ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bastl03b10 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 396 ggttagggttagacctatggggagcaccggcgagcccgatcggaagcggcggctc 450 |||||||||||| |||||||||||| || |||||||| ||||||||||||||| Sbjct: 56911 ggttagggttagggttatggggagcacgggggagcccgaccggaagcggcggctc 56857
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 396 ggttagggttagacctatggggagcaccggcgagcccgatcggaagcggcggctc 450 |||||||||||| |||||||||||| || |||||||| ||||||||||||||| Sbjct: 27532935 ggttagggttagggttatggggagcacgggggagcccgaccggaagcggcggctc 27532881
>ref|XM_473416.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2652 Score = 54.0 bits (27), Expect = 4e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 412 atggggagcaccggcgagcccgatcggaagcggcggctc 450 ||||||||||| || |||||||| ||||||||||||||| Sbjct: 1 atggggagcacgggggagcccgaccggaagcggcggctc 39
>gb|BC035821.1| Homo sapiens chromosome 20 open reading frame 172, mRNA (cDNA clone IMAGE:5553020), with apparent retained intron Length = 1640 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 68 tttctggagcctagacccttcgcacggca 96 |||||||||||||||||| | |||||||| Sbjct: 353 tttctggagcctagacccctggcacggca 325
>emb|AL132768.15|HSJ469A13 Human DNA sequence from clone RP3-469A13 on chromosome 20 Contains the 3' end of a novel gene, the C20orf172 gene for chromosome 20 open reading frame 172, the 5' end of the NDRG3 gene for NDRG family member 3 (N-myc downstream-regulated gene 3, FLJ13556) and four CpG islands, complete sequence Length = 123829 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 68 tttctggagcctagacccttcgcacggca 96 |||||||||||||||||| | |||||||| Sbjct: 72509 tttctggagcctagacccctggcacggca 72537
>gb|AC158132.6| Mus musculus chromosome 1, clone RP23-11K8, complete sequence Length = 231218 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 133 tctcaccctccccatctcctc 153 ||||||||||||||||||||| Sbjct: 174777 tctcaccctccccatctcctc 174797
>gb|AC105204.5| Homo sapiens chromosome 15, clone RP11-1087J2, complete sequence Length = 210658 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 233 caaaccctcaaaattttgctg 253 ||||||||||||||||||||| Sbjct: 195499 caaaccctcaaaattttgctg 195479
>gb|AC078905.5| Homo sapiens chromosome 15, clone RP11-138H10, complete sequence Length = 169102 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 233 caaaccctcaaaattttgctg 253 ||||||||||||||||||||| Sbjct: 16790 caaaccctcaaaattttgctg 16770
>gb|AC102491.19| Mus musculus chromosome 1, clone RP24-529L13, complete sequence Length = 190728 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 133 tctcaccctccccatctcctc 153 ||||||||||||||||||||| Sbjct: 150124 tctcaccctccccatctcctc 150104
>emb|AJ292274.1|NSY292274 Nicotiana sylvestris DNA flanking T-DNA insert line S22KdotNOSpro orphan R Length = 4753 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 107 cacctcacaccaaaaccaccg 127 ||||||||||||||||||||| Sbjct: 3719 cacctcacaccaaaaccaccg 3739
>gb|CP000027.1| Dehalococcoides ethenogenes 195, complete genome Length = 1469720 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 aatcccgaattcagccgcac 193 |||||||||||||||||||| Sbjct: 1169279 aatcccgaattcagccgcac 1169260
>ref|XM_463153.1| Oryza sativa (japonica cultivar-group), mRNA Length = 828 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 429 gcccgatcggaagcggcggc 448 |||||||||||||||||||| Sbjct: 611 gcccgatcggaagcggcggc 630
>gb|AC135500.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0034J04 map S1466, complete sequence Length = 140012 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 429 gcccgatcggaagcggcggc 448 |||||||||||||||||||| Sbjct: 114493 gcccgatcggaagcggcggc 114474
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 429 gcccgatcggaagcggcggc 448 |||||||||||||||||||| Sbjct: 22844562 gcccgatcggaagcggcggc 22844543
>ref|XM_540812.2| PREDICTED: Canis familiaris similar to T-cell, immune regulator 1 isoform a, transcript variant 1 (LOC483691), mRNA Length = 2689 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 gcggcgggctgggctggtgc 312 |||||||||||||||||||| Sbjct: 343 gcggcgggctgggctggtgc 362
>ref|XM_858982.1| PREDICTED: Canis familiaris similar to T-cell, immune regulator 1 isoform a, transcript variant 5 (LOC483691), mRNA Length = 2713 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 gcggcgggctgggctggtgc 312 |||||||||||||||||||| Sbjct: 343 gcggcgggctgggctggtgc 362
>ref|XM_858965.1| PREDICTED: Canis familiaris similar to T-cell, immune regulator 1 isoform a, transcript variant 4 (LOC483691), mRNA Length = 2676 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 gcggcgggctgggctggtgc 312 |||||||||||||||||||| Sbjct: 322 gcggcgggctgggctggtgc 341
>ref|XM_858943.1| PREDICTED: Canis familiaris similar to T-cell, immune regulator 1 isoform a, transcript variant 3 (LOC483691), mRNA Length = 2718 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 gcggcgggctgggctggtgc 312 |||||||||||||||||||| Sbjct: 322 gcggcgggctgggctggtgc 341
>gb|AY242112.1| Sus scrofa EWB tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28397 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26387 gtggcggcgggctgggctgg 26406
>gb|AY242111.1| Sus scrofa H205 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28190 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26213 gtggcggcgggctgggctgg 26232
>gb|AY242110.1| Sus scrofa H254 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28177 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26216 gtggcggcgggctgggctgg 26235
>gb|AY242109.1| Sus scrofa JWB tyrosine hydroxylase (TH) gene, exon 14; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28188 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26243 gtggcggcgggctgggctgg 26262
>gb|AY242108.1| Sus scrofa LRJ tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28209 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26265 gtggcggcgggctgggctgg 26284
>gb|AY242107.1| Sus scrofa LW1224 tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28658 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26514 gtggcggcgggctgggctgg 26533
>gb|AY242106.1| Sus scrofa LW1461 tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28658 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26514 gtggcggcgggctgggctgg 26533
>gb|AY242105.1| Sus scrofa LW197 tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28267 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26298 gtggcggcgggctgggctgg 26317
>gb|AY242104.1| Sus scrofa LW209 tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28684 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26540 gtggcggcgggctgggctgg 26559
>gb|AY242103.1| Sus scrofa LW3 tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28376 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26365 gtggcggcgggctgggctgg 26384
>gb|AY242102.1| Sus scrofa LW33361 tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28661 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26517 gtggcggcgggctgggctgg 26536
>gb|AY242101.1| Sus scrofa LW419 tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28659 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26515 gtggcggcgggctgggctgg 26534
>gb|AY242100.1| Sus scrofa LW463 tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28649 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26504 gtggcggcgggctgggctgg 26523
>gb|AY242099.1| Sus scrofa M220 tyrosine hydroxylase (TH) gene, exon 14; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28219 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26241 gtggcggcgggctgggctgg 26260
>gb|AY242098.1| Sus scrofa P208 tyrosine hydroxylase (TH) gene, exon 14 and partial cds; preproinsulin (INS) gene, complete cds; and insulin-like growth factor 2 preproprotein (IGF2) gene, complete cds, alternatively spliced Length = 28593 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 26449 gtggcggcgggctgggctgg 26468
>gb|AC136972.3| Oryza sativa chromosome 3 BAC OSJNBb0007E22 genomic sequence, complete sequence Length = 184783 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 429 gcccgatcggaagcggcggc 448 |||||||||||||||||||| Sbjct: 47092 gcccgatcggaagcggcggc 47073
>emb|AL356377.12| Human DNA sequence from clone RP11-147M1 on chromosome 1, complete sequence Length = 80552 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 343 tttgtgagtttgggaggctc 362 |||||||||||||||||||| Sbjct: 20713 tttgtgagtttgggaggctc 20694
>gb|AY305868.1| Oryza sativa (japonica cultivar-group) C2H2 type zinc finger transcription factor ZFP31 (ZFP31) mRNA, complete cds Length = 773 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 429 gcccgatcggaagcggcggc 448 |||||||||||||||||||| Sbjct: 556 gcccgatcggaagcggcggc 575
>emb|CR936218.6| Human DNA sequence from clone RP11-669E14, complete sequence Length = 213739 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 ccctccccatctcctcgatt 157 |||||||||||||||||||| Sbjct: 199723 ccctccccatctcctcgatt 199742
>gb|AY289189.1| Oryza sativa (japonica cultivar-group) zinc finger transcription factor OsZFP34 mRNA, complete cds Length = 730 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 429 gcccgatcggaagcggcggc 448 |||||||||||||||||||| Sbjct: 549 gcccgatcggaagcggcggc 568
>emb|CR932417.12| Human DNA sequence from clone XX-D_24I13, complete sequence Length = 198202 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 ccctccccatctcctcgatt 157 |||||||||||||||||||| Sbjct: 154861 ccctccccatctcctcgatt 154880
>gb|AY044828.1| Sus scrofa tyrosine hydroxylase gene, partial cds; and preproinsulin (INS) and insulin-like-growth factor 2 preproprotein (IGF2) genes, complete cds, alternatively spliced Length = 32467 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 gtggcggcgggctgggctgg 309 |||||||||||||||||||| Sbjct: 28502 gtggcggcgggctgggctgg 28521
>dbj|AB232924.1| Oryzias latipes hox gene cluster, complete cds, contains hoxDb Length = 220448 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 340 gtgtttgtgagtttgggagg 359 |||||||||||||||||||| Sbjct: 24462 gtgtttgtgagtttgggagg 24481
>gb|AC091628.2| Homo sapiens chromosome 17 map 17q21.1, complete sequence Length = 201397 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 ccctccccatctcctcgatt 157 |||||||||||||||||||| Sbjct: 8694 ccctccccatctcctcgatt 8675
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 429 gcccgatcggaagcggcggc 448 |||||||||||||||||||| Sbjct: 22837590 gcccgatcggaagcggcggc 22837571
>gb|AC010792.4|AC010792 Homo sapiens chromosome 17, clone -2524N8, complete sequence Length = 117406 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 ccctccccatctcctcgatt 157 |||||||||||||||||||| Sbjct: 4221 ccctccccatctcctcgatt 4202
>emb|BX544879.6| Human DNA sequence from clone RP11-769P22 on chromosome 17, complete sequence Length = 177152 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 ccctccccatctcctcgatt 157 |||||||||||||||||||| Sbjct: 137079 ccctccccatctcctcgatt 137098 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,761,252 Number of Sequences: 3902068 Number of extensions: 2761252 Number of successful extensions: 45028 Number of sequences better than 10.0: 45 Number of HSP's better than 10.0 without gapping: 45 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 44906 Number of HSP's gapped (non-prelim): 122 length of query: 467 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 445 effective length of database: 17,147,199,772 effective search space: 7630503898540 effective search space used: 7630503898540 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
