>gb|BC068738.1| Xenopus laevis transcription elongation factor type xTFIIS.l, mRNA
           (cDNA clone MGC:81219 IMAGE:6318853), complete cds
          Length = 1147

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 110 gcgcgatggcggccaagggg 129
           ||||||||||||||||||||
Sbjct: 86  gcgcgatggcggccaagggg 105

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 110      gcgcgatggcggccaaggggacga 133
                |||||||||||||||| |||||||
Sbjct: 10092678 gcgcgatggcggccaacgggacga 10092655

>gb|AC137634.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0078C05, complete sequence
          Length = 122116

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   gcgcgatggcggccaaggggacga 133
             |||||||||||||||| |||||||
Sbjct: 38299 gcgcgatggcggccaacgggacga 38276

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 110      gcgcgatggcggccaaggggacga 133
                |||||||||||||||| |||||||
Sbjct: 10090799 gcgcgatggcggccaacgggacga 10090776

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 109     cgcgcgatggcggccaaggg 128
               ||||||||||||||||||||
Sbjct: 2100008 cgcgcgatggcggccaaggg 2100027

>gb|U57837.1|XLU57837 Xenopus laevis transcription elongation factor type xTFIIS.l mRNA,
           complete cds
          Length = 1101

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 110 gcgcgatggcggccaagggg 129
           ||||||||||||||||||||
Sbjct: 57  gcgcgatggcggccaagggg 76

>gb|AY334016.3| Haematococcus pluvialis beta-carotene ketolase (bkt2) gene, 5'
           flanking region
          Length = 1493

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 62  gacctgcaagaaacaagca 80
           |||||||||||||||||||
Sbjct: 389 gacctgcaagaaacaagca 371

>gb|AC112771.6| Homo sapiens 3 BAC RP11-144C9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 35638

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 136   gagatggaggtgggcggcg 154
             |||||||||||||||||||
Sbjct: 15725 gagatggaggtgggcggcg 15707

>emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete genome; segment 9/16
          Length = 348706

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 105  ggagcgcgcgatggcggcc 123
            |||||||||||||||||||
Sbjct: 4557 ggagcgcgcgatggcggcc 4539

>emb|BX640427.1| Bordetella parapertussis strain 12822, complete genome; segment 5/14
          Length = 348997

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 105    ggagcgcgcgatggcggcc 123
              |||||||||||||||||||
Sbjct: 261342 ggagcgcgcgatggcggcc 261324

>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12
          Length = 347071

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 105    ggagcgcgcgatggcggcc 123
              |||||||||||||||||||
Sbjct: 129675 ggagcgcgcgatggcggcc 129657

>emb|AL939109.1|SCO939109 Streptomyces coelicolor A3(2) complete genome; segment 6/29
          Length = 277000

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    ccgggcgggcggcaggcga 99
             |||||||||||||||||||
Sbjct: 24200 ccgggcgggcggcaggcga 24218

>emb|CR858059.1| Pongo pygmaeus mRNA; cDNA DKFZp459H0730 (from clone
          DKFZp459H0730)
          Length = 3906

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 20 cccgcaagctcccgactcc 38
          |||||||||||||||||||
Sbjct: 71 cccgcaagctcccgactcc 53

>gb|AF329274.1| Dunaliella salina PsaG-like protein mRNA, complete cds
          Length = 1269

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 132  gaccgagatggaggtgggc 150
            |||||||||||||||||||
Sbjct: 1009 gaccgagatggaggtgggc 991



 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 132 gaccgagatggaggtgggc 150
           |||||||||||||||||||
Sbjct: 244 gaccgagatggaggtgggc 262

>emb|BX546494.9| Zebrafish DNA sequence from clone DKEYP-118A3 in linkage group 1,
              complete sequence
          Length = 174501

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      attaataaaggcatcccgc 24
              |||||||||||||||||||
Sbjct: 147715 attaataaaggcatcccgc 147733

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 81      ccgggcgggcggcaggcga 99
               |||||||||||||||||||
Sbjct: 2116633 ccgggcgggcggcaggcga 2116615

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 104     gggagcgcgcgatggcggc 122
               |||||||||||||||||||
Sbjct: 4103515 gggagcgcgcgatggcggc 4103497

>gb|AY772007.1| Nocardioides sp. JS614 putative PAPS reductase gene, partial cds;
            putative argininosuccinate lyase, putative
            1-aminocyclopropane-1-carboxylate deaminase, putative
            adenylosuccinate lyase, putative phosphosulfolactate
            synthase, putative oxidoreductase/dehydrogenase, putative
            short-chain dehydrogenase, putative acyl-CoA transferase,
            putative acyl-CoA synthetase, epoxyalkane: coenzyme M
            transferase (etnE), probable alkene monooxygenase beta
            subunit (etnA), probable alkene monooxygenase effector
            (etnB), probable alkene monooxygenase alpha subunit
            (etnC), probable alkene monooxygenase reductase,
            hypothetical proteins, putative dimethylsulfoxide
            reductase, hypothetical protein, putative TraA
            conjugation protein, hypothetical protein, putative ParB
            partitioning protein, and hypothetical proteins genes,
            complete cds; putative DNA integrase/recombinase gene,
            partial cds; and unknown gene
          Length = 34814

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 103  tgggagcgcgcgatggcgg 121
            |||||||||||||||||||
Sbjct: 7701 tgggagcgcgcgatggcgg 7719


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,066,904
Number of Sequences: 3902068
Number of extensions: 1066904
Number of successful extensions: 89751
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89317
Number of HSP's gapped (non-prelim): 434
length of query: 156
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 134
effective length of database: 17,147,199,772
effective search space: 2297724769448
effective search space used: 2297724769448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)