 gatgaggcagagcgtggtattacaatcaaatccacgggtatctctct 366 |||||||| || |||||||| || ||||| ||||| ||||| ||||| Sbjct: 59182 gatgaggctgaacgtggtatcactatcaagtccactggtatttctct 59228 Score = 71.9 bits (36), Expect = 2e-09 Identities = 67/76 (88%), Gaps = 1/76 (1%) Strand = Plus / Plus Query: 428 tacctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagct 486 ||||| ||||| ||||||||||||||||| ||||||||||||||||| || || || ||| Sbjct: 59290 tacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttactgct 59349 Query: 487 gctcttcgtatcactg 502 ||||| ||||| |||| Sbjct: 59350 gctctccgtattactg 59365 Score = 67.9 bits (34), Expect = 3e-08 Identities = 76/90 (84%) Strand = Plus / Plus Query: 139 ggtgaagtttaccgcggaggagctccgcggaattatggacaagaaaaataatattcgtaa 198 |||||||||||| || || ||||| || | ||||||||| | ||| | || || ||||| Sbjct: 58780 ggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgtaa 58839 Query: 199 catgtctgttattgctcatgtcgaccacgg 228 ||||||||||||||||||||||||||||| Sbjct: 58840 tatgtctgttattgctcatgtcgaccacgg 58869
>gb|AC146817.10| Medicago truncatula clone mth2-8c19, complete sequence Length = 114343 Score = 75.8 bits (38), Expect = 1e-10 Identities = 101/122 (82%) Strand = Plus / Plus Query: 245 gattcccttgtggcagctgctgggattatcgcccaggaagttgctggggatgttcgcatg 304 ||||||||||| || || ||||| ||||| || || || |||||||| ||||| | ||| Sbjct: 57757 gattcccttgttgctgccgctggaattatagcacaagaggttgctggagatgtcagaatg 57816 Query: 305 actgatacccgtgcagatgaggcagagcgtggtattacaatcaaatccacgggtatctct 364 || ||||||||||| ||||| || || |||||||| || ||||| ||||| ||||||||| Sbjct: 57817 acagatacccgtgctgatgaagctgaacgtggtatcactatcaagtccactggtatctct 57876 Query: 365 ct 366 || Sbjct: 57877 ct 57878 Score = 60.0 bits (30), Expect = 7e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 191 attcgtaacatgtctgttattgctcatgtcgaccacgg 228 ||||| || ||||||||||||||||||||||||||||| Sbjct: 62505 attcggaatatgtctgttattgctcatgtcgaccacgg 62542 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 170 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgt 219 ||||||||| | ||| | || |||||||| |||||||||||||||||||| Sbjct: 56713 attatggactacaaacacaacattcgtaatatgtctgttattgctcatgt 56762
>gb|AF240824.1| Nipponopsalis abei elongation factor-2 mRNA, partial cds Length = 2179 Score = 75.8 bits (38), Expect = 1e-10 Identities = 47/50 (94%) Strand = Plus / Plus Query: 191 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgct 240 |||||||| |||||||||||||||||||| |||||||| ||||||||||| Sbjct: 35 attcgtaatatgtctgttattgctcatgtggaccacggaaagtctacgct 84
>emb|Z81068.1|CEF25H5 Caenorhabditis elegans Cosmid F25H5, complete sequence Length = 38692 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 191 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 249 |||||||||||||||||||||||||| ||||| ||||| || ||||| ||||| ||||| Sbjct: 9122 attcgtaacatgtctgttattgctcacgtcgatcacggaaaatctacccttaccgattc 9180
>ref|NM_060056.3| Caenorhabditis elegans Elongation FacTor family member (eft-2) (eft-2) mRNA, complete cds Length = 2669 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 191 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 249 |||||||||||||||||||||||||| ||||| ||||| || ||||| ||||| ||||| Sbjct: 136 attcgtaacatgtctgttattgctcacgtcgatcacggaaaatctacccttaccgattc 194 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Plus Query: 329 gagcgtggtattacaatcaaatccacgggtatctctcttttct 371 |||||| ||||||| |||||||| || | |||||||||||||| Sbjct: 274 gagcgttgtattaccatcaaatctactgctatctctcttttct 316
>gb|M86959.1|CELEFT2A Caenorhabditis elegans elongation factor (eft-2) mRNA, complete cds Length = 2701 Score = 69.9 bits (35), Expect = 8e-09 Identities = 53/59 (89%) Strand = Plus / Plus Query: 191 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 249 |||||||||||||||||||||||||| ||||| ||||| || ||||| ||||| ||||| Sbjct: 85 attcgtaacatgtctgttattgctcacgtcgatcacggaaaatctacccttaccgattc 143 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Plus Query: 329 gagcgtggtattacaatcaaatccacgggtatctctcttttct 371 |||||| ||||||| |||||||| || | |||||||||||||| Sbjct: 223 gagcgttgtattaccatcaaatctactgctatctctcttttct 265
>gb|AY305496.1| Carcinoscorpius rotundicauda voucher Cro elongation factor-2 mRNA, partial cds Length = 1975 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 177 acaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 234 |||||||||| ||||| |||||||||||||| ||||| ||||| |||||||| ||||| Sbjct: 21 acaagaaaaagaatatccgtaacatgtctgtcattgcccatgtagaccacggaaagtc 78
>gb|AF240821.1| Limulus polyphemus elongation factor-2 mRNA, partial cds Length = 1975 Score = 67.9 bits (34), Expect = 3e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 177 acaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 234 |||||||||| || || |||||||||||||||||||| ||||| |||||||| ||||| Sbjct: 21 acaagaaaaaaaacatccgtaacatgtctgttattgcccatgtagaccacggaaagtc 78
>emb|AL122032.1|SPAC513 S.pombe chromosome I cosmid c513 Length = 13204 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 238 |||||||||||||| |||||||| ||||| ||||||||||||||| Sbjct: 133 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 89
>emb|AL121859.1|SPCP31B10 S.pombe chromosome III p1 p31B10 Length = 21649 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 238 |||||||||||||| |||||||| ||||| ||||||||||||||| Sbjct: 12724 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 12768
>ref|NM_001022856.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPCP31B10.07), partial mRNA Length = 2529 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 238 |||||||||||||| |||||||| ||||| ||||||||||||||| Sbjct: 58 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 102
>ref|NM_001019401.1| Schizosaccharomyces pombe 972h- elongation factor 2 (SPAC513.01c), partial mRNA Length = 2529 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 238 |||||||||||||| |||||||| ||||| ||||||||||||||| Sbjct: 58 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 102
>dbj|D83976.1| Schizosaccharomyces pombe DNA for elongation factor 2, complete cds Length = 3276 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 238 |||||||||||||| |||||||| ||||| ||||||||||||||| Sbjct: 268 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 312
>dbj|D83975.1| Schizosaccharomyces pombe DNA for elongation factor 2, complete cds Length = 3222 Score = 65.9 bits (33), Expect = 1e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacg 238 |||||||||||||| |||||||| ||||| ||||||||||||||| Sbjct: 325 cgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 369
>gb|AY305525.1| Trachyiulus nordquisti voucher Tnor elongation factor-2 mRNA, partial cds Length = 2185 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaag 232 ||||||||||| || || || ||||||||||| || || || || ||||| ||||||||| Sbjct: 17 atggacaagaagaagaacatccgtaacatgtccgtgatagcccacgtcgatcacggcaag 76 Query: 233 tctacgcttacggattccct 252 || ||||| ||||||||||| Sbjct: 77 tccacgctgacggattccct 96
>gb|AY064104.1| Aedes aegypti clone EF2Mc2 elongation factor 2 (Ef-2) mRNA, complete cds Length = 2658 Score = 63.9 bits (32), Expect = 5e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 249 ||||||||||| || ||||| || ||||||||||||||||| ||||| |||||||| Sbjct: 115 cgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 170
>gb|AY064103.1| Aedes aegypti clone EF2Rc2 elongation factor 2 (Ef-2) mRNA, complete cds Length = 2658 Score = 63.9 bits (32), Expect = 5e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 249 ||||||||||| || ||||| || ||||||||||||||||| ||||| |||||||| Sbjct: 115 cgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 170
>gb|AY040342.1| Aedes aegypti elongation factor 2 (Ef-2) mRNA, complete cds Length = 2681 Score = 63.9 bits (32), Expect = 5e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 249 ||||||||||| || ||||| || ||||||||||||||||| ||||| |||||||| Sbjct: 138 cgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 193
>gb|AF331798.1|AF331798 Aedes aegypti elongation factor 2 (Ef-2) mRNA, complete cds Length = 2681 Score = 63.9 bits (32), Expect = 5e-07 Identities = 50/56 (89%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattc 249 ||||||||||| || ||||| || ||||||||||||||||| ||||| |||||||| Sbjct: 138 cgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 193
>gb|AY737540.1| Toxoptera citricida putative translation elongation factor 2 mRNA, complete cds Length = 2535 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgt 219 ||||||||||| || |||||||||||||||||||| || |||||||| Sbjct: 37 atggacaagaagaagaatattcgtaacatgtctgtcatcgctcatgt 83
>gb|AY305532.1| Richtersius coronifer voucher Rco elongation factor-2 mRNA, partial cds Length = 2185 Score = 60.0 bits (30), Expect = 7e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 430 cctgatcaaccttattgattcacctggccacgttgacttttc 471 ||||||||||||||||||||| || || |||||||||||||| Sbjct: 289 cctgatcaaccttattgattcgcccggtcacgttgacttttc 330 Score = 54.0 bits (27), Expect = 5e-04 Identities = 51/59 (86%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaa 231 ||||||||||| | ||| || || |||||||| ||||||||||| || ||||||||||| Sbjct: 17 atggacaagaagactaacatccgaaacatgtccgttattgctcacgtggaccacggcaa 75
>gb|AF240826.1| Polyxenus fasciculatus elongation factor-2 mRNA, partial cds Length = 1981 Score = 60.0 bits (30), Expect = 7e-06 Identities = 69/82 (84%) Strand = Plus / Plus Query: 171 ttatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggca 230 ||||||||||||| || |||||||| |||||||| || || || || ||||| ||||||| Sbjct: 15 ttatggacaagaagaagaatattcgaaacatgtccgtaatagcccacgtcgatcacggca 74 Query: 231 agtctacgcttacggattccct 252 | ||||| || ||||| ||||| Sbjct: 75 aatctaccctgacggactccct 96
>gb|AY010232.1| Bonnemaisonia hamifera elongation factor 2 (EF2) gene, partial cds Length = 2319 Score = 60.0 bits (30), Expect = 7e-06 Identities = 64/74 (86%), Gaps = 1/74 (1%) Strand = Plus / Plus Query: 430 cctgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagctgc 488 ||||||||| || ||||| |||||||| |||||||||||||| || || ||||| ||||| Sbjct: 213 cctgatcaatctcattgactcacctggacacgttgacttttcgtccgaggtcactgctgc 272 Query: 489 tcttcgtatcactg 502 |||||| |||||| Sbjct: 273 ccttcgtgtcactg 286
>gb|AC084640.1|CBRG45J08 Caenorhabditis briggsae cosmid G45J08, complete sequence Length = 42710 Score = 60.0 bits (30), Expect = 7e-06 Identities = 55/62 (88%), Gaps = 1/62 (1%) Strand = Plus / Minus Query: 434 atcaaccttattgattcacctggccacgttgacttttcttcgg-agtcacagctgctctt 492 |||||| | |||||||| ||||||||||||||||| || |||| |||||| ||||||||| Sbjct: 8749 atcaacttgattgattctcctggccacgttgacttctcctcggaagtcaccgctgctctt 8690 Query: 493 cg 494 || Sbjct: 8689 cg 8688 Score = 46.1 bits (23), Expect = 0.11 Identities = 50/59 (84%) Strand = Plus / Minus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgt 255 ||||||||||| || ||||||||||| ||||| ||||| || || || ||||| ||||| Sbjct: 9064 aacatgtctgtcatcgctcatgtcgatcacggaaagtccaccctcaccgattctcttgt 9006
>gb|M68064.1|CHLEF2 Chlorella kessleri elongation factor 2 mRNA, complete cds Length = 2931 Score = 60.0 bits (30), Expect = 7e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccctt 253 ||||||||||| || ||||| ||||| ||||||||||||||||| || || || ||||| Sbjct: 157 cgtaacatgtccgtgattgcccatgtggaccacggcaagtctaccctcaccgactccctg 216 Query: 254 gtggcagctgctgg 267 ||||| || ||||| Sbjct: 217 gtggcggccgctgg 230
>ref|XM_792306.1| PREDICTED: Strongylocentrotus purpuratus similar to eukaryotic translation elongation factor 2, like (LOC592801), mRNA Length = 3748 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctac 237 ||||||||||| || |||||||||||||| ||||||||||| Sbjct: 190 aacatgtctgtcatcgctcatgtcgaccatggcaagtctac 230 Score = 42.1 bits (21), Expect = 1.7 Identities = 52/61 (85%), Gaps = 1/61 (1%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgacttttcttcgga-gtcacagctgctc 490 |||||||||| || ||||| || ||||| ||||||||||| || || || |||||||||| Sbjct: 431 tgatcaacctcatcgattccccaggccatgttgacttttcgtctgaggtgacagctgctc 490 Query: 491 t 491 | Sbjct: 491 t 491
>gb|AY613900.1| Mesenchytraeus solifugus clone A195 translation elongation factor 2-like mRNA, partial sequence Length = 935 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 191 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 234 ||||||||||||| ||| || ||||||||||||||||| ||||| Sbjct: 116 attcgtaacatgtgtgtcatcgctcatgtcgaccacggaaagtc 159
>gb|AC150552.1| Drosophila melanogaster clone BACR12I17, complete sequence Length = 174573 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||| || || |||||||||||||| || || || |||||||||||| Sbjct: 117638 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 117579
>ref|XM_389750.1| Gibberella zeae PH-1 chromosome 4 EF2_NEUCR Elongation factor 2 (EF-2) (Colonial temperature-sensitive 3) (FG09574.1) partial mRNA Length = 2499 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 237 ||||||||||| |||||||| || ||||| |||||||||||||| Sbjct: 22 cgtaacatgtccgttattgcccacgtcgatcacggcaagtctac 65
>gb|AY305522.1| Skogsbergia lerneri voucher Skle elongation factor-2 mRNA, partial cds Length = 2107 Score = 56.0 bits (28), Expect = 1e-04 Identities = 56/64 (87%), Gaps = 1/64 (1%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgacttttcttc-ggagtcacagctgctc 490 |||||||||| || ||||||||||| ||||||||||| ||||| | ||||||||| || | Sbjct: 216 tgatcaacctgatcgattcacctggtcacgttgacttctcttctgaagtcacagcagccc 275 Query: 491 ttcg 494 |||| Sbjct: 276 ttcg 279
>gb|AY310265.1| Phryssonotus sp. 'jump' elongation factor 2 mRNA, partial cds Length = 2185 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgacttttc 471 |||||||||| || ||||| |||||||||||||||||||| Sbjct: 288 tgatcaacctgatcgattcccctggccacgttgacttttc 327
>emb|X15805.1|DMEF2 Drosophila DMEF2 gene for the translation elongation factor 2 Length = 2821 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||| || || |||||||||||||| || || || |||||||||||| Sbjct: 133 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 192
>gb|AF240835.1| Peripatus sp. 'Per2' elongation factor-2 mRNA, partial cds Length = 2182 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 443 attgattcacctggccacgttgacttttcttc 474 |||||||||||||||||||| ||||||||||| Sbjct: 299 attgattcacctggccacgtagacttttcttc 330 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgc 213 |||||||||||| | ||||| |||||||||||||| ||||| Sbjct: 17 atggacaagaaacagaatatccgtaacatgtctgtgattgc 57
>ref|NM_165395.1| Drosophila melanogaster Elongation factor 2b CG2238-RC, transcript variant C (Ef2b), mRNA Length = 2768 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||| || || |||||||||||||| || || || |||||||||||| Sbjct: 80 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 139
>ref|NM_165394.1| Drosophila melanogaster Elongation factor 2b CG2238-RB, transcript variant B (Ef2b), mRNA Length = 2794 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||| || || |||||||||||||| || || || |||||||||||| Sbjct: 106 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 165
>ref|NM_080366.2| Drosophila melanogaster Elongation factor 2b CG2238-RA, transcript variant A (Ef2b), mRNA Length = 2858 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||| || || |||||||||||||| || || || |||||||||||| Sbjct: 170 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 229
>gb|AY075481.1| Drosophila melanogaster RE38659 full length cDNA Length = 2823 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||| || || |||||||||||||| || || || |||||||||||| Sbjct: 172 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 231
>gb|AC009254.8| Drosophila melanogaster, chromosome 2L, region 40A-40C, BAC clone BACR42E05, complete sequence Length = 175179 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||| || || |||||||||||||| || || || |||||||||||| Sbjct: 67131 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 67072
>gb|AE003781.5| Drosophila melanogaster chromosome 2L, section 80 of 83 of the complete sequence Length = 323775 Score = 56.0 bits (28), Expect = 1e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||||||| ||||| || || |||||||||||||| || || || |||||||||||| Sbjct: 138578 aacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcccttgtg 138519
>gb|AY305509.1| Lynceus sp. JCR-2003 elongation factor-2 mRNA, partial cds Length = 2179 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgt 219 ||||||||||| || || |||||||||||||| || ||||||||||| Sbjct: 17 atggacaagaagaagaacattcgtaacatgtccgtcattgctcatgt 63 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 443 attgattcacctggccacgttgacttttc 471 |||||||| ||||| |||||||||||||| Sbjct: 299 attgattctcctggacacgttgacttttc 327
>gb|AY305494.1| Ctenolepisma lineata voucher Cli elongation factor-2 mRNA, partial cds Length = 2179 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 188 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 234 ||||| || |||||||| || ||||||||||||||||| |||||||| Sbjct: 32 aatatccgcaacatgtccgtcattgctcatgtcgaccatggcaagtc 78
>dbj|AK187829.1| Mus musculus cDNA, clone:Y0G0143C24, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 54.0 bits (27), Expect = 5e-04 Identities = 54/63 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63 Query: 257 gca 259 ||| Sbjct: 64 gca 66
>gb|AY310280.1| Platydesmus sp. 'Pla' elongation factor 2 mRNA, partial cds Length = 2185 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcga 222 ||||||||||| || || || ||||||||||| || |||||||||||||| Sbjct: 17 atggacaagaagaagaacatccgtaacatgtccgtcattgctcatgtcga 66
>gb|AF240834.1| Nereis virens elongation factor-2 mRNA, partial cds Length = 1969 Score = 52.0 bits (26), Expect = 0.002 Identities = 71/86 (82%) Strand = Plus / Plus Query: 170 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 229 ||||||||| |||||| || || |||||||||||||| || ||||| || || |||||| Sbjct: 14 attatggaccggaaaaagaacatccgtaacatgtctgtgatcgctcacgttgatcacggc 73 Query: 230 aagtctacgcttacggattcccttgt 255 || ||||| || || || |||||||| Sbjct: 74 aaatctacactgactgactcccttgt 99
>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI, complete sequence Length = 1813164 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttac 243 ||||||||||| || ||||| || ||||||||||| ||||| |||||||| Sbjct: 697928 cgtaacatgtccgtgattgcgcacgtcgaccacggtaagtcgacgcttac 697879
>gb|AY144923.1| Saccharomyces castellii clone Contig2043 EFT gene, complete cds Length = 2529 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 192 ttcgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 237 ||||||||||||| ||||||||||| ||||| || || |||||||| Sbjct: 56 ttcgtaacatgtccgttattgctcacgtcgatcatggtaagtctac 101
>dbj|AK110167.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-F12, full insert sequence Length = 2770 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtc 234 |||||||| |||||||| || ||||||||||||||||| Sbjct: 127 aacatgtcggttattgcccacgtcgaccacggcaagtc 164
>ref|NM_211043.1| Eremothecium gossypii AFR142Cp (AFR142C), mRNA Length = 2529 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttac 243 ||||||||||| || ||||| || ||||||||||| ||||| |||||||| Sbjct: 58 cgtaacatgtccgtgattgcgcacgtcgaccacggtaagtcgacgcttac 107
>ref|XM_970542.1| PREDICTED: Tribolium castaneum similar to Elongation factor 2 (EF-2) (LOC664546), mRNA Length = 2927 Score = 50.1 bits (25), Expect = 0.007 Identities = 58/69 (84%) Strand = Plus / Plus Query: 188 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggat 247 ||||| ||||||||||| || |||||||| || ||||||||||| || || || || || Sbjct: 120 aatatccgtaacatgtccgtcattgctcacgtggaccacggcaaatcaactctgaccgac 179 Query: 248 tcccttgtg 256 ||||||||| Sbjct: 180 tcccttgtg 188
>gb|AF240816.1| Armadillidium vulgare elongation factor-2 mRNA, partial cds Length = 2179 Score = 50.1 bits (25), Expect = 0.007 Identities = 37/41 (90%) Strand = Plus / Plus Query: 188 aatattcgtaacatgtctgttattgctcatgtcgaccacgg 228 ||||||||||| ||||| || ||||||||||| |||||||| Sbjct: 32 aatattcgtaatatgtccgtcattgctcatgtagaccacgg 72
>ref|XM_631629.1| Dictyostelium discoideum AX4 elongation factor 2 (DDB0191363), partial mRNA Length = 2520 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 200 atgtctgttattgctcatgtcgaccacgg 228 ||||||||||||||||||||||| ||||| Sbjct: 64 atgtctgttattgctcatgtcgatcacgg 92
>dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0022F10 Length = 150498 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 131 gccaaaatggtgaagtttaccgcggaggagctccgcg 167 ||||| ||||||| |||||| |||||||||||||||| Sbjct: 44740 gccaagatggtgaggtttacggcggaggagctccgcg 44704
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Minus Query: 131 gccaaaatggtgaagtttaccgcggaggagctccgcg 167 ||||| ||||||| |||||| |||||||||||||||| Sbjct: 135908 gccaagatggtgaggtttacggcggaggagctccgcg 135872
>dbj|AK215787.1| Mus musculus cDNA, clone:Y2G0136D03, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 389 Score = 50.1 bits (25), Expect = 0.007 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgantcccttgtg 63
>dbj|AK110168.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-G01, full insert sequence Length = 2997 Score = 50.1 bits (25), Expect = 0.007 Identities = 55/65 (84%) Strand = Plus / Plus Query: 188 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggat 247 ||||| |||||||||| ||||||||||| ||||| ||||| ||||| || ||||| || Sbjct: 211 aatatccgtaacatgttcgttattgctcacgtcgatcacggaaagtccacccttaccgac 270 Query: 248 tccct 252 ||||| Sbjct: 271 tccct 275
>dbj|AK102586.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033098E24, full insert sequence Length = 2849 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 131 gccaaaatggtgaagtttaccgcggaggagctccgcg 167 ||||| ||||||| |||||| |||||||||||||||| Sbjct: 63 gccaagatggtgaggtttacggcggaggagctccgcg 99
>dbj|AK073592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048F11, full insert sequence Length = 2865 Score = 50.1 bits (25), Expect = 0.007 Identities = 34/37 (91%) Strand = Plus / Plus Query: 131 gccaaaatggtgaagtttaccgcggaggagctccgcg 167 ||||| ||||||| |||||| |||||||||||||||| Sbjct: 63 gccaagatggtgaggtttacggcggaggagctccgcg 99
>gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome Length = 1767403 Score = 50.1 bits (25), Expect = 0.007 Identities = 40/45 (88%) Strand = Plus / Minus Query: 425 gaatacctgatcaaccttattgattcacctggccacgttgacttt 469 |||||||| ||||||||||||||| |||| || ||||| |||||| Sbjct: 1539113 gaataccttatcaaccttattgatacaccaggacacgtagacttt 1539069
>gb|M26017.1|DDIEF2 D.discoideum elongation factor 2 mRNA, complete cds Length = 2755 Score = 50.1 bits (25), Expect = 0.007 Identities = 28/29 (96%) Strand = Plus / Plus Query: 200 atgtctgttattgctcatgtcgaccacgg 228 ||||||||||||||||||||||| ||||| Sbjct: 292 atgtctgttattgctcatgtcgatcacgg 320
>gb|AY391422.1| Danio rerio eukaryotic translation elongation factor 2 (EEF2) mRNA, complete cds Length = 2826 Score = 48.1 bits (24), Expect = 0.028 Identities = 46/52 (88%), Gaps = 1/52 (1%) Strand = Plus / Plus Query: 452 cctggccacgttgacttttcttcggag-tcacagctgctcttcgtatcactg 502 ||||||||||| |||||||| || ||| ||||||||||||| ||| |||||| Sbjct: 370 cctggccacgtggacttttcctccgaggtcacagctgctctgcgtgtcactg 421
>ref|XM_363816.1| Magnaporthe grisea 70-15 hypothetical protein (MG01742.4) partial mRNA Length = 2610 Score = 48.1 bits (24), Expect = 0.028 Identities = 48/56 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 252 |||||||| || ||||| || ||||||||||||||||| || || || |||||||| Sbjct: 40 aacatgtccgtcattgcccacgtcgaccacggcaagtcgaccctcaccgattccct 95
>gb|BC045488.1| Danio rerio eukaryotic translation elongation factor 2, like, mRNA (cDNA clone MGC:55904 IMAGE:3818891), complete cds Length = 2855 Score = 48.1 bits (24), Expect = 0.028 Identities = 46/52 (88%), Gaps = 1/52 (1%) Strand = Plus / Plus Query: 452 cctggccacgttgacttttcttcggag-tcacagctgctcttcgtatcactg 502 ||||||||||| |||||||| || ||| ||||||||||||| ||| |||||| Sbjct: 401 cctggccacgtggacttttcctccgaggtcacagctgctctgcgtgtcactg 452
>gb|BC007152.1| Mus musculus eukaryotic translation elongation factor 2, mRNA (cDNA clone MGC:6761 IMAGE:3600352), complete cds Length = 3111 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200
>ref|XM_454080.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E02926g predicted mRNA Length = 2529 Score = 48.1 bits (24), Expect = 0.028 Identities = 39/44 (88%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 237 ||||||||||| |||||||| || ||||| ||||| |||||||| Sbjct: 58 cgtaacatgtccgttattgcccacgtcgatcacggtaagtctac 101
>gb|AC159225.4| Mus musculus chromosome 1, clone RP24-306F17, complete sequence Length = 168805 Score = 48.1 bits (24), Expect = 0.028 Identities = 36/40 (90%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtcta 236 |||||||| || ||||||||||| ||||| |||||||||| Sbjct: 82970 aacatgtcagtcattgctcatgtggaccatggcaagtcta 83009
>ref|XR_003342.1| PREDICTED: Mus musculus similar to Elongation factor 2 (EF-2) (LOC435640), mRNA Length = 2545 Score = 48.1 bits (24), Expect = 0.028 Identities = 36/40 (90%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtcta 236 |||||||| || ||||||||||| ||||| |||||||||| Sbjct: 173 aacatgtcagtcattgctcatgtggaccatggcaagtcta 212
>ref|XM_444908.1| Candida glabrata CBS138 hypothetical protein (CAGL0A03234g) partial mRNA Length = 2529 Score = 48.1 bits (24), Expect = 0.028 Identities = 39/44 (88%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 237 ||||||||||| || ||||| |||||||| ||||| |||||||| Sbjct: 58 cgtaacatgtccgtcattgcccatgtcgatcacggtaagtctac 101
>gb|BC060707.1| Mus musculus eukaryotic translation elongation factor 2, mRNA (cDNA clone IMAGE:6810450), partial cds Length = 2972 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 18 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 77
>gb|AC102568.8| Mus musculus chromosome 1, clone RP23-224O10, complete sequence Length = 239053 Score = 48.1 bits (24), Expect = 0.028 Identities = 36/40 (90%) Strand = Plus / Minus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtcta 236 |||||||| || ||||||||||| ||||| |||||||||| Sbjct: 21935 aacatgtcagtcattgctcatgtggaccatggcaagtcta 21896
>gb|AY305531.1| Ooperipatellus nanus voucher Ona elongation factor-2 mRNA, partial cds Length = 1978 Score = 48.1 bits (24), Expect = 0.028 Identities = 61/72 (84%), Gaps = 1/72 (1%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgacttttcttc-ggagtcacagctgctc 490 ||||||| || |||||||| ||||||||||| || |||||||| | ||| || ||||||| Sbjct: 288 tgatcaatctcattgattctcctggccacgtagatttttcttcagaagttactgctgctc 347 Query: 491 ttcgtatcactg 502 | ||| |||||| Sbjct: 348 tccgtgtcactg 359
>gb|AY310270.1| Nemasoma varicorne voucher Nva elongation factor 2 mRNA, partial cds Length = 643 Score = 48.1 bits (24), Expect = 0.028 Identities = 48/56 (85%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacgg 228 ||||||||||| || || ||||| ||||||||||| ||||| ||||| || ||||| Sbjct: 17 atggacaagaagaagaacattcgcaacatgtctgtgattgcccatgtggatcacgg 72
>gb|AY310258.1| Glomeridesmus trinidadensis voucher Gtri elongation factor 2 mRNA, partial cds Length = 2185 Score = 48.1 bits (24), Expect = 0.028 Identities = 36/40 (90%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgacttttc 471 ||||||| ||||||||||| |||||||| ||||| ||||| Sbjct: 288 tgatcaatcttattgattcccctggccatgttgatttttc 327
>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140 of Kluyveromyces lactis Length = 2234072 Score = 48.1 bits (24), Expect = 0.028 Identities = 39/44 (88%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 237 ||||||||||| |||||||| || ||||| ||||| |||||||| Sbjct: 274152 cgtaacatgtccgttattgcccacgtcgatcacggtaagtctac 274195
>emb|CR380947.1| Candida glabrata strain CBS138 chromosome A complete sequence Length = 485192 Score = 48.1 bits (24), Expect = 0.028 Identities = 39/44 (88%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 237 ||||||||||| || ||||| |||||||| ||||| |||||||| Sbjct: 323942 cgtaacatgtccgtcattgcccatgtcgatcacggtaagtctac 323985
>gb|AC155932.6| Mus musculus BAC clone RP23-85K13 from chromosome 10, complete sequence Length = 239525 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 137328 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 137387
>gb|BC063965.1| Danio rerio eukaryotic translation elongation factor 2, like, mRNA (cDNA clone MGC:77674 IMAGE:6997283), complete cds Length = 2850 Score = 48.1 bits (24), Expect = 0.028 Identities = 46/52 (88%), Gaps = 1/52 (1%) Strand = Plus / Plus Query: 452 cctggccacgttgacttttcttcggag-tcacagctgctcttcgtatcactg 502 ||||||||||| |||||||| || ||| ||||||||||||| ||| |||||| Sbjct: 381 cctggccacgtggacttttcctccgaggtcacagctgctctgcgtgtcactg 432
>emb|CR318632.9| Zebrafish DNA sequence from clone CH211-113N10 in linkage group 5, complete sequence Length = 143278 Score = 48.1 bits (24), Expect = 0.028 Identities = 48/56 (85%) Strand = Plus / Minus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 252 ||||||||||| ||||| ||||| ||||||||||| || || || || |||||||| Sbjct: 107527 aacatgtctgtgattgcccatgtggaccacggcaaatccactctcaccgattccct 107472
>dbj|AK128976.1| Mus musculus cDNA fis, clone TRACH3016277, highly similar to Elongation factor 2 Length = 3073 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 142 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 201
>dbj|AK145545.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0013E23 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK145509.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0008O17 product:eukaryotic translation elongation factor 2, full insert sequence Length = 2932 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK134195.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830470E07 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK151945.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830043K06 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK153936.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430007P07 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3073 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK151812.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830038A06 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3022 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 93 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 152
>dbj|AK150902.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830018A09 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK146947.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920078K07 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK144874.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730046C15 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3074 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 145 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 204
>dbj|AK159421.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420019L24 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3084 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK149659.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:G530008F18 product:eukaryotic translation elongation factor 2, full insert sequence Length = 2475 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK152826.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830086O05 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK159155.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420005L02 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3073 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK146508.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920016H22 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3074 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK152587.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830080H09 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK152447.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830072H23 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK151487.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830030N18 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK166815.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0015D24 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3073 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK166788.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0013F05 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3074 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK166758.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0009D22 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3073 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK166751.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0008M05 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3070 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200
>dbj|AK166747.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0008K21 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK166719.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0007E11 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3074 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK155325.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630220G13 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK152146.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830050C12 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK150136.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:G530135N13 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3075 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK168874.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920062C16 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3065 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 136 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 195
>dbj|AK168827.1| Mus musculus cDNA, RIKEN full-length enriched library, clone:I920058H11 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK168794.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched library, clone:I920055J08 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK168659.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920042H11 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3073 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK168638.1| Mus musculus 16 days embryo heart cDNA, RIKEN full-length enriched library, clone:I920040J20 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3074 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK168615.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920038K05 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3073 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK166596.1| Mus musculus morula whole body morula cDNA, RIKEN full-length enriched library, clone:I0C0032K22 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3075 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK166595.1| Mus musculus morula whole body morula cDNA, RIKEN full-length enriched library, clone:I0C0032K13 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK153275.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830134C02 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK163063.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430110F17 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK159829.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420032E20 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK159806.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420031K23 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK168527.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920029L03 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3069 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK167281.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0050C01 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 142 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 201
>dbj|AK167230.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0043E10 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>ref|XM_692874.1| PREDICTED: Danio rerio wu:fj53d02 (wu:fj53d02), mRNA Length = 3323 Score = 48.1 bits (24), Expect = 0.028 Identities = 48/56 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattccct 252 ||||||||||| ||||| ||||| ||||||||||| || || || || |||||||| Sbjct: 155 aacatgtctgtgattgcccatgtggaccacggcaaatccactctcaccgattccct 210
>dbj|AK159514.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420022I05 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK167199.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0038L22 product:eukaryotic translation elongation factor 2, full insert sequence Length = 2931 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK167221.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0041O03 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK167208.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0040H15 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3070 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200
>dbj|AK167115.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0031N20 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3079 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK167109.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0031H23 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK167093.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0030K01 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK167081.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0029P06 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3073 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK166212.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN full-length enriched library, clone:G830016F02 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK166968.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0025N20 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtcaacgctgaccgactcccttgtg 202
>dbj|AK166851.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0017E19 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3070 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200
>dbj|AK166829.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0015K24 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3073 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK169013.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched library, clone:I920074H24 product:eukaryotic translation elongation factor 2, full insert sequence Length = 3082 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK032997.1| Mus musculus 12 days embryo male wolffian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6720487K10 product:ELONGATION FACTOR 2 (EF-2) homolog [Mus musculus], full insert sequence Length = 3072 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK077866.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN full-length enriched library, clone:5930429P17 product:ELONGATION FACTOR 2 (EF-2) homolog [Rattus norvegicus], full insert sequence Length = 3074 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK040474.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430101N03 product:ELONGATION FACTOR 2 (EF-2) homolog [Rattus norvegicus], full insert sequence Length = 3074 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK087985.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430001M15 product:ELONGATION FACTOR 2 (EF-2) homolog [Rattus norvegicus], full insert sequence Length = 3068 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 143 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 202
>dbj|AK028938.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched library, clone:4732472F11 product:ELONGATION FACTOR 2 (EF-2) homolog [Mus musculus], full insert sequence Length = 3065 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 136 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 195
>gb|BC090153.1| Xenopus laevis cDNA clone MGC:98463 IMAGE:7198247, complete cds Length = 3035 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 78 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 137
>ref|NM_200458.2| Danio rerio eukaryotic translation elongation factor 2, like (eef2l), mRNA Length = 2826 Score = 48.1 bits (24), Expect = 0.028 Identities = 46/52 (88%), Gaps = 1/52 (1%) Strand = Plus / Plus Query: 452 cctggccacgttgacttttcttcggag-tcacagctgctcttcgtatcactg 502 ||||||||||| |||||||| || ||| ||||||||||||| ||| |||||| Sbjct: 370 cctggccacgtggacttttcctccgaggtcacagctgctctgcgtgtcactg 421
>gb|AF107287.1|AF107287 Candida glabrata elongation factor 2 (EFT2) gene, partial cds Length = 2444 Score = 48.1 bits (24), Expect = 0.028 Identities = 39/44 (88%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 237 ||||||||||| || ||||| |||||||| ||||| |||||||| Sbjct: 16 cgtaacatgtccgtcattgcccatgtcgatcacggtaagtctac 59
>dbj|AK214266.1| Mus musculus cDNA, clone:Y2G0131D22, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 395 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 68 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 127
>dbj|AK213305.1| Mus musculus cDNA, clone:Y2G0127O13, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 159 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK211536.1| Mus musculus cDNA, clone:Y2G0122B11, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK212666.1| Mus musculus cDNA, clone:Y2G0125L14, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 336 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK211738.1| Mus musculus cDNA, clone:Y2G0122L09, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 402 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK209955.1| Mus musculus cDNA, clone:Y2G0116N17, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 81 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK204992.1| Mus musculus cDNA, clone:Y1G0150E22, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK202382.1| Mus musculus cDNA, clone:Y1G0141F10, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 227 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 68 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 127
>dbj|AK197271.1| Mus musculus cDNA, clone:Y1G0124J03, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 164 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK195329.1| Mus musculus cDNA, clone:Y1G0118C13, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK194702.1| Mus musculus cDNA, clone:Y1G0116D02, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK193129.1| Mus musculus cDNA, clone:Y1G0111C16, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 227 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 68 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 127
>dbj|AK193057.1| Mus musculus cDNA, clone:Y1G0110N20, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 385 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK185714.1| Mus musculus cDNA, clone:Y0G0134P20, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK181093.1| Mus musculus cDNA, clone:Y0G0116O15, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 142 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK179508.1| Mus musculus cDNA, clone:Y0G0110K21, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK178103.1| Mus musculus cDNA, clone:Y0G0105G24, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 227 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 68 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 127
>dbj|AK177405.1| Mus musculus cDNA, clone:Y0G0102K05, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK177249.1| Mus musculus cDNA, clone:Y0G0102C15, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 4 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>gb|U89415.1|MMU89415 Mus musculus strain BALB/c elongation factor 2 mRNA, partial cds Length = 779 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 38 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 97
>gb|BC013263.1| Mus musculus eukaryotic translation elongation factor 2, mRNA (cDNA clone IMAGE:3595704) Length = 3097 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 129 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 188
>ref|NM_007907.1| Mus musculus eukaryotic translation elongation factor 2 (Eef2), mRNA Length = 3111 Score = 48.1 bits (24), Expect = 0.028 Identities = 51/60 (85%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 |||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 141 aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 200
>dbj|AB082376.1| Pisum sativum mRNA for elongation factor EF-2, partial cds Length = 1480 Score = 48.1 bits (24), Expect = 0.028 Identities = 33/36 (91%) Strand = Plus / Plus Query: 443 attgattcacctggccacgttgacttttcttcggag 478 |||||||| ||||| |||||||||||||| |||||| Sbjct: 107 attgattcccctgggcacgttgacttttcatcggag 142
>gb|AF534908.2| Tetrahymena thermophila elongation factor 2 gene, complete cds Length = 2609 Score = 46.1 bits (23), Expect = 0.11 Identities = 53/63 (84%) Strand = Plus / Plus Query: 188 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggat 247 ||||| ||||| ||||| ||||||||||| ||||| ||||| || || || ||||| ||| Sbjct: 52 aatatccgtaatatgtcagttattgctcacgtcgatcacggtaaatccacccttaccgat 111 Query: 248 tcc 250 ||| Sbjct: 112 tcc 114
>ref|NM_191821.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2562 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 137 atggtgaagtttaccgcggaggagctccgcg 167 ||||||| |||||| |||||||||||||||| Sbjct: 1 atggtgaggtttacggcggaggagctccgcg 31
>gb|BC044327.1| Xenopus laevis eukaryotic translation elongation factor 2, mRNA (cDNA clone MGC:53560 IMAGE:4681560), complete cds Length = 2946 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Plus Query: 191 attcgtaacatgtctgttattgctcatgtcgaccacggcaagtctac 237 |||||||| ||||| || ||||| ||||| ||||||||||| ||||| Sbjct: 117 attcgtaatatgtcggtcattgcccatgtggaccacggcaaatctac 163
>gb|AC140034.14| Medicago truncatula clone mth2-17g19, complete sequence Length = 83825 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 209 attgctcatgtcgaccacggcaa 231 ||||||||||||||||||||||| Sbjct: 67069 attgctcatgtcgaccacggcaa 67091
>gb|AY305517.1| Periplaneta americana voucher Pam elongation factor-2 mRNA, partial cds Length = 2179 Score = 46.1 bits (23), Expect = 0.11 Identities = 41/47 (87%) Strand = Plus / Plus Query: 188 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtc 234 ||||| ||||| |||||||| || || |||||||| ||||||||||| Sbjct: 32 aatatccgtaatatgtctgtgatcgcccatgtcgatcacggcaagtc 78
>gb|AY305488.1| Abacion magnum voucher Ama2 elongation factor-2 mRNA, partial cds Length = 2185 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 443 attgattcacctggccacgttgacttttcttcgga 477 ||||||||||| |||||||| ||||| |||||||| Sbjct: 299 attgattcaccaggccacgtcgacttctcttcgga 333 Score = 40.1 bits (20), Expect = 6.8 Identities = 47/56 (83%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacgg 228 ||||||||||| || || || ||||| ||||| |||||||| ||||| || ||||| Sbjct: 17 atggacaagaagaagaacatccgtaatatgtccgttattgcccatgttgatcacgg 72
>gb|AY310291.1| Stemmiulus insulanus voucher Stem elongation factor 2 mRNA, partial cds Length = 2185 Score = 46.1 bits (23), Expect = 0.11 Identities = 38/43 (88%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgacttttcttc 474 |||||||| | |||||||| || ||||||||||| |||||||| Sbjct: 288 tgatcaacttgattgattcgccgggccacgttgatttttcttc 330
>ref|XM_691803.1| PREDICTED: Danio rerio similar to eukaryotic translation elongation factor 2 (LOC568472), mRNA Length = 2373 Score = 46.1 bits (23), Expect = 0.11 Identities = 57/67 (85%), Gaps = 1/67 (1%) Strand = Plus / Plus Query: 435 tcaaccttattgattcacctggccacgttgacttttcttc-ggagtcacagctgctcttc 493 ||||||| ||||| || ||||| || |||||||||||||| | ||| |||||||| || | Sbjct: 107 tcaacctgattgactcccctgggcatgttgacttttcttcagaagttacagctgcactgc 166 Query: 494 gtatcac 500 ||||||| Sbjct: 167 gtatcac 173
>gb|DQ295234.1| Spironucleus barkhanus translation elongation factor 2 (EF-2) mRNA, partial cds Length = 2529 Score = 46.1 bits (23), Expect = 0.11 Identities = 62/75 (82%) Strand = Plus / Plus Query: 200 atgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtggca 259 |||||||||||||| ||||| || || || ||||| || ||||| ||||| ||| | || Sbjct: 38 atgtctgttattgcacatgtagatcatggtaagtcaactcttactgattctcttatcgcc 97 Query: 260 gctgctgggattatc 274 |||||||| |||||| Sbjct: 98 gctgctggtattatc 112 Score = 40.1 bits (20), Expect = 6.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttga 465 ||||| ||||||||||| ||||| |||||||| Sbjct: 257 atcaatcttattgattcccctgggcacgttga 288
>gb|AY144924.1| Saccharomyces castellii clone Contig1523 EFT gene, complete cds Length = 1368 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 192 ttcgtaacatgtctgttattgctcatgtcga 222 ||||||||||||| ||||||||||| ||||| Sbjct: 56 ttcgtaacatgtccgttattgctcacgtcga 86
>dbj|AK184688.1| Mus musculus cDNA, clone:Y0G0131C21, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 46.1 bits (23), Expect = 0.11 Identities = 50/59 (84%) Strand = Plus / Plus Query: 198 acatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||||| || || || ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 5 acatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>emb|BX293565.25| Zebrafish DNA sequence from clone DKEY-268M13 in linkage group 22, complete sequence Length = 160930 Score = 46.1 bits (23), Expect = 0.11 Identities = 57/67 (85%), Gaps = 1/67 (1%) Strand = Plus / Plus Query: 435 tcaaccttattgattcacctggccacgttgacttttcttc-ggagtcacagctgctcttc 493 ||||||| ||||| || ||||| || |||||||||||||| | ||| |||||||| || | Sbjct: 5251 tcaacctgattgactcccctgggcatgttgacttttcttcagaagttacagctgcactgc 5310 Query: 494 gtatcac 500 ||||||| Sbjct: 5311 gtatcac 5317
>emb|BX005203.7| Zebrafish DNA sequence from clone DKEY-110C1 in linkage group 22, complete sequence Length = 214843 Score = 46.1 bits (23), Expect = 0.11 Identities = 57/67 (85%), Gaps = 1/67 (1%) Strand = Plus / Minus Query: 435 tcaaccttattgattcacctggccacgttgacttttcttc-ggagtcacagctgctcttc 493 ||||||| ||||| || ||||| || |||||||||||||| | ||| |||||||| || | Sbjct: 161058 tcaacctgattgactcccctgggcatgttgacttttcttcagaagttacagctgcactgc 160999 Query: 494 gtatcac 500 ||||||| Sbjct: 160998 gtatcac 160992
>gb|U17362.1|CGU17362 Cricetulus griseus elongation factor 2 (EF2) mRNA, complete cds Length = 2629 Score = 46.1 bits (23), Expect = 0.11 Identities = 68/83 (81%) Strand = Plus / Plus Query: 170 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 229 ||||||||||||||| || || || |||||||| || || ||||| || ||||||||| Sbjct: 53 attatggacaagaaagccaacatccggaacatgtcagtcatcgctcacgtggaccacggc 112 Query: 230 aagtctacgcttacggattccct 252 ||||| || || ||||| ||||| Sbjct: 113 aagtccacactgacggactccct 135
>gb|M13708.1|CRUEF2 Hamster elongation factor 2 mRNA, complete cds Length = 2933 Score = 46.1 bits (23), Expect = 0.11 Identities = 68/83 (81%) Strand = Plus / Plus Query: 170 attatggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggc 229 ||||||||||||||| || || || |||||||| || || ||||| || ||||||||| Sbjct: 111 attatggacaagaaagccaacatccggaacatgtcagtcatcgctcacgtggaccacggc 170 Query: 230 aagtctacgcttacggattccct 252 ||||| || || ||||| ||||| Sbjct: 171 aagtccacactgacggactccct 193
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome Length = 3997420 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 209 attgctcatgtcgaccacggcaagtc 234 ||||||||| |||||||||||||||| Sbjct: 1980600 attgctcatatcgaccacggcaagtc 1980625 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 441 ttattgattcacctggccacgttgacttt 469 |||||||| | |||||||||||||||||| Sbjct: 696903 ttattgatacgcctggccacgttgacttt 696931
>gb|AY078407.1| Spodoptera exigua translation elongation factor 2 mRNA, complete cds Length = 2983 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtc 234 |||||||| || || ||||| ||||||||||||||||| Sbjct: 183 aacatgtccgtcatcgctcacgtcgaccacggcaagtc 220 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||| |||||||| || |||||||| ||||||||||| Sbjct: 430 tgattaaccttatcgactcacctgggcacgttgactt 466
>ref|XM_765828.1| Giardia lamblia ATCC 50803 elongation factor 2 (GLP_608_18578_21274) partial mRNA Length = 2697 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtc 234 |||||||| || |||||||||||||| ||||| ||||| Sbjct: 61 aacatgtcggtcattgctcatgtcgatcacggaaagtc 98
>ref|XM_720710.1| Plasmodium yoelii yoelii str. 17XNL elongation factor 2 (PY05356) partial mRNA Length = 2499 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttc 471 |||||| | ||||||||||| || |||||||||||||| Sbjct: 280 atcaacttaattgattcaccaggacacgttgacttttc 317 Score = 40.1 bits (20), Expect = 6.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacgg 228 |||||||| ||||| || |||||||||||||| Sbjct: 61 aacatgtccgttatagcacatgtcgaccacgg 92
>ref|XM_736543.1| Plasmodium chabaudi chabaudi elongation factor 2 (PC000371.03.0) partial mRNA Length = 1116 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttc 471 |||||| | ||||||||||| || |||||||||||||| Sbjct: 280 atcaacttaattgattcaccaggacacgttgacttttc 317 Score = 40.1 bits (20), Expect = 6.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacgg 228 |||||||| ||||| || |||||||||||||| Sbjct: 61 aacatgtccgttatagcacatgtcgaccacgg 92
>ref|XM_673005.1| Plasmodium berghei strain ANKA elongation factor 2 (PB000800.00.0) partial mRNA Length = 2499 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttc 471 |||||| | ||||||||||| || |||||||||||||| Sbjct: 280 atcaacttaattgattcaccagggcacgttgacttttc 317 Score = 40.1 bits (20), Expect = 6.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacgg 228 |||||||| ||||| || |||||||||||||| Sbjct: 61 aacatgtccgttatagcacatgtcgaccacgg 92
>ref|XM_662910.1| Cryptosporidium hominis TU502 elongation factor 2 (EF-2) (Chro.80341) partial mRNA Length = 2499 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaa 231 ||||| ||||||||||||||||| ||||| || ||||| Sbjct: 58 cgtaatatgtctgttattgctcacgtcgatcatggcaa 95 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttcttc 474 |||||| | ||||||||||| || ||||| ||||||||||| Sbjct: 280 atcaacttaattgattcaccggggcacgtagacttttcttc 320
>gb|AY305512.1| Neogonodactylus oerstedii voucher Neo elongation factor-2 mRNA, partial cds Length = 2179 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtc 234 ||||||||||| ||||||||||| || || |||||||| Sbjct: 41 aacatgtctgtgattgctcatgtagatcatggcaagtc 78 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttcttc 474 |||||||| |||||||| || ||||||||||| || ||||| Sbjct: 290 atcaacctgattgattccccaggccacgttgatttctcttc 330
>gb|AY305503.2| Metajapyx subterraneus voucher Jap elongation factor-2 mRNA, partial cds Length = 2179 Score = 44.1 bits (22), Expect = 0.44 Identities = 52/62 (83%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaag 232 ||||||||||| || || || || |||||||| || ||||| || || |||||||||||| Sbjct: 17 atggacaagaagaagaacatccggaacatgtccgtgattgcccacgtggaccacggcaag 76 Query: 233 tc 234 || Sbjct: 77 tc 78
>gb|AY305487.1| Acanthocyclops vernalis voucher A369 elongation factor-2 mRNA, partial cds Length = 2179 Score = 44.1 bits (22), Expect = 0.44 Identities = 33/38 (86%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtc 234 |||||||| || || ||||| ||||| ||||||||||| Sbjct: 41 aacatgtcygtcatygctcacgtcgatcacggcaagtc 78
>gb|AY310284.1| Strigamia bothriopa voucher Sbo3 elongation factor 2 mRNA, partial cds Length = 2104 Score = 44.1 bits (22), Expect = 0.44 Identities = 37/42 (88%) Strand = Plus / Plus Query: 437 aaccttattgattcacctggccacgttgacttttcttcggag 478 ||||| || |||||||| || |||||||||||||| |||||| Sbjct: 218 aacctcatcgattcacccggtcacgttgacttttcgtcggag 259
>gb|AY310264.1| Ophyiulus pilosus voucher Jul elongation factor 2 mRNA, partial cds Length = 2185 Score = 44.1 bits (22), Expect = 0.44 Identities = 64/78 (82%) Strand = Plus / Plus Query: 173 atggacaagaaaaataatattcgtaacatgtctgttattgctcatgtcgaccacggcaag 232 ||||||||||| || || || ||||||||||| || ||||| || || |||||||| || Sbjct: 17 atggacaagaagaagaacatccgtaacatgtccgtgattgcccacgtagaccacggtaaa 76 Query: 233 tctacgcttacggattcc 250 || || || ||||||||| Sbjct: 77 tcaacactgacggattcc 94
>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome Length = 2971517 Score = 44.1 bits (22), Expect = 0.44 Identities = 31/34 (91%) Strand = Plus / Plus Query: 207 ttattgctcatgtcgaccacggcaagtctacgct 240 |||| |||||| |||||||||||||||| ||||| Sbjct: 1044229 ttatcgctcatatcgaccacggcaagtccacgct 1044262 Score = 44.1 bits (22), Expect = 0.44 Identities = 31/34 (91%) Strand = Plus / Plus Query: 207 ttattgctcatgtcgaccacggcaagtctacgct 240 |||| |||||| |||||||||||||||| ||||| Sbjct: 901197 ttatcgctcatatcgaccacggcaagtccacgct 901230
>gb|AF240823.1| Mastigoproctus giganteus elongation factor-2 mRNA, partial cds Length = 2179 Score = 44.1 bits (22), Expect = 0.44 Identities = 52/62 (83%) Strand = Plus / Plus Query: 188 aatattcgtaacatgtctgttattgctcatgtcgaccacggcaagtctacgcttacggat 247 ||||| || ||||||||||| ||||| ||||| ||||| || ||||| || ||||| ||| Sbjct: 32 aatatccgcaacatgtctgtaattgcacatgtggaccatgggaagtcaacacttacagat 91 Query: 248 tc 249 || Sbjct: 92 tc 93 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttcttc 474 |||||| | ||||||||||| ||||| ||||| |||||||| Sbjct: 290 atcaacttaattgattcaccaggccatgttgatttttcttc 330
>ref|XM_627193.1| Cryptosporidium parvum Iowa II Eft2p GTpase; translation elongation factor 2 (EF-2) (cgd8_2930), partial mRNA Length = 2511 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaa 231 ||||| ||||||||||||||||| ||||| || ||||| Sbjct: 70 cgtaatatgtctgttattgctcacgtcgatcatggcaa 107 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttcttc 474 |||||| | ||||||||||| || ||||| ||||||||||| Sbjct: 292 atcaacttaattgattcaccgggacacgtagacttttcttc 332
>gb|DQ357217.1| Leishmania braziliensis elongation factor 2 (EF-2) gene, complete cds Length = 2538 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 197 aacatgtctgttattgctcatgtcgaccacggcaagtc 234 |||||||| || ||||| || ||||||||||||||||| Sbjct: 61 aacatgtccgtgattgcccacgtcgaccacggcaagtc 98
>gb|AF213662.1|AF213662 Gelidium canariensis elongation factor 2 (EF2) gene, partial cds Length = 2295 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 440 cttattgattcacctggccacgttga 465 ||||||||||||||||| |||||||| Sbjct: 211 cttattgattcacctggtcacgttga 236
>gb|AF213661.1|AF213661 Chondrus crispus elongation factor 2 (EF2) gene, partial cds Length = 2295 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttc 471 |||||||| || ||||| || ||||||||||||||||| Sbjct: 202 atcaacctaatcgattcgccgggccacgttgacttttc 239
>dbj|AK195851.1| Mus musculus cDNA, clone:Y1G0119N10, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 163 Score = 44.1 bits (22), Expect = 0.44 Identities = 37/42 (88%) Strand = Plus / Plus Query: 215 catgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 22 catgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|AK189260.1| Mus musculus cDNA, clone:Y0G0148H14, strand:plus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000047864, based on BLAT search Length = 425 Score = 44.1 bits (22), Expect = 0.44 Identities = 37/42 (88%) Strand = Plus / Plus Query: 215 catgtcgaccacggcaagtctacgcttacggattcccttgtg 256 ||||| |||||||||||||| ||||| || || ||||||||| Sbjct: 22 catgtggaccacggcaagtccacgctgaccgactcccttgtg 63
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 215 catgtcgaccacggcaagtctacgct 240 |||||||||||||||||||| ||||| Sbjct: 1609962 catgtcgaccacggcaagtcgacgct 1609937
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome Length = 5411809 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 329 gagcgtggtattacaatcaaat 350 |||||||||||||||||||||| Sbjct: 4261074 gagcgtggtattacaatcaaat 4261053
>gb|U21667.1|CPU21667 Cryptosporidium parvum elongation factor-2 (EF-2) gene, complete cds Length = 2723 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaa 231 ||||| ||||||||||||||||| ||||| || ||||| Sbjct: 148 cgtaatatgtctgttattgctcacgtcgatcatggcaa 185 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 434 atcaaccttattgattcacctggccacgttgacttttcttc 474 |||||| | ||||||||||| || ||||| ||||||||||| Sbjct: 370 atcaacttaattgattcaccgggacacgtagacttttcttc 410
>dbj|D21259.1|ENHEF2A E. histolytica elongation factor 2 gene, partial sequence Length = 2286 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 437 aaccttattgattcacctggccacgt 462 ||||||||||||||||| |||||||| Sbjct: 208 aaccttattgattcaccaggccacgt 233
>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome Length = 4222334 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 219 tcgaccacggcaagtctacgcttacggat 247 |||||||||||||||| |||||| ||||| Sbjct: 2639920 tcgaccacggcaagtcaacgcttgcggat 2639892
>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome Length = 2572079 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 441 ttattgattcacctggccacgttgacttt 469 |||||||| ||||||| |||||||||||| Sbjct: 2363640 ttattgatacacctggtcacgttgacttt 2363612
>gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 186817 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 115 ttgacattcaaaatcagccaa 135 ||||||||||||||||||||| Sbjct: 54125 ttgacattcaaaatcagccaa 54105
>gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence Length = 136150 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 169 aattatggacaagaaaaataa 189 ||||||||||||||||||||| Sbjct: 115997 aattatggacaagaaaaataa 115977
>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome Length = 4222645 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Minus Query: 219 tcgaccacggcaagtctacgcttacggat 247 |||||||||||||||| |||||| ||||| Sbjct: 2640780 tcgaccacggcaagtcaacgcttgcggat 2640752
>ref|XM_658842.1| Aspergillus nidulans FGSC A4 elongation factor 2 (AN6330.2), mRNA Length = 2535 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcgaccacggcaagtc 234 ||||||||||| || |||||||| ||||| ||||| ||||| Sbjct: 58 cgtaacatgtcggtcattgctcacgtcgatcacggaaagtc 98
>gb|U28373.1|YSCD9481 Saccharomyces cerevisiae chromosome IV cosmid 9481 Length = 42133 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 194 cgtaacatgtctgttattgctcatgtcga 222 ||||||||||| ||||||||||| ||||| Sbjct: 40645 cgtaacatgtccgttattgctcacgtcga 40673
>emb|CR719790.2|CNS0GIC4 Tetraodon nigroviridis full-length cDNA Length = 769 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 1 tgatcaacctgattgactcaccaggacacgttgactt 37
>emb|CR701440.1|CNS0G46K Tetraodon nigroviridis full-length cDNA Length = 1133 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 372 tgatcaacctgattgactcaccaggacacgttgactt 408
>emb|CR694358.2|CNS0FYPU Tetraodon nigroviridis full-length cDNA Length = 1714 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 381 tgatcaacctgattgactcaccaggacacgttgactt 417
>emb|CR694270.2|CNS0FYNE Tetraodon nigroviridis full-length cDNA Length = 1129 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 367 tgatcaacctgattgactcaccaggacacgttgactt 403
>gb|AC123541.3| Oryctolagus cuniculus clone LB1-184A7, complete sequence Length = 190901 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 247 ttcccttgtggcagctgctgg 267 ||||||||||||||||||||| Sbjct: 53190 ttcccttgtggcagctgctgg 53170
>emb|CR656569.2|CNS0F5KV Tetraodon nigroviridis full-length cDNA Length = 1130 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 371 tgatcaacctgattgactcaccaggacacgttgactt 407
>emb|CR651666.2|CNS0F1SO Tetraodon nigroviridis full-length cDNA Length = 1110 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 373 tgatcaacctgattgactcaccaggacacgttgactt 409
>emb|CR651194.2|CNS0F1FK Tetraodon nigroviridis full-length cDNA Length = 835 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 78 tgatcaacctgattgactcaccaggacacgttgactt 114
>emb|CR649058.2|CNS0EZS8 Tetraodon nigroviridis full-length cDNA Length = 1118 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 368 tgatcaacctgattgactcaccaggacacgttgactt 404
>emb|CR647101.2|CNS0EY9V Tetraodon nigroviridis full-length cDNA Length = 829 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 78 tgatcaacctgattgactcaccaggacacgttgactt 114
>emb|CR646461.2|CNS0EXS3 Tetraodon nigroviridis full-length cDNA Length = 1134 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 381 tgatcaacctgattgactcaccaggacacgttgactt 417
>emb|CR645858.2|CNS0EXBC Tetraodon nigroviridis full-length cDNA Length = 1133 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 374 tgatcaacctgattgactcaccaggacacgttgactt 410
>emb|CR644860.2|CNS0EWJM Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 78 tgatcaacctgattgactcaccaggacacgttgactt 114
>emb|CR644476.2|CNS0EW8Y Tetraodon nigroviridis full-length cDNA Length = 1133 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 373 tgatcaacctgattgactcaccaggacacgttgactt 409
>emb|CR641154.2|CNS0ETOO Tetraodon nigroviridis full-length cDNA Length = 838 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 78 tgatcaacctgattgactcaccaggacacgttgactt 114
>emb|CR638920.2|CNS0ERYM Tetraodon nigroviridis full-length cDNA Length = 810 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 432 tgatcaaccttattgattcacctggccacgttgactt 468 |||||||||| ||||| ||||| || ||||||||||| Sbjct: 78 tgatcaacctgattgactcaccaggacacgttgactt 114
>gb|AY310283.1| Rhysida nuda voucher Rnu elongation factor 2 mRNA, partial cds Length = 2110 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 440 cttattgattcacctggccacgttgactt 468 |||||||||||||| || ||||||||||| Sbjct: 221 cttattgattcaccaggacacgttgactt 249 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,706,009 Number of Sequences: 3902068 Number of extensions: 5706009 Number of successful extensions: 93048 Number of sequences better than 10.0: 331 Number of HSP's better than 10.0 without gapping: 326 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 92109 Number of HSP's gapped (non-prelim): 921 length of query: 502 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 480 effective length of database: 17,147,199,772 effective search space: 8230655890560 effective search space used: 8230655890560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
