Clone Name | bastl03e12 |
---|---|
Clone Library Name | barley_pub |
>gb|BT009347.1| Triticum aestivum clone wlm96.pk0001.b7:fis, full insert mRNA sequence Length = 2214 Score = 749 bits (378), Expect = 0.0 Identities = 467/496 (94%), Gaps = 8/496 (1%) Strand = Plus / Plus Query: 1 aatcccatcccatcgcgcagacaggcag-------gccgcccgccaccgcgcgc-atatc 52 ||||||||||||| |||||| ||||||| |||| ||||| |||||||| | ||| Sbjct: 32 aatcccatcccattgcgcaggcaggcaggcaggccgccgaccgccgccgcgcgcgagatc 91 Query: 53 ggaggcctccatcacgaaccccgggctccgcagccggaggcggtgaccggtgtgtatttg 112 ||| ||||||| ||||| |||| |||||||||||||||||||| |||||||| || |||| Sbjct: 92 ggacgcctccaccacgaccccccggctccgcagccggaggcggcgaccggtgcgtgtttg 151 Query: 113 gcaggtaggctcgccggggcgatatgagcgggcacgactccaagtacttctccaccacca 172 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 152 gcaggtaggctcgccggggcgatatgagcgggcacgactccaagtacttctccaccacca 211 Query: 173 aaaagggggagatccccgagctcaaggaggagctcaactcccagtacaaggataagagaa 232 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 212 aaaagggggagatccccgagctcaaggaggagctcaactcccagtacaaggacaagagaa 271 Query: 233 aagatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgt 292 |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||| Sbjct: 272 aagatgctgtcaagaaagtgattgcagcgatgaccgttggaaaagatgtctcatcactgt 331 Query: 293 ttacggatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatact 352 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 332 ttacggatgtcgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatatt 391 Query: 353 tatatctcatcaactatgctaaaagtcaaccagacctagcgatacttgccgtgaacacat 412 | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 392 tgtatctcatcaactatgctaaaagtcaaccagatctagcgatacttgccgtgaacacat 451 Query: 413 ttgttaaggattcacaagatccaaatccactgatccgtgctttggctgtgaggacaatgg 472 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 452 ttgttaaggattcacaagatccaaatccgctgatccgtgctttggctgtgaggacaatgg 511 Query: 473 gttgcatccgtgtaga 488 |||||||||||||||| Sbjct: 512 gttgcatccgtgtaga 527
>dbj|AK068938.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013169D19, full insert sequence Length = 2979 Score = 502 bits (253), Expect = e-139 Identities = 319/341 (93%) Strand = Plus / Plus Query: 145 cacgactccaagtacttctccaccaccaaaaagggggagatccccgagctcaaggaggag 204 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 34 cacgactccaagtacttctccaccaccaagaagggggagatccccgagctcaaggaggag 93 Query: 205 ctcaactcccagtacaaggataagagaaaagatgctgtcaagaaagtgattgcagcaatg 264 ||||||||||||||||||||||||||||||||||||||||||||||| || || || ||| Sbjct: 94 ctcaactcccagtacaaggataagagaaaagatgctgtcaagaaagttatcgctgctatg 153 Query: 265 actgttggaaaagatgtctcatcattgtttacggatgttgtgaactgtatgcagactgag 324 ||||||||||||||||| ||||| |||||||| || ||||||||||| |||||||||||| Sbjct: 154 actgttggaaaagatgtttcatctttgtttaccgacgttgtgaactgcatgcagactgag 213 Query: 325 aacttggagctgaaaaaactagtatacttatatctcatcaactatgctaaaagtcaacca 384 |||||||||||||| ||||||||||| |||||||| || |||||||| ||||||||||| Sbjct: 214 aacttggagctgaagaaactagtatatttatatctgattaactatgccaaaagtcaacct 273 Query: 385 gacctagcgatacttgccgtgaacacatttgttaaggattcacaagatccaaatccactg 444 ||||| || |||||||| || ||||||||||||||||||||||||||||||||||||||| Sbjct: 274 gaccttgccatacttgctgtaaacacatttgttaaggattcacaagatccaaatccactg 333 Query: 445 atccgtgctttggctgtgaggacaatgggttgcatccgtgt 485 || |||||||| ||||||||||||||||||||||||||||| Sbjct: 334 attcgtgctttagctgtgaggacaatgggttgcatccgtgt 374
>gb|AY109428.1| Zea mays CL501_1 mRNA sequence Length = 3187 Score = 444 bits (224), Expect = e-121 Identities = 315/347 (90%) Strand = Plus / Minus Query: 136 atgagcgggcacgactccaagtacttctccaccaccaaaaagggggagatccccgagctc 195 ||||||||||||||||||||||||||||| |||||||| || |||||||||||||| Sbjct: 3075 atgagcgggcacgactccaagtacttctctaccaccaagaannnnnagatccccgagctc 3016 Query: 196 aaggaggagctcaactcccagtacaaggataagagaaaagatgctgtcaagaaagtgatt 255 ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 3015 aaggaggagctcaactcccagtataaggacaagagaaaagatgctgtcaagaaagtgatt 2956 Query: 256 gcagcaatgactgttggaaaagatgtctcatcattgtttacggatgttgtgaactgtatg 315 || || |||||||| ||||| ||||||||||||||||| || |||||||||||||| ||| Sbjct: 2955 gctgctatgactgtaggaaaggatgtctcatcattgttcactgatgttgtgaactgcatg 2896 Query: 316 cagactgagaacttggagctgaaaaaactagtatacttatatctcatcaactatgctaaa 375 |||||||||||||||||||| || ||||||||||| || ||||||||||||||||||||| Sbjct: 2895 cagactgagaacttggagctcaagaaactagtatatttgtatctcatcaactatgctaaa 2836 Query: 376 agtcaaccagacctagcgatacttgccgtgaacacatttgttaaggattcacaagatcca 435 |||||||| || || || || ||||| ||||||||||||||||||||||||||||| ||| Sbjct: 2835 agtcaacctgatcttgccattcttgctgtgaacacatttgttaaggattcacaagaccca 2776 Query: 436 aatccactgatccgtgctttggctgtgaggacaatgggttgcatccg 482 || ||| |||| |||||||||||||| |||||||||||||| ||||| Sbjct: 2775 aacccattgattcgtgctttggctgttaggacaatgggttgtatccg 2729
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 248 bits (125), Expect = 1e-62 Identities = 182/201 (90%) Strand = Plus / Minus Query: 221 aggataagagaaaagatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatg 280 ||||||||||||||||||||||||||||||| || || || ||||||||||||||||||| Sbjct: 13566118 aggataagagaaaagatgctgtcaagaaagttatcgctgctatgactgttggaaaagatg 13566059 Query: 281 tctcatcattgtttacggatgttgtgaactgtatgcagactgagaacttggagctgaaaa 340 | ||||| |||||||| || ||||||||||| |||||||||||||||||||||||||| | Sbjct: 13566058 tttcatctttgtttaccgacgttgtgaactgcatgcagactgagaacttggagctgaaga 13565999 Query: 341 aactagtatacttatatctcatcaactatgctaaaagtcaaccagacctagcgatacttg 400 |||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||| Sbjct: 13565998 aactagtatatttatatctgattaactatgccaaaagtcaacctgaccttgccatacttg 13565939 Query: 401 ccgtgaacacatttgttaagg 421 | || |||||||||||||||| Sbjct: 13565938 ctgtaaacacatttgttaagg 13565918 Score = 194 bits (98), Expect = 2e-46 Identities = 104/106 (98%) Strand = Plus / Minus Query: 118 taggctcgccggggcgatatgagcgggcacgactccaagtacttctccaccaccaaaaag 177 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| Sbjct: 13567353 taggctcgccggggcgagatgagcgggcacgactccaagtacttctccaccaccaagaag 13567294 Query: 178 ggggagatccccgagctcaaggaggagctcaactcccagtacaagg 223 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13567293 ggggagatccccgagctcaaggaggagctcaactcccagtacaagg 13567248 Score = 117 bits (59), Expect = 4e-23 Identities = 65/67 (97%) Strand = Plus / Minus Query: 419 aggattcacaagatccaaatccactgatccgtgctttggctgtgaggacaatgggttgca 478 |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| Sbjct: 13565796 aggattcacaagatccaaatccactgattcgtgctttagctgtgaggacaatgggttgca 13565737 Query: 479 tccgtgt 485 ||||||| Sbjct: 13565736 tccgtgt 13565730
>gb|AC137073.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBb0005A11, from chromosome 3, complete sequence Length = 168219 Score = 248 bits (125), Expect = 1e-62 Identities = 182/201 (90%) Strand = Plus / Minus Query: 221 aggataagagaaaagatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatg 280 ||||||||||||||||||||||||||||||| || || || ||||||||||||||||||| Sbjct: 126009 aggataagagaaaagatgctgtcaagaaagttatcgctgctatgactgttggaaaagatg 125950 Query: 281 tctcatcattgtttacggatgttgtgaactgtatgcagactgagaacttggagctgaaaa 340 | ||||| |||||||| || ||||||||||| |||||||||||||||||||||||||| | Sbjct: 125949 tttcatctttgtttaccgacgttgtgaactgcatgcagactgagaacttggagctgaaga 125890 Query: 341 aactagtatacttatatctcatcaactatgctaaaagtcaaccagacctagcgatacttg 400 |||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||| Sbjct: 125889 aactagtatatttatatctgattaactatgccaaaagtcaacctgaccttgccatacttg 125830 Query: 401 ccgtgaacacatttgttaagg 421 | || |||||||||||||||| Sbjct: 125829 ctgtaaacacatttgttaagg 125809 Score = 194 bits (98), Expect = 2e-46 Identities = 104/106 (98%) Strand = Plus / Minus Query: 118 taggctcgccggggcgatatgagcgggcacgactccaagtacttctccaccaccaaaaag 177 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| Sbjct: 127244 taggctcgccggggcgagatgagcgggcacgactccaagtacttctccaccaccaagaag 127185 Query: 178 ggggagatccccgagctcaaggaggagctcaactcccagtacaagg 223 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 127184 ggggagatccccgagctcaaggaggagctcaactcccagtacaagg 127139 Score = 117 bits (59), Expect = 4e-23 Identities = 65/67 (97%) Strand = Plus / Minus Query: 419 aggattcacaagatccaaatccactgatccgtgctttggctgtgaggacaatgggttgca 478 |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| Sbjct: 125687 aggattcacaagatccaaatccactgattcgtgctttagctgtgaggacaatgggttgca 125628 Query: 479 tccgtgt 485 ||||||| Sbjct: 125627 tccgtgt 125621
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 248 bits (125), Expect = 1e-62 Identities = 182/201 (90%) Strand = Plus / Minus Query: 221 aggataagagaaaagatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatg 280 ||||||||||||||||||||||||||||||| || || || ||||||||||||||||||| Sbjct: 13561993 aggataagagaaaagatgctgtcaagaaagttatcgctgctatgactgttggaaaagatg 13561934 Query: 281 tctcatcattgtttacggatgttgtgaactgtatgcagactgagaacttggagctgaaaa 340 | ||||| |||||||| || ||||||||||| |||||||||||||||||||||||||| | Sbjct: 13561933 tttcatctttgtttaccgacgttgtgaactgcatgcagactgagaacttggagctgaaga 13561874 Query: 341 aactagtatacttatatctcatcaactatgctaaaagtcaaccagacctagcgatacttg 400 |||||||||| |||||||| || |||||||| ||||||||||| ||||| || ||||||| Sbjct: 13561873 aactagtatatttatatctgattaactatgccaaaagtcaacctgaccttgccatacttg 13561814 Query: 401 ccgtgaacacatttgttaagg 421 | || |||||||||||||||| Sbjct: 13561813 ctgtaaacacatttgttaagg 13561793 Score = 194 bits (98), Expect = 2e-46 Identities = 104/106 (98%) Strand = Plus / Minus Query: 118 taggctcgccggggcgatatgagcgggcacgactccaagtacttctccaccaccaaaaag 177 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| Sbjct: 13563228 taggctcgccggggcgagatgagcgggcacgactccaagtacttctccaccaccaagaag 13563169 Query: 178 ggggagatccccgagctcaaggaggagctcaactcccagtacaagg 223 |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 13563168 ggggagatccccgagctcaaggaggagctcaactcccagtacaagg 13563123 Score = 117 bits (59), Expect = 4e-23 Identities = 65/67 (97%) Strand = Plus / Minus Query: 419 aggattcacaagatccaaatccactgatccgtgctttggctgtgaggacaatgggttgca 478 |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| Sbjct: 13561671 aggattcacaagatccaaatccactgattcgtgctttagctgtgaggacaatgggttgca 13561612 Query: 479 tccgtgt 485 ||||||| Sbjct: 13561611 tccgtgt 13561605
>ref|NM_117209.3| Arabidopsis thaliana clathrin binding AT4G11380 mRNA, complete cds Length = 3310 Score = 226 bits (114), Expect = 5e-56 Identities = 291/350 (83%) Strand = Plus / Plus Query: 136 atgagcgggcacgactccaagtacttctccaccaccaaaaagggggagatccccgagctc 195 ||||| || ||||| || || ||||||||||| || || ||||| |||||||| |||||| Sbjct: 101 atgagtggtcacgattcgaaatacttctccacgacgaagaagggagagatccctgagctc 160 Query: 196 aaggaggagctcaactcccagtacaaggataagagaaaagatgctgtcaagaaagtgatt 255 ||||| ||||| || |||||||| |||||||||||||||||||| || ||||| || ||| Sbjct: 161 aaggaagagcttaattcccagtataaggataagagaaaagatgcagttaagaaggttatt 220 Query: 256 gcagcaatgactgttggaaaagatgtctcatcattgtttacggatgttgtgaactgtatg 315 || || |||||||||||||| ||||| |||||| | || || ||||| || || |||||| Sbjct: 221 gcggcgatgactgttggaaaggatgtttcatcacttttcactgatgtagtcaattgtatg 280 Query: 316 cagactgagaacttggagctgaaaaaactagtatacttatatctcatcaactatgctaaa 375 || || || || |||||| |||| || || || ||||| |||||||| || ||||| ||| Sbjct: 281 caaacggaaaatttggagttgaagaagcttgtttacttgtatctcataaattatgcgaaa 340 Query: 376 agtcaaccagacctagcgatacttgccgtgaacacatttgttaaggattcacaagatcca 435 || || ||||| || || || ||||| || || || ||||| ||||||||||| |||||| Sbjct: 341 agccagccagatcttgctattcttgcagtaaatacctttgtaaaggattcacaggatcca 400 Query: 436 aatccactgatccgtgctttggctgtgaggacaatgggttgcatccgtgt 485 ||||| ||||| ||||||||||||||| |||||||||| ||||| ||||| Sbjct: 401 aatccgctgattcgtgctttggctgtgcggacaatgggctgcattcgtgt 450
>gb|BT010362.1| Arabidopsis thaliana At4g11380 mRNA, complete cds Length = 2685 Score = 226 bits (114), Expect = 5e-56 Identities = 291/350 (83%) Strand = Plus / Plus Query: 136 atgagcgggcacgactccaagtacttctccaccaccaaaaagggggagatccccgagctc 195 ||||| || ||||| || || ||||||||||| || || ||||| |||||||| |||||| Sbjct: 1 atgagtggtcacgattcgaaatacttctccacgacgaagaagggagagatccctgagctc 60 Query: 196 aaggaggagctcaactcccagtacaaggataagagaaaagatgctgtcaagaaagtgatt 255 ||||| ||||| || |||||||| |||||||||||||||||||| || ||||| || ||| Sbjct: 61 aaggaagagcttaattcccagtataaggataagagaaaagatgcagttaagaaggttatt 120 Query: 256 gcagcaatgactgttggaaaagatgtctcatcattgtttacggatgttgtgaactgtatg 315 || || |||||||||||||| ||||| |||||| | || || ||||| || || |||||| Sbjct: 121 gcggcgatgactgttggaaaggatgtttcatcacttttcactgatgtagtcaattgtatg 180 Query: 316 cagactgagaacttggagctgaaaaaactagtatacttatatctcatcaactatgctaaa 375 || || || || |||||| |||| || || || ||||| |||||||| || ||||| ||| Sbjct: 181 caaacggaaaatttggagttgaagaagcttgtttacttgtatctcataaattatgcgaaa 240 Query: 376 agtcaaccagacctagcgatacttgccgtgaacacatttgttaaggattcacaagatcca 435 || || ||||| || || || ||||| || || || ||||| ||||||||||| |||||| Sbjct: 241 agccagccagatcttgctattcttgcagtaaatacctttgtaaaggattcacaggatcca 300 Query: 436 aatccactgatccgtgctttggctgtgaggacaatgggttgcatccgtgt 485 ||||| ||||| ||||||||||||||| |||||||||| ||||| ||||| Sbjct: 301 aatccgctgattcgtgctttggctgtgcggacaatgggctgcattcgtgt 350
>gb|AY093155.1| Arabidopsis thaliana beta-adaptin-like protein (At4g11380) mRNA, complete cds Length = 2972 Score = 226 bits (114), Expect = 5e-56 Identities = 291/350 (83%) Strand = Plus / Plus Query: 136 atgagcgggcacgactccaagtacttctccaccaccaaaaagggggagatccccgagctc 195 ||||| || ||||| || || ||||||||||| || || ||||| |||||||| |||||| Sbjct: 82 atgagtggtcacgattcgaaatacttctccacgacgaagaagggagagatccctgagctc 141 Query: 196 aaggaggagctcaactcccagtacaaggataagagaaaagatgctgtcaagaaagtgatt 255 ||||| ||||| || |||||||| |||||||||||||||||||| || ||||| || ||| Sbjct: 142 aaggaagagcttaattcccagtataaggataagagaaaagatgcagttaagaaggttatt 201 Query: 256 gcagcaatgactgttggaaaagatgtctcatcattgtttacggatgttgtgaactgtatg 315 || || |||||||||||||| ||||| |||||| | || || ||||| || || |||||| Sbjct: 202 gcggcgatgactgttggaaaggatgtttcatcacttttcactgatgtagtcaattgtatg 261 Query: 316 cagactgagaacttggagctgaaaaaactagtatacttatatctcatcaactatgctaaa 375 || || || || |||||| |||| || || || ||||| |||||||| || ||||| ||| Sbjct: 262 caaacggaaaatttggagttgaagaagcttgtttacttgtatctcataaattatgcgaaa 321 Query: 376 agtcaaccagacctagcgatacttgccgtgaacacatttgttaaggattcacaagatcca 435 || || ||||| || || || ||||| || || || ||||| ||||||||||| |||||| Sbjct: 322 agccagccagatcttgctattcttgcagtaaatacctttgtaaaggattcacaggatcca 381 Query: 436 aatccactgatccgtgctttggctgtgaggacaatgggttgcatccgtgt 485 ||||| ||||| ||||||||||||||| |||||||||| ||||| ||||| Sbjct: 382 aatccgctgattcgtgctttggctgtgcggacaatgggctgcattcgtgt 431
>emb|BX828065.1|CNS0A2BU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH4ZB04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2928 Score = 226 bits (114), Expect = 5e-56 Identities = 291/350 (83%) Strand = Plus / Plus Query: 136 atgagcgggcacgactccaagtacttctccaccaccaaaaagggggagatccccgagctc 195 ||||| || ||||| || || ||||||||||| || || ||||| |||||||| |||||| Sbjct: 100 atgagtggtcacgattcgaaatacttctccacgacgaagaagggagagatccctgagctc 159 Query: 196 aaggaggagctcaactcccagtacaaggataagagaaaagatgctgtcaagaaagtgatt 255 ||||| ||||| || |||||||| |||||||||||||||||||| || ||||| || ||| Sbjct: 160 aaggaagagcttaattcccagtataaggataagagaaaagatgcagttaagaaggttatt 219 Query: 256 gcagcaatgactgttggaaaagatgtctcatcattgtttacggatgttgtgaactgtatg 315 || || |||||||||||||| ||||| |||||| | || || ||||| || || |||||| Sbjct: 220 gcggcgatgactgttggaaaggatgtttcatcacttttcactgatgtagtcaattgtatg 279 Query: 316 cagactgagaacttggagctgaaaaaactagtatacttatatctcatcaactatgctaaa 375 || || || || |||||| |||| || || || ||||| |||||||| || ||||| ||| Sbjct: 280 caaacggaaaatttggagttgaagaagcttgtttacttgtatctcataaattatgcgaaa 339 Query: 376 agtcaaccagacctagcgatacttgccgtgaacacatttgttaaggattcacaagatcca 435 || || ||||| || || || ||||| || || || ||||| ||||||||||| |||||| Sbjct: 340 agccagccagatcttgctattcttgcagtaaatacctttgtaaaggattcacaggatcca 399 Query: 436 aatccactgatccgtgctttggctgtgaggacaatgggttgcatccgtgt 485 ||||| ||||| ||||||||||||||| |||||||||| ||||| ||||| Sbjct: 400 aatccgctgattcgtgctttggctgtgcggacaatgggctgcattcgtgt 449
>gb|AF216386.1|AF216386 Arabidopsis thaliana beta-adaptin-like protein B mRNA, complete cds Length = 2939 Score = 226 bits (114), Expect = 5e-56 Identities = 291/350 (83%) Strand = Plus / Plus Query: 136 atgagcgggcacgactccaagtacttctccaccaccaaaaagggggagatccccgagctc 195 ||||| || ||||| || || ||||||||||| || || ||||| |||||||| |||||| Sbjct: 42 atgagtggtcacgattcgaaatacttctccacgacgaagaagggagagatccctgagctc 101 Query: 196 aaggaggagctcaactcccagtacaaggataagagaaaagatgctgtcaagaaagtgatt 255 ||||| ||||| || |||||||| |||||||||||||||||||| || ||||| || ||| Sbjct: 102 aaggaagagcttaattcccagtataaggataagagaaaagatgcagttaagaaggttatt 161 Query: 256 gcagcaatgactgttggaaaagatgtctcatcattgtttacggatgttgtgaactgtatg 315 || || |||||||||||||| ||||| |||||| | || || ||||| || || |||||| Sbjct: 162 gcggcgatgactgttggaaaggatgtttcatcacttttcactgatgtagtcaattgtatg 221 Query: 316 cagactgagaacttggagctgaaaaaactagtatacttatatctcatcaactatgctaaa 375 || || || || |||||| |||| || || || ||||| |||||||| || ||||| ||| Sbjct: 222 caaacggaaaatttggagttgaagaagcttgtttacttgtatctcataaattatgcgaaa 281 Query: 376 agtcaaccagacctagcgatacttgccgtgaacacatttgttaaggattcacaagatcca 435 || || ||||| || || || ||||| || || || ||||| ||||||||||| |||||| Sbjct: 282 agccagccagatcttgctattcttgcagtaaatacctttgtaaaggattcacaggatcca 341 Query: 436 aatccactgatccgtgctttggctgtgaggacaatgggttgcatccgtgt 485 ||||| ||||| ||||||||||||||| |||||||||| ||||| ||||| Sbjct: 342 aatccgctgattcgtgctttggctgtgcggacaatgggctgcattcgtgt 391
>ref|NM_118475.3| Arabidopsis thaliana clathrin binding AT4G23460 mRNA, complete cds Length = 2962 Score = 198 bits (100), Expect = 1e-47 Identities = 241/288 (83%) Strand = Plus / Plus Query: 175 aagggggagatccccgagctcaaggaggagctcaactcccagtacaaggataagagaaaa 234 ||||| |||||||| ||||||||||| ||||| || || ||||||||||||||||| ||| Sbjct: 92 aagggagagatccctgagctcaaggaagagctgaattcacagtacaaggataagaggaaa 151 Query: 235 gatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgttt 294 |||||||| ||||| || ||||| ||||||||||||||||| ||||| |||||| | || Sbjct: 152 gatgctgttaagaaggttattgcggcaatgactgttggaaaggatgtttcatcacttttc 211 Query: 295 acggatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatactta 354 || ||||| || || || ||||| |||||||| ||||| |||| || || || ||||| Sbjct: 212 actgatgtagtcaattgcatgcaaactgagaatctggagttgaagaagcttgtttacttg 271 Query: 355 tatctcatcaactatgctaaaagtcaaccagacctagcgatacttgccgtgaacacattt 414 ||||| || |||||||| ||||| || ||||| || || || || || || || || ||| Sbjct: 272 tatctgataaactatgcaaaaagccagccagatcttgctatcctcgctgtaaatactttt 331 Query: 415 gttaaggattcacaagatccaaatccactgatccgtgctttggctgtg 462 ||||||||||||||||| ||||||||| ||||||| |||||||||||| Sbjct: 332 gttaaggattcacaagacccaaatccattgatccgggctttggctgtg 379
>gb|AF216387.1|AF216387 Arabidopsis thaliana beta-adaptin-like protein C mRNA, partial cds Length = 2761 Score = 198 bits (100), Expect = 1e-47 Identities = 241/288 (83%) Strand = Plus / Plus Query: 175 aagggggagatccccgagctcaaggaggagctcaactcccagtacaaggataagagaaaa 234 ||||| |||||||| ||||||||||| ||||| || || ||||||||||||||||| ||| Sbjct: 31 aagggagagatccctgagctcaaggaagagctgaattcacagtacaaggataagaggaaa 90 Query: 235 gatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgttt 294 |||||||| ||||| || ||||| ||||||||||||||||| ||||| |||||| | || Sbjct: 91 gatgctgttaagaaggttattgcggcaatgactgttggaaaggatgtttcatcacttttc 150 Query: 295 acggatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatactta 354 || ||||| || || || ||||| |||||||| ||||| |||| || || || ||||| Sbjct: 151 actgatgtagtcaattgcatgcaaactgagaatctggagttgaagaagcttgtttacttg 210 Query: 355 tatctcatcaactatgctaaaagtcaaccagacctagcgatacttgccgtgaacacattt 414 ||||| || |||||||| ||||| || ||||| || || || || || || || || ||| Sbjct: 211 tatctgataaactatgcaaaaagccagccagatcttgctatcctcgctgtaaatactttt 270 Query: 415 gttaaggattcacaagatccaaatccactgatccgtgctttggctgtg 462 ||||||||||||||||| ||||||||| ||||||| |||||||||||| Sbjct: 271 gttaaggattcacaagacccaaatccattgatccgggctttggctgtg 318
>gb|AY065000.1| Arabidopsis thaliana AT4g23460/F16G20_160 mRNA, complete cds Length = 2955 Score = 190 bits (96), Expect = 3e-45 Identities = 240/288 (83%) Strand = Plus / Plus Query: 175 aagggggagatccccgagctcaaggaggagctcaactcccagtacaaggataagagaaaa 234 ||||| |||||||| ||||||||||| ||||| || || ||||||||||||||||| ||| Sbjct: 92 aagggagagatccctgagctcaaggaagagctgaattcacagtacaaggataagaggaaa 151 Query: 235 gatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgttt 294 |||||||| ||||| || ||||| || |||||||||||||| ||||| |||||| | || Sbjct: 152 gatgctgttaagaaggttattgcggcgatgactgttggaaaggatgtttcatcacttttc 211 Query: 295 acggatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatactta 354 || ||||| || || || ||||| |||||||| ||||| |||| || || || ||||| Sbjct: 212 actgatgtagtcaattgcatgcaaactgagaatctggagttgaagaagcttgtttacttg 271 Query: 355 tatctcatcaactatgctaaaagtcaaccagacctagcgatacttgccgtgaacacattt 414 ||||| || |||||||| ||||| || ||||| || || || || || || || || ||| Sbjct: 272 tatctgataaactatgcaaaaagccagccagatcttgctatcctcgctgtaaatactttt 331 Query: 415 gttaaggattcacaagatccaaatccactgatccgtgctttggctgtg 462 ||||||||||||||||| ||||||||| ||||||| |||||||||||| Sbjct: 332 gttaaggattcacaagacccaaatccattgatccgggctttggctgtg 379
>emb|AL161559.2|ATCHRIV59 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 59 Length = 199199 Score = 99.6 bits (50), Expect = 8e-18 Identities = 137/166 (82%) Strand = Plus / Minus Query: 221 aggataagagaaaagatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatg 280 |||||||||| ||||||||||| ||||| || ||||| ||||||||||||||||| |||| Sbjct: 101952 aggataagaggaaagatgctgttaagaaggttattgcggcaatgactgttggaaaggatg 101893 Query: 281 tctcatcattgtttacggatgttgtgaactgtatgcagactgagaacttggagctgaaaa 340 | |||||| | || || ||||| || || || ||||| |||||||| ||||| |||| | Sbjct: 101892 tttcatcacttttcactgatgtagtcaattgcatgcaaactgagaatctggagttgaaga 101833 Query: 341 aactagtatacttatatctcatcaactatgctaaaagtcaaccaga 386 | || || ||||| ||||| || |||||||| ||||| || ||||| Sbjct: 101832 agcttgtttacttgtatctgataaactatgcaaaaagccagccaga 101787 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 419 aggattcacaagatccaaatccactgatccgtgctttggctgtg 462 ||||||||||||| ||||||||| ||||||| |||||||||||| Sbjct: 101607 aggattcacaagacccaaatccattgatccgggctttggctgtg 101564 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 175 aagggggagatccccgagctcaaggaggagctcaactcccagtacaagg 223 ||||| |||||||| ||||||||||| ||||| || || |||||||||| Sbjct: 102441 aagggagagatccctgagctcaaggaagagctgaattcacagtacaagg 102393
>emb|AL031326.1|ATF16G20 Arabidopsis thaliana DNA chromosome 4, BAC clone F16G20 (ESSAII project) Length = 97006 Score = 99.6 bits (50), Expect = 8e-18 Identities = 137/166 (82%) Strand = Plus / Minus Query: 221 aggataagagaaaagatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatg 280 |||||||||| ||||||||||| ||||| || ||||| ||||||||||||||||| |||| Sbjct: 60420 aggataagaggaaagatgctgttaagaaggttattgcggcaatgactgttggaaaggatg 60361 Query: 281 tctcatcattgtttacggatgttgtgaactgtatgcagactgagaacttggagctgaaaa 340 | |||||| | || || ||||| || || || ||||| |||||||| ||||| |||| | Sbjct: 60360 tttcatcacttttcactgatgtagtcaattgcatgcaaactgagaatctggagttgaaga 60301 Query: 341 aactagtatacttatatctcatcaactatgctaaaagtcaaccaga 386 | || || ||||| ||||| || |||||||| ||||| || ||||| Sbjct: 60300 agcttgtttacttgtatctgataaactatgcaaaaagccagccaga 60255 Score = 63.9 bits (32), Expect = 5e-07 Identities = 41/44 (93%) Strand = Plus / Minus Query: 419 aggattcacaagatccaaatccactgatccgtgctttggctgtg 462 ||||||||||||| ||||||||| ||||||| |||||||||||| Sbjct: 60075 aggattcacaagacccaaatccattgatccgggctttggctgtg 60032 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 175 aagggggagatccccgagctcaaggaggagctcaactcccagtacaagg 223 ||||| |||||||| ||||||||||| ||||| || || |||||||||| Sbjct: 60909 aagggagagatccctgagctcaaggaagagctgaattcacagtacaagg 60861
>emb|AL161531.2|ATCHRIV31 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 31 Length = 198301 Score = 91.7 bits (46), Expect = 2e-15 Identities = 136/166 (81%) Strand = Plus / Plus Query: 221 aggataagagaaaagatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatg 280 ||||||||||||||||||| || ||||| || ||||| || |||||||||||||| |||| Sbjct: 165397 aggataagagaaaagatgcagttaagaaggttattgcggcgatgactgttggaaaggatg 165456 Query: 281 tctcatcattgtttacggatgttgtgaactgtatgcagactgagaacttggagctgaaaa 340 | |||||| | || || ||||| || || |||||||| || || || |||||| |||| | Sbjct: 165457 tttcatcacttttcactgatgtagtcaattgtatgcaaacggaaaatttggagttgaaga 165516 Query: 341 aactagtatacttatatctcatcaactatgctaaaagtcaaccaga 386 | || || ||||| |||||||| || ||||| ||||| || ||||| Sbjct: 165517 agcttgtttacttgtatctcataaattatgcgaaaagccagccaga 165562 Score = 85.7 bits (43), Expect = 1e-13 Identities = 61/67 (91%) Strand = Plus / Plus Query: 419 aggattcacaagatccaaatccactgatccgtgctttggctgtgaggacaatgggttgca 478 |||||||||| ||||||||||| ||||| ||||||||||||||| |||||||||| |||| Sbjct: 165712 aggattcacaggatccaaatccgctgattcgtgctttggctgtgcggacaatgggctgca 165771 Query: 479 tccgtgt 485 | ||||| Sbjct: 165772 ttcgtgt 165778 Score = 63.9 bits (32), Expect = 5e-07 Identities = 74/88 (84%) Strand = Plus / Plus Query: 136 atgagcgggcacgactccaagtacttctccaccaccaaaaagggggagatccccgagctc 195 ||||| || ||||| || || ||||||||||| || || ||||| |||||||| |||||| Sbjct: 164845 atgagtggtcacgattcgaaatacttctccacgacgaagaagggagagatccctgagctc 164904 Query: 196 aaggaggagctcaactcccagtacaagg 223 ||||| ||||| || |||||||| |||| Sbjct: 164905 aaggaagagcttaattcccagtataagg 164932
>emb|AL096882.2|ATF8L21 Arabidopsis thaliana DNA chromosome 4, BAC clone F8L21 (ESSA project) Length = 98948 Score = 91.7 bits (46), Expect = 2e-15 Identities = 136/166 (81%) Strand = Plus / Plus Query: 221 aggataagagaaaagatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatg 280 ||||||||||||||||||| || ||||| || ||||| || |||||||||||||| |||| Sbjct: 92391 aggataagagaaaagatgcagttaagaaggttattgcggcgatgactgttggaaaggatg 92450 Query: 281 tctcatcattgtttacggatgttgtgaactgtatgcagactgagaacttggagctgaaaa 340 | |||||| | || || ||||| || || |||||||| || || || |||||| |||| | Sbjct: 92451 tttcatcacttttcactgatgtagtcaattgtatgcaaacggaaaatttggagttgaaga 92510 Query: 341 aactagtatacttatatctcatcaactatgctaaaagtcaaccaga 386 | || || ||||| |||||||| || ||||| ||||| || ||||| Sbjct: 92511 agcttgtttacttgtatctcataaattatgcgaaaagccagccaga 92556 Score = 85.7 bits (43), Expect = 1e-13 Identities = 61/67 (91%) Strand = Plus / Plus Query: 419 aggattcacaagatccaaatccactgatccgtgctttggctgtgaggacaatgggttgca 478 |||||||||| ||||||||||| ||||| ||||||||||||||| |||||||||| |||| Sbjct: 92706 aggattcacaggatccaaatccgctgattcgtgctttggctgtgcggacaatgggctgca 92765 Query: 479 tccgtgt 485 | ||||| Sbjct: 92766 ttcgtgt 92772 Score = 63.9 bits (32), Expect = 5e-07 Identities = 74/88 (84%) Strand = Plus / Plus Query: 136 atgagcgggcacgactccaagtacttctccaccaccaaaaagggggagatccccgagctc 195 ||||| || ||||| || || ||||||||||| || || ||||| |||||||| |||||| Sbjct: 91839 atgagtggtcacgattcgaaatacttctccacgacgaagaagggagagatccctgagctc 91898 Query: 196 aaggaggagctcaactcccagtacaagg 223 ||||| ||||| || |||||||| |||| Sbjct: 91899 aaggaagagcttaattcccagtataagg 91926
>gb|BT016054.1| Drosophila melanogaster LP17054 full insert cDNA Length = 3231 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 151 tccaagtacttctccaccaccaaaaagggggagatccccgagctcaag 198 |||||||||||| |||||||||| ||||| |||||| |||||||||| Sbjct: 104 tccaagtacttcaccaccaccaagaagggcgagatcttcgagctcaag 151
>ref|XM_415772.1| PREDICTED: Gallus gallus similar to Ap2b1 protein (LOC417525), mRNA Length = 3465 Score = 56.0 bits (28), Expect = 1e-04 Identities = 76/92 (82%) Strand = Plus / Plus Query: 232 aaagatgctgtcaagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattg 291 ||||| ||||| ||||| || |||||||| |||||||| || || |||||| ||| | Sbjct: 91 aaagaagctgtaaagaaggttattgcagccatgactgtggggaaggatgtcagctcactc 150 Query: 292 tttacggatgttgtgaactgtatgcagactga 323 ||| | |||||||||||||| ||||||||||| Sbjct: 151 tttcctgatgttgtgaactgcatgcagactga 182
>ref|NM_078691.2| Drosophila melanogaster Adaptin CG12532-RA (Bap), mRNA Length = 3235 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 151 tccaagtacttctccaccaccaaaaagggggagatccccgagctcaag 198 |||||||||||| |||||||||| ||||| |||||| |||||||||| Sbjct: 122 tccaagtacttcaccaccaccaagaagggcgagatcttcgagctcaag 169
>gb|AC010671.8|AC010671 Drosophila melanogaster, chromosome X, region 18E-18F, BAC clone BACR33M08, complete sequence Length = 180263 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 151 tccaagtacttctccaccaccaaaaagggggagatccccgagctcaag 198 |||||||||||| |||||||||| ||||| |||||| |||||||||| Sbjct: 128412 tccaagtacttcaccaccaccaagaagggcgagatcttcgagctcaag 128459
>gb|AC012165.6|AC012165 Drosophila melanogaster, chromosome X, region 18F-18F, BAC clone BACR48P17, complete sequence Length = 176195 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 151 tccaagtacttctccaccaccaaaaagggggagatccccgagctcaag 198 |||||||||||| |||||||||| ||||| |||||| |||||||||| Sbjct: 11772 tccaagtacttcaccaccaccaagaagggcgagatcttcgagctcaag 11819
>gb|AE003513.3| Drosophila melanogaster chromosome X, section 65 of 74 of the complete sequence Length = 207432 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 151 tccaagtacttctccaccaccaaaaagggggagatccccgagctcaag 198 |||||||||||| |||||||||| ||||| |||||| |||||||||| Sbjct: 31911 tccaagtacttcaccaccaccaagaagggcgagatcttcgagctcaag 31958
>emb|X75910.1|DMBA D.melanogaster mRNA for beta-adaptin Length = 3217 Score = 56.0 bits (28), Expect = 1e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 151 tccaagtacttctccaccaccaaaaagggggagatccccgagctcaag 198 |||||||||||| |||||||||| ||||| |||||| |||||||||| Sbjct: 100 tccaagtacttcaccaccaccaagaagggcgagatcttcgagctcaag 147
>ref|NM_007454.2| Mus musculus adaptor protein complex AP-1, beta 1 subunit (Ap1b1), mRNA Length = 3942 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 276 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 314 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 487 tggctgtgaggactatgggctgcatccg 514
>ref|XM_714967.1| Candida albicans SC5314 putative clathrin-associated protein AP-1 complex component (CaO19_7861), mRNA Length = 2328 Score = 54.0 bits (27), Expect = 4e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 249 agtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 ||||||| ||||||||||||||| |||||||| |||||||| ||| | |||||| Sbjct: 171 agtgattcaagcaatgactgttggtaaagatgtatcatcattatttcctgatgtt 225
>ref|XM_714837.1| Candida albicans SC5314 putative clathrin-associated protein AP-1 complex component (CaO19_231), mRNA Length = 2325 Score = 54.0 bits (27), Expect = 4e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 249 agtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 ||||||| ||||||||||||||| |||||||| |||||||| ||| | |||||| Sbjct: 171 agtgattcaagcaatgactgttggtaaagatgtatcatcattatttcctgatgtt 225
>gb|AC005528.43| Mus musculus strain 129S6/SvEvTac clone rp21-493n6 map 11a2, complete sequence Length = 199326 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 179740 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 179702 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 176298 tggctgtgaggactatgggctgcatccg 176271
>gb|BC008513.1| Mus musculus adaptor protein complex AP-1, beta 1 subunit, mRNA (cDNA clone MGC:5850 IMAGE:3601435), complete cds Length = 3724 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 170 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 208 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 381 tggctgtgaggactatgggctgcatccg 408
>emb|AL645522.12| Mouse DNA sequence from clone RP23-64E17 on chromosome 11 Cntains the 3' end of the Nipsnap1 gene for 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans), a novel gene, a ribosomal protein L17 (Rpl17) pseudogene, the Nefh gene for neurofilament heavy polypeptide, the Ap1b1 gene for adaptor protein complex AP-1 beta 1 subunit, the gene for the ortholog of human RAS-related protein on chromosome 22, the gene for the ortholog of human growth arrest-specific 2 like 1 GAS2L1 and six CpG islands, complete sequence Length = 183758 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 127211 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 127249 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 130904 tggctgtgaggactatgggctgcatccg 130931
>dbj|AK159273.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420013K18 product:adaptor protein complex AP-1, beta 1 subunit, full insert sequence Length = 3762 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 248 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 286 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 459 tggctgtgaggactatgggctgcatccg 486
>dbj|AK155892.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F730314K12 product:adaptor protein complex AP-1, beta 1 subunit, full insert sequence Length = 3792 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 277 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 315 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 488 tggctgtgaggactatgggctgcatccg 515
>dbj|AK165747.1| Mus musculus 13 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone:G630049C13 product:adaptor protein complex AP-1, beta 1 subunit, full insert sequence Length = 3799 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 273 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 311 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 484 tggctgtgaggactatgggctgcatccg 511
>dbj|AK160042.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420045E07 product:adaptor protein complex AP-1, beta 1 subunit, full insert sequence Length = 3762 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 248 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 286 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 459 tggctgtgaggactatgggctgcatccg 486
>dbj|AK170376.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630101J08 product:adaptor protein complex AP-1, beta 1 subunit, full insert sequence Length = 3930 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 266 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 304 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 477 tggctgtgaggactatgggctgcatccg 504
>dbj|AK034140.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched library, clone:9330159F11 product:adaptor protein complex AP-1, beta 1 subunit, full insert sequence Length = 4253 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 557 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 595 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 768 tggctgtgaggactatgggctgcatccg 795
>dbj|AK211687.1| Mus musculus cDNA, clone:Y2G0122I18, strand:unspecified Length = 462 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 367 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 405
>dbj|AK180383.1| Mus musculus cDNA, clone:Y0G0114A03, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000009234, based on BLAT search Length = 355 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 150 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 188
>emb|Y07919.1|MMBPRADPR M.musculus mRNA for beta-prime-adaptin protein Length = 3885 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| |||||||||| || ||||||||| Sbjct: 212 aagaaagtgattgcatcaatgactgtgggcaaagatgtc 250 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 423 tggctgtgaggactatgggctgcatccg 450
>gb|BC063350.1| Xenopus tropicalis adaptor-related protein complex 2, beta 1 subunit, mRNA (cDNA clone MGC:75877 IMAGE:5383070), complete cds Length = 3913 Score = 52.0 bits (26), Expect = 0.002 Identities = 119/150 (79%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacg 297 ||||| ||||| || ||||| |||||||| || || ||||||||| || ||||| | Sbjct: 314 gctgtgaagaaggttattgctgcaatgaccgtgggcaaagatgtcagctccctgtttcca 373 Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||| || || || |||| ||||| ||||| || ||| | || Sbjct: 374 gatgtggtgaactgcatgcaaacagacaatctggaactgaagaaacttgtttacctttac 433 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||||||||| ||||||||| Sbjct: 434 ctgatgaactatgctaaaagccaaccagac 463
>ref|NM_080583.1| Rattus norvegicus adaptor-related protein complex 2, beta 1 subunit (Ap2b1), mRNA Length = 5413 Score = 52.0 bits (26), Expect = 0.002 Identities = 74/90 (82%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||||||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 296 gatgtggtgaactgtatgcagactgacaacctggaactaaagaagcttgtgtacctctat 355 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 356 ctgatgaactatgccaagagtcagccagac 385
>gb|BC103481.1| Rattus norvegicus adaptor-related protein complex 2, beta 1 subunit, mRNA (cDNA clone MGC:124574 IMAGE:7929959), complete cds Length = 5394 Score = 52.0 bits (26), Expect = 0.002 Identities = 74/90 (82%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||||||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 265 gatgtggtgaactgtatgcagactgacaacctggaactaaagaagcttgtgtacctctat 324 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 325 ctgatgaactatgccaagagtcagccagac 354
>gb|AC118772.5| Rattus norvegicus 10 BAC CH230-404C20 (Children's Hospital Oakland Research Institute) complete sequence Length = 178272 Score = 52.0 bits (26), Expect = 0.002 Identities = 74/90 (82%) Strand = Plus / Minus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||||||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 35080 gatgtggtgaactgtatgcagactgacaacctggaactaaagaagcttgtgtacctctat 35021 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 35020 ctgatgaactatgccaagagtcagccagac 34991
>ref|NM_203875.1| Xenopus tropicalis adaptor-related protein complex 2, beta 1 subunit (ap2b1), mRNA Length = 3913 Score = 52.0 bits (26), Expect = 0.002 Identities = 119/150 (79%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacg 297 ||||| ||||| || ||||| |||||||| || || ||||||||| || ||||| | Sbjct: 314 gctgtgaagaaggttattgctgcaatgaccgtgggcaaagatgtcagctccctgtttcca 373 Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||| || || || |||| ||||| ||||| || ||| | || Sbjct: 374 gatgtggtgaactgcatgcaaacagacaatctggaactgaagaaacttgtttacctttac 433 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||||||||| ||||||||| Sbjct: 434 ctgatgaactatgctaaaagccaaccagac 463
>gb|M77246.1|RATBCCAPB R.norvegicus beta-chain clathrin associated protein complex AP-2 mRNA, complete cds Length = 5413 Score = 52.0 bits (26), Expect = 0.002 Identities = 74/90 (82%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||||||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 296 gatgtggtgaactgtatgcagactgacaacctggaactaaagaagcttgtgtacctctat 355 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 356 ctgatgaactatgccaagagtcagccagac 385
>gb|M34176.1|RATBADPTA Rat beta adaptin mRNA, complete cds Length = 3477 Score = 52.0 bits (26), Expect = 0.002 Identities = 74/90 (82%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||||||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 228 gatgtggtgaactgtatgcagactgacaacctggaactaaagaagcttgtgtacctctat 287 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 288 ctgatgaactatgccaagagtcagccagac 317
>ref|XM_778670.1| PREDICTED: Strongylocentrotus purpuratus similar to CG12532-PA (LOC578506), partial mRNA Length = 1167 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 |||||||| |||||| ||||| || |||||||||||| || ||||| | ||||| Sbjct: 103 aagaaagtcattgcaagcatgacagtcggaaaagatgtcagctctctgtttccagatgtg 162 Query: 304 gtgaactgtatgcagactgagaacttggagctgaaaaaact 344 |||||||| ||||||||||| ||| | |||||||| ||||| Sbjct: 163 gtgaactgcatgcagactgacaaccttgagctgaagaaact 203
>ref|XM_796939.1| PREDICTED: Strongylocentrotus purpuratus similar to Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain), transcript variant 8 (LOC577543), mRNA Length = 4175 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 |||||||| |||||| ||||| || |||||||||||| || ||||| | ||||| Sbjct: 103 aagaaagtcattgcaagcatgacagtcggaaaagatgtcagctctctgtttccagatgtg 162 Query: 304 gtgaactgtatgcagactgagaacttggagctgaaaaaact 344 |||||||| ||||||||||| ||| | |||||||| ||||| Sbjct: 163 gtgaactgcatgcagactgacaaccttgagctgaagaaact 203
>ref|XM_796917.1| PREDICTED: Strongylocentrotus purpuratus similar to Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain), transcript variant 7 (LOC577543), mRNA Length = 4250 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 |||||||| |||||| ||||| || |||||||||||| || ||||| | ||||| Sbjct: 103 aagaaagtcattgcaagcatgacagtcggaaaagatgtcagctctctgtttccagatgtg 162 Query: 304 gtgaactgtatgcagactgagaacttggagctgaaaaaact 344 |||||||| ||||||||||| ||| | |||||||| ||||| Sbjct: 163 gtgaactgcatgcagactgacaaccttgagctgaagaaact 203
>ref|XM_796885.1| PREDICTED: Strongylocentrotus purpuratus similar to Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain), transcript variant 6 (LOC577543), mRNA Length = 4139 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 |||||||| |||||| ||||| || |||||||||||| || ||||| | ||||| Sbjct: 103 aagaaagtcattgcaagcatgacagtcggaaaagatgtcagctctctgtttccagatgtg 162 Query: 304 gtgaactgtatgcagactgagaacttggagctgaaaaaact 344 |||||||| ||||||||||| ||| | |||||||| ||||| Sbjct: 163 gtgaactgcatgcagactgacaaccttgagctgaagaaact 203
>ref|XM_796857.1| PREDICTED: Strongylocentrotus purpuratus similar to Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain), transcript variant 5 (LOC577543), mRNA Length = 4175 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 |||||||| |||||| ||||| || |||||||||||| || ||||| | ||||| Sbjct: 103 aagaaagtcattgcaagcatgacagtcggaaaagatgtcagctctctgtttccagatgtg 162 Query: 304 gtgaactgtatgcagactgagaacttggagctgaaaaaact 344 |||||||| ||||||||||| ||| | |||||||| ||||| Sbjct: 163 gtgaactgcatgcagactgacaaccttgagctgaagaaact 203
>ref|XM_796809.1| PREDICTED: Strongylocentrotus purpuratus similar to Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain), transcript variant 4 (LOC577543), mRNA Length = 4238 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 |||||||| |||||| ||||| || |||||||||||| || ||||| | ||||| Sbjct: 103 aagaaagtcattgcaagcatgacagtcggaaaagatgtcagctctctgtttccagatgtg 162 Query: 304 gtgaactgtatgcagactgagaacttggagctgaaaaaact 344 |||||||| ||||||||||| ||| | |||||||| ||||| Sbjct: 163 gtgaactgcatgcagactgacaaccttgagctgaagaaact 203
>ref|XM_796763.1| PREDICTED: Strongylocentrotus purpuratus similar to Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain), transcript variant 3 (LOC577543), mRNA Length = 4127 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 |||||||| |||||| ||||| || |||||||||||| || ||||| | ||||| Sbjct: 103 aagaaagtcattgcaagcatgacagtcggaaaagatgtcagctctctgtttccagatgtg 162 Query: 304 gtgaactgtatgcagactgagaacttggagctgaaaaaact 344 |||||||| ||||||||||| ||| | |||||||| ||||| Sbjct: 163 gtgaactgcatgcagactgacaaccttgagctgaagaaact 203
>ref|XM_796695.1| PREDICTED: Strongylocentrotus purpuratus similar to Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain), transcript variant 2 (LOC577543), mRNA Length = 3003 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 |||||||| |||||| ||||| || |||||||||||| || ||||| | ||||| Sbjct: 103 aagaaagtcattgcaagcatgacagtcggaaaagatgtcagctctctgtttccagatgtg 162 Query: 304 gtgaactgtatgcagactgagaacttggagctgaaaaaact 344 |||||||| ||||||||||| ||| | |||||||| ||||| Sbjct: 163 gtgaactgcatgcagactgacaaccttgagctgaagaaact 203
>ref|XM_774827.1| PREDICTED: Strongylocentrotus purpuratus similar to Adapter-related protein complex 1 beta 1 subunit (Beta-adaptin 1) (Adaptor protein complex AP-1 beta-1 subunit) (Golgi adaptor HA1/AP1 adaptin beta subunit) (Clathrin assembly protein complex 1 beta large chain), transcript variant 1 (LOC577543), mRNA Length = 4253 Score = 50.1 bits (25), Expect = 0.007 Identities = 82/101 (81%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgtt 303 |||||||| |||||| ||||| || |||||||||||| || ||||| | ||||| Sbjct: 103 aagaaagtcattgcaagcatgacagtcggaaaagatgtcagctctctgtttccagatgtg 162 Query: 304 gtgaactgtatgcagactgagaacttggagctgaaaaaact 344 |||||||| ||||||||||| ||| | |||||||| ||||| Sbjct: 163 gtgaactgcatgcagactgacaaccttgagctgaagaaact 203
>emb|AL929354.1|PFA929354 Plasmodium falciparum strain 3D7, chromosome 5, segment 4/4 Length = 340552 Score = 50.1 bits (25), Expect = 0.007 Identities = 55/65 (84%) Strand = Plus / Minus Query: 253 attgcagcaatgactgttggaaaagatgtctcatcattgtttacggatgttgtgaactgt 312 ||||| || ||||||||||| ||||||||||| |||| ||| | ||||||||||| || Sbjct: 158436 attgctgctatgactgttgggaaagatgtctcgacattattttctgatgttgtgaattgc 158377 Query: 313 atgca 317 ||||| Sbjct: 158376 atgca 158372
>emb|CR936854.1| Zebrafish DNA sequence from clone RP71-BGZ91K11 in linkage group 5, complete sequence Length = 98528 Score = 50.1 bits (25), Expect = 0.007 Identities = 46/53 (86%) Strand = Plus / Plus Query: 430 gatccaaatccactgatccgtgctttggctgtgaggacaatgggttgcatccg 482 |||||||| || |||||||||||| |||||||| | || |||||||| ||||| Sbjct: 94964 gatccaaaccctctgatccgtgctctggctgtgcgcacgatgggttgtatccg 95016
>gb|BC066566.1| Danio rerio adaptor-related protein complex 2, beta 1 subunit, mRNA (cDNA clone MGC:76931 IMAGE:6524686), complete cds Length = 4107 Score = 50.1 bits (25), Expect = 0.007 Identities = 46/53 (86%) Strand = Plus / Plus Query: 430 gatccaaatccactgatccgtgctttggctgtgaggacaatgggttgcatccg 482 |||||||| || |||||||||||| |||||||| | || |||||||| ||||| Sbjct: 407 gatccaaaccctctgatccgtgctctggctgtgcgcacgatgggttgtatccg 459
>gb|AC135795.21| Medicago truncatula clone mth2-28g10, complete sequence Length = 110937 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Plus Query: 146 acgactccaagtacttctccaccaccaaaaagggggagatccccgagct 194 |||||||||||||||||||| |||| || ||||| || ||||| ||||| Sbjct: 11116 acgactccaagtacttctcccccacgaagaagggtgaaatccctgagct 11164
>gb|AC150889.3| Medicago truncatula chromosome 7 BAC clone mte1-61j12, complete sequence Length = 116517 Score = 50.1 bits (25), Expect = 0.007 Identities = 43/49 (87%) Strand = Plus / Minus Query: 146 acgactccaagtacttctccaccaccaaaaagggggagatccccgagct 194 |||||||||||||||||||| |||| || ||||| || ||||| ||||| Sbjct: 13047 acgactccaagtacttctcccccacgaagaagggtgaaatccctgagct 12999
>ref|NM_199919.2| Danio rerio adaptor-related protein complex 2, beta 1 subunit (ap2b1), mRNA Length = 4107 Score = 50.1 bits (25), Expect = 0.007 Identities = 46/53 (86%) Strand = Plus / Plus Query: 430 gatccaaatccactgatccgtgctttggctgtgaggacaatgggttgcatccg 482 |||||||| || |||||||||||| |||||||| | || |||||||| ||||| Sbjct: 407 gatccaaaccctctgatccgtgctctggctgtgcgcacgatgggttgtatccg 459
>emb|AL935280.12| Zebrafish DNA sequence from clone DKEY-261J4, complete sequence Length = 221563 Score = 50.1 bits (25), Expect = 0.007 Identities = 46/53 (86%) Strand = Plus / Minus Query: 430 gatccaaatccactgatccgtgctttggctgtgaggacaatgggttgcatccg 482 |||||||| || |||||||||||| |||||||| | || |||||||| ||||| Sbjct: 23666 gatccaaaccctctgatccgtgctctggctgtgcgcacgatgggttgtatccg 23614
>gb|BC049138.1| Danio rerio adaptor-related protein complex 2, beta 1 subunit, mRNA (cDNA clone MGC:55659 IMAGE:3815390), complete cds Length = 3892 Score = 50.1 bits (25), Expect = 0.007 Identities = 46/53 (86%) Strand = Plus / Plus Query: 430 gatccaaatccactgatccgtgctttggctgtgaggacaatgggttgcatccg 482 |||||||| || |||||||||||| |||||||| | || |||||||| ||||| Sbjct: 346 gatccaaaccctctgatccgtgctctggctgtgcgcacgatgggttgtatccg 398
>ref|XM_681550.1| PREDICTED: Danio rerio similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 1 (LOC562166), mRNA Length = 4547 Score = 48.1 bits (24), Expect = 0.027 Identities = 84/104 (80%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaagatgtctcatcattgtttacg 297 ||||| ||||| || |||||| | ||||| ||||||||||||||| | ||||| | Sbjct: 371 gctgtgaagaaggtcattgcatctatgaccgttggaaaagatgtcagtgctctgtttcct 430 Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaa 341 |||||||| ||||| |||||||| || ||| |||| |||||||| Sbjct: 431 gatgttgtcaactgcatgcagacagataacctggaactgaaaaa 474
>dbj|AB169049.1| Macaca fascicularis testis cDNA, clone: QtsA-16864, similar to human adaptor-related protein complex 2, beta 1 subunit(AP2B1), mRNA, RefSeq: NM_001282.1 Length = 1322 Score = 48.1 bits (24), Expect = 0.027 Identities = 39/44 (88%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgactgt 269 |||||||| || ||||| |||||||||||||| || |||||||| Sbjct: 206 aagagaaaggaggctgtgaagaaagtgattgctgctatgactgt 249
>ref|XM_582607.2| PREDICTED: Bos taurus similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 1 (LOC506192), mRNA Length = 3846 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 183 gtgaactgtatgcagacagacaacctggagctgaa 217
>ref|XM_865584.1| PREDICTED: Bos taurus similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 2 (LOC506192), mRNA Length = 3816 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 183 gtgaactgtatgcagacagacaacctggagctgaa 217
>ref|XM_876374.1| PREDICTED: Bos taurus similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 8 (LOC506192), mRNA Length = 3837 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 183 gtgaactgtatgcagacagacaacctggagctgaa 217
>ref|XM_876313.1| PREDICTED: Bos taurus similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 7 (LOC506192), mRNA Length = 4076 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 452 gtgaactgtatgcagacagacaacctggagctgaa 486
>ref|XM_876248.1| PREDICTED: Bos taurus similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 6 (LOC506192), mRNA Length = 3858 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 183 gtgaactgtatgcagacagacaacctggagctgaa 217
>ref|XM_876183.1| PREDICTED: Bos taurus similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 5 (LOC506192), mRNA Length = 3801 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 183 gtgaactgtatgcagacagacaacctggagctgaa 217
>ref|XM_876061.1| PREDICTED: Bos taurus similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 3 (LOC506192), mRNA Length = 3807 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 183 gtgaactgtatgcagacagacaacctggagctgaa 217
>ref|XR_003087.1| PREDICTED: Mus musculus similar to adaptor-related protein complex 2, beta 1 subunit (LOC384042), mRNA Length = 2853 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttgga 332 ||||| |||||||||||||||||||| ||| |||| Sbjct: 182 gatgtggtgaactgtatgcagactgacaacctgga 216
>ref|XM_860149.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 4 (LOC486344), mRNA Length = 2969 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 303 gtgaactgtatgcagacagacaacctggagctgaa 337
>ref|XM_847105.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 3 (LOC486344), mRNA Length = 2990 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 303 gtgaactgtatgcagacagacaacctggagctgaa 337
>ref|XM_543470.2| PREDICTED: Canis familiaris similar to adaptor-related protein complex 1 beta 1 subunit isoform b, transcript variant 1 (LOC486344), mRNA Length = 2960 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 303 gtgaactgtatgcagacagacaacctggagctgaa 337
>emb|Z83839.1|HS127L4 Human DNA sequence from clone RP1-127L4 on chromosome 22 Contains the 3' end of the SLC5A1 gene for solute carrier family 5 (sodiumglucose transporter) member 1, an adaptin, beta 1-like 1 pseudogene (ADTB1L1), an adaptin, beta 1-like 2 pseudogene (ADTB1L2) and the 3' end of a novel gene, complete sequence Length = 47812 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| ||||||| || || ||||||||| Sbjct: 24660 aagaaagtgattgcatcaatgaccgtgggcaaagatgtc 24698
>gb|BC105429.1| Bos taurus similar to adaptor-related protein complex 1 beta 1 subunit isoform b, mRNA (cDNA clone MGC:128441 IMAGE:7984158), complete cds Length = 4015 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactgagaacttggagctgaa 338 ||||||||||||||||| || ||| |||||||||| Sbjct: 303 gtgaactgtatgcagacagacaacctggagctgaa 337
>ref|NG_002624.1| Homo sapiens adaptin, beta 1-like 2 (ADTB1L2) pseudogene on chromosome 22 Length = 302 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| ||||||| || || ||||||||| Sbjct: 167 aagaaagtgattgcatcaatgaccgtgggcaaagatgtc 205
>ref|NM_017277.1| Rattus norvegicus adaptor protein complex AP-1, beta 1 subunit (Ap1b1), mRNA Length = 3679 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| ||||||| || || ||||||||| Sbjct: 142 aagaaagtgattgcatcaatgaccgtgggcaaagatgtc 180 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 353 tggctgtgaggactatgggctgcatccg 380
>gb|M77245.1|RATBCCAPA R.norvegicus beta'-chain clathrin associated protein complex AP-1 mRNA, complete cds Length = 3679 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||||||||||||| ||||||| || || ||||||||| Sbjct: 142 aagaaagtgattgcatcaatgaccgtgggcaaagatgtc 180 Score = 40.1 bits (20), Expect = 6.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 455 tggctgtgaggacaatgggttgcatccg 482 ||||||||||||| ||||| |||||||| Sbjct: 353 tggctgtgaggactatgggctgcatccg 380
>emb|AL645473.12| Mouse DNA sequence from clone RP23-246H17 on chromosome 4, complete sequence Length = 162757 Score = 46.1 bits (23), Expect = 0.11 Identities = 32/35 (91%) Strand = Plus / Minus Query: 298 gatgttgtgaactgtatgcagactgagaacttgga 332 ||||| |||||||||||||||||||| ||| |||| Sbjct: 151299 gatgtggtgaactgtatgcagactgacaacctgga 151265
>ref|XM_636754.1| Dictyostelium discoideum hypothetical protein (DDB0204689), partial mRNA Length = 2829 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 244 aagaaagtgattgcagcaatgactgttggaaaagatgt 281 ||||| || |||||||||||||| ||||| |||||||| Sbjct: 103 aagaaggtaattgcagcaatgacagttggtaaagatgt 140
>ref|XM_848630.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 3 (LOC480605), mRNA Length = 3379 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862736.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 18 (LOC480605), mRNA Length = 3346 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862726.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 17 (LOC480605), mRNA Length = 3370 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862718.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 16 (LOC480605), mRNA Length = 3280 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862711.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 15 (LOC480605), mRNA Length = 3319 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862704.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 14 (LOC480605), mRNA Length = 3328 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862697.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 13 (LOC480605), mRNA Length = 3256 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_537725.2| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 2 (LOC480605), mRNA Length = 3400 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862680.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 12 (LOC480605), mRNA Length = 3292 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862671.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 11 (LOC480605), mRNA Length = 3334 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862664.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 10 (LOC480605), mRNA Length = 3338 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862654.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 9 (LOC480605), mRNA Length = 3353 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862645.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 8 (LOC480605), mRNA Length = 3289 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862634.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 7 (LOC480605), mRNA Length = 3238 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862614.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 5 (LOC480605), mRNA Length = 811 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 236 gctgtgaagaaagtgattgctgccatgactgtgggaaa 273
>ref|XM_862605.1| PREDICTED: Canis familiaris similar to adaptor-related protein complex 2, beta 1 subunit, transcript variant 4 (LOC480605), mRNA Length = 3350 Score = 44.1 bits (22), Expect = 0.42 Identities = 34/38 (89%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaa 275 ||||| |||||||||||||| || |||||||| ||||| Sbjct: 249 gctgtgaagaaagtgattgctgccatgactgtgggaaa 286
>emb|AL603711.6| Mouse DNA sequence from clone RP23-381B19 on chromosome 11 Contains the 3' end of the Slfn3 gene for schlafen 3, a novel gene, two schlafen (Slfn) pseudogenes, the Pex12 gene for peroxisomal biogenesis factor 12 and the Ap2b1 gene for adaptor-related protein complex 2 beta 1 subunit, complete sequence Length = 204523 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Minus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 84264 gatgtggtgaactgcatgcagactgacaacctggaactaaagaagctcgtgtacctctat 84205 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 84204 ctgatgaactatgccaagagtcagccagac 84175
>gb|AC124036.5| Mus Musculus Strain C57BL6/J chromosome 11 BAC Clone RP24-100D7, Complete Sequence, complete sequence Length = 228907 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 68076 gatgtggtgaactgcatgcagactgacaacctggaactaaagaagctcgtgtacctctat 68135 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 68136 ctgatgaactatgccaagagtcagccagac 68165
>ref|NM_027915.3| Mus musculus adaptor-related protein complex 2, beta 1 subunit (Ap2b1), transcript variant 2, mRNA Length = 5369 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 321 gatgtggtgaactgcatgcagactgacaacctggaactaaagaagctcgtgtacctctat 380 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 381 ctgatgaactatgccaagagtcagccagac 410
>ref|NM_001035854.2| Mus musculus adaptor-related protein complex 2, beta 1 subunit (Ap2b1), transcript variant 1, mRNA Length = 5411 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 321 gatgtggtgaactgcatgcagactgacaacctggaactaaagaagctcgtgtacctctat 380 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 381 ctgatgaactatgccaagagtcagccagac 410
>dbj|AK138434.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched library, clone:A230106K07 product:adaptor-related protein complex 2, beta 1 subunit, full insert sequence Length = 5406 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 322 gatgtggtgaactgcatgcagactgacaacctggaactaaagaagctcgtgtacctctat 381 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 382 ctgatgaactatgccaagagtcagccagac 411
>dbj|AK032617.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length enriched library, clone:6430706O21 product:adaptor-related protein complex 2, beta 1 subunit, full insert sequence Length = 3595 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 284 gatgtggtgaactgcatgcagactgacaacctggaactaaagaagctcgtgtacctctat 343 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 344 ctgatgaactatgccaagagtcagccagac 373
>emb|CR385856.1| Gallus gallus finished cDNA, clone ChEST206j22 Length = 1682 Score = 44.1 bits (22), Expect = 0.42 Identities = 25/26 (96%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactga 323 |||||||||||||| ||||||||||| Sbjct: 45 gatgttgtgaactgcatgcagactga 70
>dbj|AK004975.1| Mus musculus adult male liver cDNA, RIKEN full-length enriched library, clone:1300012O03 product:adaptor-related protein complex 2, beta 1 subunit, full insert sequence Length = 3270 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 245 gatgtggtgaactgcatgcagactgacaacctggaactaaagaagctcgtgtacctctat 304 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 305 ctgatgaactatgccaagagtcagccagac 334
>dbj|AP000824.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-678L3, complete sequence Length = 186915 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 232 aaagatgctgtcaagaaagtga 253 |||||||||||||||||||||| Sbjct: 20320 aaagatgctgtcaagaaagtga 20299
>dbj|AP003486.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-890B15, complete sequence Length = 217479 Score = 44.1 bits (22), Expect = 0.42 Identities = 22/22 (100%) Strand = Plus / Minus Query: 232 aaagatgctgtcaagaaagtga 253 |||||||||||||||||||||| Sbjct: 90980 aaagatgctgtcaagaaagtga 90959
>gb|BC046772.1| Mus musculus adaptor-related protein complex 2, beta 1 subunit, transcript variant 1, mRNA (cDNA clone MGC:61224 IMAGE:5708062), complete cds Length = 3038 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 293 gatgtggtgaactgcatgcagactgacaacctggaactaaagaagctcgtgtacctctat 352 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 353 ctgatgaactatgccaagagtcagccagac 382
>gb|AC151352.2| Xenopus tropicalis clone ISB-48G11, complete sequence Length = 48240 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||| || || || |||| ||||| ||||| || ||| | || Sbjct: 16111 gatgtggtgaactgcatgcaaacagacaatctggaactgaagaaacttgtttacctttac 16170 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||||||||| ||||||||| Sbjct: 16171 ctgatgaactatgctaaaagccaaccagac 16200
>emb|AL713883.1|CNS07YP0 Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6) clone 179H3 of library Caltech CITB-BAC from chromosome 11 of Mus musculus (mouse) Length = 168835 Score = 44.1 bits (22), Expect = 0.42 Identities = 73/90 (81%) Strand = Plus / Plus Query: 298 gatgttgtgaactgtatgcagactgagaacttggagctgaaaaaactagtatacttatat 357 ||||| |||||||| ||||||||||| ||| |||| || || || || || ||| | ||| Sbjct: 125668 gatgtggtgaactgcatgcagactgacaacctggaactaaagaagctcgtgtacctctat 125727 Query: 358 ctcatcaactatgctaaaagtcaaccagac 387 || || |||||||| || ||||| |||||| Sbjct: 125728 ctgatgaactatgccaagagtcagccagac 125757
>ref|NM_001030006.1| Homo sapiens adaptor-related protein complex 2, beta 1 subunit (AP2B1), transcript variant 1, mRNA Length = 5772 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 274 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 314 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 352 gtgaactgtatgcagactga 371
>ref|NM_001282.2| Homo sapiens adaptor-related protein complex 2, beta 1 subunit (AP2B1), transcript variant 2, mRNA Length = 5730 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 274 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 314 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 352 gtgaactgtatgcagactga 371
>ref|XM_511415.1| PREDICTED: Pan troglodytes similar to adaptor-related protein complex 2, beta 1 subunit; beta adaptin (LOC454587), mRNA Length = 3324 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 514 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 554 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 592 gtgaactgtatgcagactga 611
>ref|XM_866869.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 2 (AP2B1), mRNA Length = 5536 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_879185.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 15 (AP2B1), mRNA Length = 5434 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_879164.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 14 (AP2B1), mRNA Length = 5476 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_879135.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 13 (AP2B1), mRNA Length = 5497 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_879107.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 12 (AP2B1), mRNA Length = 5485 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_879081.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 11 (AP2B1), mRNA Length = 5413 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_879048.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 10 (AP2B1), mRNA Length = 5479 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_879012.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 9 (AP2B1), mRNA Length = 5491 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_878986.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 8 (AP2B1), mRNA Length = 5446 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_591504.2| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 1 (AP2B1), mRNA Length = 2947 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_878933.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 7 (AP2B1), mRNA Length = 5380 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 206 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 246
>ref|XM_878905.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 6 (AP2B1), mRNA Length = 1799 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_878878.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 5 (AP2B1), mRNA Length = 5494 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 221 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 261
>ref|XM_878849.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 4 (AP2B1), mRNA Length = 5479 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 206 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 246
>ref|XM_878816.1| PREDICTED: Bos taurus adaptor-related protein complex 2, beta 1 subunit, transcript variant 3 (AP2B1), mRNA Length = 5479 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 206 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 246
>gb|AY341427.1| Homo sapiens beta adaptin subunit mRNA, complete cds; alternatively spliced Length = 3457 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 223 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 263 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 387 gtgaactgtatgcagactga 406
>emb|AL136124.10| Human DNA sequence from clone RP4-792D7 on chromosome 1q42.2-43 Contains the 5' end of the TARBP1 gene for TAR (HIV) RNA binding protein 1 and a CpG island, complete sequence Length = 104632 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 227 agagaaaagatgctgtcaagaaagt 251 |||||||||||||| |||||||||| Sbjct: 56000 agagaaaagatgctttcaagaaagt 56024
>emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete genome; segment 18/29 Length = 292100 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 84 agccggaggcggtgaccggtgtgta 108 |||||| |||||||||||||||||| Sbjct: 233754 agccgggggcggtgaccggtgtgta 233730
>gb|AF367600.1| Merxmuellera disticha internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence Length = 597 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 24 ggcaggccgcccgccaccgcgcgca 48 ||||||||| ||||||||||||||| Sbjct: 190 ggcaggccgaccgccaccgcgcgca 166
>emb|CR860139.1| Pongo pygmaeus mRNA; cDNA DKFZp469O1619 (from clone DKFZp469O1619) Length = 3352 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 226 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 266 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 304 gtgaactgtatgcagactga 323
>emb|CR749392.1| Homo sapiens mRNA; cDNA DKFZp781K0743 (from clone DKFZp781K0743) Length = 3487 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 257 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 297 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 335 gtgaactgtatgcagactga 354
>gb|AC161478.5| Pan troglodytes BAC clone CH251-170F20 from chromosome unknown, complete sequence Length = 150487 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Minus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 111517 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 111477 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 104055 gtgaactgtatgcagactga 104036
>gb|AC159215.2| Pan troglodytes BAC clone CH251-458G5 from chromosome unknown, complete sequence Length = 208565 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 113927 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 113967 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 121390 gtgaactgtatgcagactga 121409
>emb|BX664747.11| Zebrafish DNA sequence from clone CH211-149D1 in linkage group 5, complete sequence Length = 115297 Score = 42.1 bits (21), Expect = 1.7 Identities = 39/45 (86%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaagatgtc 282 ||||| ||||| || |||||| | ||||| ||||||||||||||| Sbjct: 54058 gctgtgaagaaggtcattgcatctatgaccgttggaaaagatgtc 54102
>gb|AC019231.7| Homo sapiens BAC clone RP11-573O16 from 2, complete sequence Length = 187268 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 225 taagagaaaagatgctgtcaa 245 ||||||||||||||||||||| Sbjct: 67461 taagagaaaagatgctgtcaa 67441
>gb|AC004134.1|AC004134 Homo sapiens chromosome 17, clone hCIT.507_E_2, complete sequence Length = 119307 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Minus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 109556 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 109516 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 102109 gtgaactgtatgcagactga 102090
>gb|BC006201.2| Homo sapiens adaptor-related protein complex 2, beta 1 subunit, mRNA (cDNA clone MGC:3632 IMAGE:3532472), complete cds Length = 3427 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 181 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 221 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 259 gtgaactgtatgcagactga 278
>gb|M34175.1|HUMBADPTA Human beta adaptin mRNA, complete cds Length = 5701 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 226 aagagaaaagatgctgtcaagaaagtgattgcagcaatgac 266 |||||||| || ||||| |||||||||||||| || ||||| Sbjct: 262 aagagaaaggaggctgtgaagaaagtgattgctgctatgac 302 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 340 gtgaactgtatgcagactga 359
>gb|M34177.1|BOVBADPTA Cow beta adaptin mRNA, partial cds Length = 708 Score = 42.1 bits (21), Expect = 1.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 238 gctgtcaagaaagtgattgcagcaatgactgttggaaaaga 278 ||||| |||||||||||||| || |||||||| || ||||| Sbjct: 1 gctgtgaagaaagtgattgctgctatgactgtggggaaaga 41
>gb|AY819719.1| Sugarcane mosaic virus isolate FER-1 capsid protein (cp) gene, partial cds Length = 851 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AY819718.1| Sugarcane mosaic virus isolate PIR-2 capsid protein (cp) gene, partial cds Length = 886 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones BAC 799C8 and 122A5 hardness locus region Length = 160897 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 166 accaccaaaaagggggagat 185 |||||||||||||||||||| Sbjct: 38218 accaccaaaaagggggagat 38199
>gb|DQ227694.1| Sugarcane mosaic virus isolate GX-1 polyprotein gene, partial cds Length = 906 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 93 agctcaaggaggagctcaac 112
>gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 12, complete sequence Length = 906719 Score = 40.1 bits (20), Expect = 6.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 340 aaactagtatacttatatctcatcaactatgc 371 ||||| ||||| ||||||||||| |||||||| Sbjct: 49258 aaactcgtatatttatatctcatgaactatgc 49227
>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete sequence Length = 1194300 Score = 40.1 bits (20), Expect = 6.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 340 aaactagtatacttatatctcatcaactatgc 371 ||||| ||||| ||||||||||| |||||||| Sbjct: 13734 aaactcgtatatttatatctcatgaactatgc 13765
>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete genome Length = 3397754 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 agaacttggagctgaaaaaa 342 |||||||||||||||||||| Sbjct: 64970 agaacttggagctgaaaaaa 64951
>ref|XM_426433.1| PREDICTED: Gallus gallus similar to Butyrate response factor 1 (TIS11B protein) (EGF-inducible protein CMG1) (LOC428877), mRNA Length = 1326 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 ggccgcccgccaccgcgcgc 47 |||||||||||||||||||| Sbjct: 877 ggccgcccgccaccgcgcgc 858
>gb|AY590778.1| Sugarcane mosaic virus polyprotein mRNA, partial cds Length = 1812 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 717 agctcaaggaggagctcaac 736
>ref|XM_755086.1| Ustilago maydis 521 hypothetical protein (UM04032.1) partial mRNA Length = 2547 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 gctcaaggaggagctcaact 211 |||||||||||||||||||| Sbjct: 993 gctcaaggaggagctcaact 1012
>ref|XM_567942.1| Cryptococcus neoformans var. neoformans JEC21 clathrin binding protein (CNL03830) partial mRNA Length = 2435 Score = 40.1 bits (20), Expect = 6.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 340 aaactagtatacttatatctcatcaactatgc 371 ||||| ||||| ||||||||||| |||||||| Sbjct: 319 aaactcgtatatttatatctcatgaactatgc 350
>ref|XM_567943.1| Cryptococcus neoformans var. neoformans JEC21 clathrin binding protein (CNL03830) partial mRNA Length = 2366 Score = 40.1 bits (20), Expect = 6.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 340 aaactagtatacttatatctcatcaactatgc 371 ||||| ||||| ||||||||||| |||||||| Sbjct: 319 aaactcgtatatttatatctcatgaactatgc 350
>gb|AY363103.1|AY363102S2 Mus musculus diadenosine triphosphate hydrolase (Fhit) gene, exons 6 through 10 and partial cds Length = 688489 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 319 actgagaacttggagctgaaaaaa 342 |||||||| ||||||||||||||| Sbjct: 203554 actgagaagttggagctgaaaaaa 203577
>ref|XM_572541.1| Cryptococcus neoformans var. neoformans JEC21 clathrin binding protein (CNH03830) partial mRNA Length = 2435 Score = 40.1 bits (20), Expect = 6.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 340 aaactagtatacttatatctcatcaactatgc 371 ||||| ||||| ||||||||||| |||||||| Sbjct: 319 aaactcgtatatttatatctcatgaactatgc 350
>ref|XM_572542.1| Cryptococcus neoformans var. neoformans JEC21 clathrin binding protein (CNH03830) partial mRNA Length = 2366 Score = 40.1 bits (20), Expect = 6.6 Identities = 29/32 (90%) Strand = Plus / Plus Query: 340 aaactagtatacttatatctcatcaactatgc 371 ||||| ||||| ||||||||||| |||||||| Sbjct: 319 aaactcgtatatttatatctcatgaactatgc 350
>gb|DQ141605.1| Sugarcane mosaic virus polyprotein mRNA, partial cds Length = 2116 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 1950 agctcaaggaggagctcaac 1969
>gb|AC102431.7| Mus musculus chromosome 14, clone RP24-106J1, complete sequence Length = 157923 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 319 actgagaacttggagctgaaaaaa 342 |||||||| ||||||||||||||| Sbjct: 107441 actgagaagttggagctgaaaaaa 107418
>emb|AM040436.1| Sugarcane mosaic virus partial cp gene for coat protein, genomic RNA Length = 888 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>emb|AL359263.13| Human DNA sequence from clone RP13-88F20 on chromosome X Contains an adaptor-related protein complex 2, beta 1 subunit (AP2B1) pseudogene, complete sequence Length = 69518 Score = 40.1 bits (20), Expect = 6.6 Identities = 29/32 (90%) Strand = Plus / Minus Query: 226 aagagaaaagatgctgtcaagaaagtgattgc 257 |||||||| || ||||| |||||||||||||| Sbjct: 56270 aagagaaaggaggctgtgaagaaagtgattgc 56239 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 304 gtgaactgtatgcagactga 323 |||||||||||||||||||| Sbjct: 56192 gtgaactgtatgcagactga 56173
>gb|AC096051.7| Rattus norvegicus 10 BAC CH230-21G1 (Children's Hospital Oakland Research Institute) complete sequence Length = 216194 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 ttctccaccaccaaaaaggg 179 |||||||||||||||||||| Sbjct: 73276 ttctccaccaccaaaaaggg 73257
>emb|CR628337.1| Legionella pneumophila str. Lens complete genome Length = 3345687 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 agaacttggagctgaaaaaa 342 |||||||||||||||||||| Sbjct: 65039 agaacttggagctgaaaaaa 65020
>emb|AJ278405.1|SMO278405 Sugarcane mosaic virus genomic RNA for polyprotein (vp gene), strain A, isolate Brisbane Length = 9589 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 8472 agctcaaggaggagctcaac 8491
>gb|DQ438949.1| Sugarcane mosaic virus isolate KhzQ86 polyprotein gene, partial cds; and 3' UTR Length = 1815 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 717 agctcaaggaggagctcaac 736
>gb|AC020912.6| Homo sapiens chromosome 19 clone CTD-2583G20, complete sequence Length = 163225 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 155 agtacttctccaccaccaaa 174 |||||||||||||||||||| Sbjct: 135966 agtacttctccaccaccaaa 135985
>gb|DQ369960.1| Sugarcane mosaic virus isolate KhzL66 polyprotein gene, partial cds Length = 2002 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 903 agctcaaggaggagctcaac 922
>gb|AY836523.1| Sugarcane mosaic virus strain E polyprotein gene, partial cds Length = 1795 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 697 agctcaaggaggagctcaac 716
>gb|AY241923.1| Sugarcane mosaic virus nonfunctional polyprotein mRNA, partial sequence Length = 1330 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 231 agctcaaggaggagctcaac 250
>gb|AF090447.2| Zea mays 22 kDa alpha zein gene cluster, complete sequence Length = 346296 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 accaccaaaaagggggagat 185 |||||||||||||||||||| Sbjct: 317303 accaccaaaaagggggagat 317322
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 40.1 bits (20), Expect = 6.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 24 ggcaggccgcccgccaccgcgcgc 47 ||||| |||||||||||||||||| Sbjct: 2240950 ggcagcccgcccgccaccgcgcgc 2240973
>gb|AY943294.1| Hordeum vulgare subsp. vulgare clone BAC 673I14, complete sequence Length = 108608 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 accaccaaaaagggggagat 185 |||||||||||||||||||| Sbjct: 35304 accaccaaaaagggggagat 35323
>gb|DQ343236.1| Sugarcane mosaic virus nonfunctional coat protein gene, complete sequence Length = 899 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 85 agctcaaggaggagctcaac 104
>emb|BX247876.6| Zebrafish DNA sequence from clone CH211-271B14 in linkage group 5, complete sequence Length = 176246 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 406 aacacatttgttaaggattc 425 |||||||||||||||||||| Sbjct: 96682 aacacatttgttaaggattc 96701
>gb|AY953351.1| Sugarcane mosaic virus strain D polyprotein mRNA, partial cds Length = 1368 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 273 agctcaaggaggagctcaac 292
>emb|AJ491974.1|SMO491974 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate ZAF 54-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491973.1|SMO491973 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate ZAF 53-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491972.1|SMO491972 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate ZAF 52-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491970.1|SMO491970 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate USA Lou 45-1 Length = 840 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491969.1|SMO491969 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate USA Lou 44-1 Length = 840 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491968.1|SMO491968 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate USA Lou 43-1 Length = 840 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491967.1|SMO491967 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate USA Lou 42-1 Length = 840 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491966.1|SMO491966 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate USA Lou 41-1 Length = 828 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491965.1|SMO491965 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate USA Lou 40-1 Length = 828 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491964.1|SMO491964 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate USA Flo 8-1 Length = 840 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491963.1|SMO491963 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate EGY7-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491959.1|SMO491959 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON12-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491956.1|SMO491956 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON111-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491955.1|SMO491955 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON110-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491954.1|SMO491954 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON11-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491953.1|SMO491953 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON109-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491952.1|SMO491952 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON108-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491950.1|SMO491950 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON106-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491949.1|SMO491949 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON105-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491948.1|SMO491948 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON104-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|AJ491943.1|SMO491943 Sugarcane mosaic virus partial cp gene for capsid protein, genomic RNA, isolate CON10-1 Length = 852 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 63 agctcaaggaggagctcaac 82
>emb|Z30212.1|SCAPL2GE S.cerevisiae APL2 gene Length = 3033 Score = 40.1 bits (20), Expect = 6.6 Identities = 38/44 (86%) Strand = Plus / Plus Query: 397 cttgccgtgaacacatttgttaaggattcacaagatccaaatcc 440 |||||||| |||||||| ||| ||| |||||||||||||||| Sbjct: 717 cttgccgttaacacattcattactgatgcacaagatccaaatcc 760
>emb|Z28135.1|SCYKL136W S.cerevisiae chromosome XI reading frame ORF YKL136w Length = 2831 Score = 40.1 bits (20), Expect = 6.6 Identities = 38/44 (86%) Strand = Plus / Minus Query: 397 cttgccgtgaacacatttgttaaggattcacaagatccaaatcc 440 |||||||| |||||||| ||| ||| |||||||||||||||| Sbjct: 2054 cttgccgttaacacattcattactgatgcacaagatccaaatcc 2011
>emb|AL049829.4|CNS0000B Human chromosome 14 DNA sequence BAC R-124D2 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 196292 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 231 aaaagatgctgtcaagaaag 250 |||||||||||||||||||| Sbjct: 114981 aaaagatgctgtcaagaaag 114962
>gb|DQ332983.1| Synthetic construct Saccharomyces cerevisiae clone FLH112564.01X APL2 gene, complete sequence Length = 2181 Score = 40.1 bits (20), Expect = 6.6 Identities = 38/44 (86%) Strand = Plus / Plus Query: 397 cttgccgtgaacacatttgttaaggattcacaagatccaaatcc 440 |||||||| |||||||| ||| ||| |||||||||||||||| Sbjct: 295 cttgccgttaacacattcattactgatgcacaagatccaaatcc 338
>gb|DQ316252.1| Sugarcane mosaic virus isolate wd-sg polyprotein gene, partial cds Length = 862 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 93 agctcaaggaggagctcaac 112
>gb|DQ316251.1| Sugarcane mosaic virus isolate wd-dz polyprotein gene, partial cds Length = 866 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 94 agctcaaggaggagctcaac 113
>gb|DQ316250.1| Sugarcane mosaic virus isolate so-bl6 polyprotein gene, partial cds Length = 859 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 86 agctcaaggaggagctcaac 105
>gb|DQ316249.1| Sugarcane mosaic virus isolate so-bl5 polyprotein gene, partial cds Length = 860 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 93 agctcaaggaggagctcaac 112
>gb|DQ316248.1| Sugarcane mosaic virus isolate so-bl4 polyprotein gene, partial cds Length = 892 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 87 agctcaaggaggagctcaac 106
>gb|DQ316247.1| Sugarcane mosaic virus isolate so-bl2 polyprotein gene, partial cds Length = 851 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 53 agctcaaggaggagctcaac 72
>gb|DQ316244.1| Sugarcane mosaic virus isolate sh-wy polyprotein gene, partial cds Length = 822 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 54 agctcaaggaggagctcaac 73
>gb|DQ316243.1| Sugarcane mosaic virus isolate sh-sx polyprotein gene, partial cds Length = 842 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 71 agctcaaggaggagctcaac 90
>gb|DQ316242.1| Sugarcane mosaic virus isolate sh-nn polyprotein gene, partial cds Length = 778 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 47 agctcaaggaggagctcaac 66
>gb|DQ316240.1| Sugarcane mosaic virus isolate sh-hp2 polyprotein gene, partial cds Length = 859 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 93 agctcaaggaggagctcaac 112
>gb|DQ316239.1| Sugarcane mosaic virus isolate sh-hp1 polyprotein gene, partial cds Length = 856 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 93 agctcaaggaggagctcaac 112
>gb|DQ316238.1| Sugarcane mosaic virus isolate sh-gz4 polyprotein gene, partial cds Length = 843 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 86 agctcaaggaggagctcaac 105
>gb|DQ316236.1| Sugarcane mosaic virus isolate sh-gz2 polyprotein gene, partial cds Length = 854 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 87 agctcaaggaggagctcaac 106
>gb|DQ316235.1| Sugarcane mosaic virus isolate sh-gz1 polyprotein gene, partial cds Length = 860 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 87 agctcaaggaggagctcaac 106
>gb|DQ316234.1| Sugarcane mosaic virus isolate sh-dz polyprotein gene, partial cds Length = 780 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 48 agctcaaggaggagctcaac 67
>gb|DQ316232.1| Sugarcane mosaic virus isolate mz-gz2 polyprotein gene, partial cds Length = 828 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 78 agctcaaggaggagctcaac 97
>gb|AF006738.1|AF006738 Sugarcane mosaic virus coat protein gene, partial cds Length = 942 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AF006737.1|AF006737 Sugarcane mosaic virus coat protein gene, partial cds Length = 942 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AF006736.1|AF006736 Sugarcane mosaic virus coat protein gene, partial cds Length = 918 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AF006735.1|AF006735 Sugarcane mosaic virus coat protein gene, partial cds Length = 942 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AF006733.1|AF006733 Sugarcane mosaic virus coat protein gene, partial cds Length = 921 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AF006732.1|AF006732 Sugarcane mosaic virus coat protein gene, partial cds Length = 921 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AF006731.1|AF006731 Sugarcane mosaic virus coat protein gene, partial cds Length = 942 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AF006730.1|AF006730 Sugarcane mosaic virus coat protein gene, partial cds Length = 921 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AF006729.1|AF006729 Sugarcane mosaic virus coat protein gene, partial cds Length = 903 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|AF006728.1|AF006728 Sugarcane mosaic virus coat protein gene, partial cds Length = 942 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 75 agctcaaggaggagctcaac 94
>gb|U57354.1|SMU57354 Sugarcane mosaic virus strain A polyprotein mRNA, partial cds Length = 1977 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 903 agctcaaggaggagctcaac 922
>gb|U57357.1|SMU57357 Sugarcane mosaic virus strain E polyprotein mRNA, partial cds Length = 2001 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 903 agctcaaggaggagctcaac 922
>gb|U57356.1|SMU57356 Sugarcane mosaic virus strain D polyprotein mRNA, partial cds Length = 1989 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 903 agctcaaggaggagctcaac 922
>emb|AL671917.8| Mouse DNA sequence from clone RP23-217I18 on chromosome 3, complete sequence Length = 172826 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 320 ctgagaacttggagctgaaa 339 |||||||||||||||||||| Sbjct: 126920 ctgagaacttggagctgaaa 126939
>dbj|D00948.1|MSCCP Sugarcane mosaic virus mRNA for coat protein, partial cds Length = 1330 Score = 40.1 bits (20), Expect = 6.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 191 agctcaaggaggagctcaac 210 |||||||||||||||||||| Sbjct: 231 agctcaaggaggagctcaac 250 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,078,042 Number of Sequences: 3902068 Number of extensions: 4078042 Number of successful extensions: 120833 Number of sequences better than 10.0: 234 Number of HSP's better than 10.0 without gapping: 233 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 120191 Number of HSP's gapped (non-prelim): 633 length of query: 488 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 466 effective length of database: 17,147,199,772 effective search space: 7990595093752 effective search space used: 7990595093752 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)