| Clone Name | bastl04c06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BC068738.1| Xenopus laevis transcription elongation factor type xTFIIS.l, mRNA (cDNA clone MGC:81219 IMAGE:6318853), complete cds Length = 1147 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 110 gcgcgatggcggccaagggg 129 |||||||||||||||||||| Sbjct: 86 gcgcgatggcggccaagggg 105
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 1.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 110 gcgcgatggcggccaaggggacga 133 |||||||||||||||| ||||||| Sbjct: 10092678 gcgcgatggcggccaacgggacga 10092655
>gb|AC137634.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0078C05, complete sequence Length = 122116 Score = 40.1 bits (20), Expect = 1.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 110 gcgcgatggcggccaaggggacga 133 |||||||||||||||| ||||||| Sbjct: 38299 gcgcgatggcggccaacgggacga 38276
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 1.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 110 gcgcgatggcggccaaggggacga 133 |||||||||||||||| ||||||| Sbjct: 10090799 gcgcgatggcggccaacgggacga 10090776
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome Length = 3052398 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 109 cgcgcgatggcggccaaggg 128 |||||||||||||||||||| Sbjct: 2100008 cgcgcgatggcggccaaggg 2100027
>gb|U57837.1|XLU57837 Xenopus laevis transcription elongation factor type xTFIIS.l mRNA, complete cds Length = 1101 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 110 gcgcgatggcggccaagggg 129 |||||||||||||||||||| Sbjct: 57 gcgcgatggcggccaagggg 76
>gb|AY334016.3| Haematococcus pluvialis beta-carotene ketolase (bkt2) gene, 5' flanking region Length = 1493 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 62 gacctgcaagaaacaagca 80 ||||||||||||||||||| Sbjct: 389 gacctgcaagaaacaagca 371
>gb|AC112771.6| Homo sapiens 3 BAC RP11-144C9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 35638 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 136 gagatggaggtgggcggcg 154 ||||||||||||||||||| Sbjct: 15725 gagatggaggtgggcggcg 15707
>emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete genome; segment 9/16 Length = 348706 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 105 ggagcgcgcgatggcggcc 123 ||||||||||||||||||| Sbjct: 4557 ggagcgcgcgatggcggcc 4539
>emb|BX640427.1| Bordetella parapertussis strain 12822, complete genome; segment 5/14 Length = 348997 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 105 ggagcgcgcgatggcggcc 123 ||||||||||||||||||| Sbjct: 261342 ggagcgcgcgatggcggcc 261324
>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12 Length = 347071 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 105 ggagcgcgcgatggcggcc 123 ||||||||||||||||||| Sbjct: 129675 ggagcgcgcgatggcggcc 129657
>emb|AL939109.1|SCO939109 Streptomyces coelicolor A3(2) complete genome; segment 6/29 Length = 277000 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 81 ccgggcgggcggcaggcga 99 ||||||||||||||||||| Sbjct: 24200 ccgggcgggcggcaggcga 24218
>emb|CR858059.1| Pongo pygmaeus mRNA; cDNA DKFZp459H0730 (from clone DKFZp459H0730) Length = 3906 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 20 cccgcaagctcccgactcc 38 ||||||||||||||||||| Sbjct: 71 cccgcaagctcccgactcc 53
>gb|AF329274.1| Dunaliella salina PsaG-like protein mRNA, complete cds Length = 1269 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 132 gaccgagatggaggtgggc 150 ||||||||||||||||||| Sbjct: 1009 gaccgagatggaggtgggc 991 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 132 gaccgagatggaggtgggc 150 ||||||||||||||||||| Sbjct: 244 gaccgagatggaggtgggc 262
>emb|BX546494.9| Zebrafish DNA sequence from clone DKEYP-118A3 in linkage group 1, complete sequence Length = 174501 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 6 attaataaaggcatcccgc 24 ||||||||||||||||||| Sbjct: 147715 attaataaaggcatcccgc 147733
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 81 ccgggcgggcggcaggcga 99 ||||||||||||||||||| Sbjct: 2116633 ccgggcgggcggcaggcga 2116615
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 104 gggagcgcgcgatggcggc 122 ||||||||||||||||||| Sbjct: 4103515 gggagcgcgcgatggcggc 4103497
>gb|AY772007.1| Nocardioides sp. JS614 putative PAPS reductase gene, partial cds; putative argininosuccinate lyase, putative 1-aminocyclopropane-1-carboxylate deaminase, putative adenylosuccinate lyase, putative phosphosulfolactate synthase, putative oxidoreductase/dehydrogenase, putative short-chain dehydrogenase, putative acyl-CoA transferase, putative acyl-CoA synthetase, epoxyalkane: coenzyme M transferase (etnE), probable alkene monooxygenase beta subunit (etnA), probable alkene monooxygenase effector (etnB), probable alkene monooxygenase alpha subunit (etnC), probable alkene monooxygenase reductase, hypothetical proteins, putative dimethylsulfoxide reductase, hypothetical protein, putative TraA conjugation protein, hypothetical protein, putative ParB partitioning protein, and hypothetical proteins genes, complete cds; putative DNA integrase/recombinase gene, partial cds; and unknown gene Length = 34814 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 103 tgggagcgcgcgatggcgg 121 ||||||||||||||||||| Sbjct: 7701 tgggagcgcgcgatggcgg 7719 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,066,904 Number of Sequences: 3902068 Number of extensions: 1066904 Number of successful extensions: 89751 Number of sequences better than 10.0: 18 Number of HSP's better than 10.0 without gapping: 18 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 89317 Number of HSP's gapped (non-prelim): 434 length of query: 156 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 134 effective length of database: 17,147,199,772 effective search space: 2297724769448 effective search space used: 2297724769448 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)