ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl02g12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC147427.2| Oryza sativa chromosome 3 B1394A07 genomic seque... 194 2e-46
2gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 194 2e-46
3dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 194 2e-46
4dbj|AK103284.1| Oryza sativa (japonica cultivar-group) cDNA clon... 194 2e-46
5dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
6dbj|AK102183.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
7gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 141 2e-30
8emb|AL713934.5|CNS07YPF Oryza sativa chromosome 12, . Partial se... 141 2e-30
9emb|AL713940.4|CNS07YPM Oryza sativa chromosome 12, . BAC OJ1327... 141 2e-30
10ref|NM_197030.1| Oryza sativa (japonica cultivar-group) putative... 86 1e-13
11gb|AY423716.1| Oryza sativa (japonica cultivar-group) homeodomai... 86 1e-13
12gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 geno... 86 1e-13
13dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
14dbj|AK102830.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
15dbj|AK102603.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 1e-13
16gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 86 1e-13
17gb|DQ385515.1| Phaeoceros carolinianus class III homeodomain-leu... 78 3e-11
18ref|NM_194843.1| Oryza sativa (japonica cultivar-group) putative... 72 2e-09
19gb|AC091665.3| Oryza sativa chromosome 10 clone OSJNBb0016M10, c... 72 2e-09
20dbj|AK059657.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
21ref|NM_188279.1| Oryza sativa (japonica cultivar-group), predic... 68 3e-08
22gb|AC133450.6| Oryza sativa chromosome 3 BAC OSJNBa0072F13 genom... 68 3e-08
23gb|AC107207.9| Oryza sativa chromosome 3 BAC OSJNBb0106M04 genom... 68 3e-08
24gb|DQ385532.1| Marchantia polymorpha class III homeodomain-leuci... 68 3e-08
25gb|DQ385514.1| Marchantia polymorpha class III homeodomain-leuci... 68 3e-08
26dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
27dbj|AP003197.4| Oryza sativa (japonica cultivar-group) genomic D... 68 3e-08
28dbj|AK100250.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 3e-08
29gb|DQ385520.1| Selaginella kraussiana class III homeodomain-leuc... 64 4e-07
30gb|DQ385539.1| Pseudotsuga menziesii class III homeodomain-leuci... 62 2e-06
31gb|DQ385528.1| Pseudotsuga menziesii class III homeodomain-leuci... 62 2e-06
32gb|DQ385540.1| Pseudotsuga menziesii class III homeodomain-leuci... 60 6e-06
33gb|DQ385529.1| Pseudotsuga menziesii class III homeodomain-leuci... 60 6e-06
34gb|DQ013803.1| Phyllostachys praecox HB1 mRNA, partial cds 58 3e-05
35gb|DQ385531.1| Taxus globosa class III homeodomain-leucine zippe... 58 3e-05
36emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete ... 54 4e-04
37ref|XM_468564.1| Oryza sativa (japonica cultivar-group), predic... 52 0.002
38gb|AY425991.1| Oryza sativa (japonica cultivar-group) homeodomai... 52 0.002
39emb|Y10293.1|SPSTTABCD Streptomyces spp. sttA, sttB, sttC, sttD ... 52 0.002
40dbj|AK110678.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
41dbj|AK102378.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
42gb|AC105733.2| Oryza sativa (japonica cultivar-group) chromosome... 52 0.002
43gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 50 0.006
44ref|NM_210848.1| Eremothecium gossypii AFL054Cp (AFL054C), mRNA 50 0.006
45gb|DQ216582.1| Taeniopygia guttata clone 0058P0041C09 malate deh... 48 0.024
46gb|DQ216580.1| Taeniopygia guttata clone 0058P0051G04 malate deh... 48 0.024
47gb|DQ216577.1| Taeniopygia guttata clone 0063P0023A06 malate deh... 48 0.024
48gb|DQ216576.1| Taeniopygia guttata clone 0063P0017D08 malate deh... 48 0.024
49gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 48 0.024
50gb|DQ216578.1| Taeniopygia guttata clone 0064P0018A04 malate deh... 46 0.096
51gb|AY501430.1| Zea mays rolled leaf1 mRNA, complete cds 46 0.096
52ref|XM_502214.1| Yarrowia lipolytica CLIB122, YALI0C24189g predi... 46 0.096
53emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete ... 46 0.096
54emb|AL939109.1|SCO939109 Streptomyces coelicolor A3(2) complete ... 46 0.096
55gb|DQ385533.1| Physcomitrella patens class III homeodomain-leuci... 46 0.096
56gb|DQ385516.1| Physcomitrella patens class III homeodomain-leuci... 46 0.096
57dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.096
58dbj|AP003634.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.096
59emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 46 0.096
60ref|NM_183008.1| Homo sapiens UBX domain containing 5 (UBXD5), t... 44 0.38
61ref|NM_146222.2| Mus musculus cDNA sequence BC024479 (BC024479),... 44 0.38
62gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chr... 44 0.38
63ref|XM_600204.2| PREDICTED: Bos taurus similar to potassium chan... 44 0.38
64gb|AC105958.11| Mus musculus chromosome 9, clone RP24-325P4, com... 44 0.38
65gb|AF370425.1| Homo sapiens PP2243 mRNA, complete cds 44 0.38
66ref|XM_541888.2| PREDICTED: Canis familiaris similar to DALR ant... 44 0.38
67gb|AF267536.2| Takifugu rubripes NKX2.9 (nkx2.9) gene, exons 1 a... 44 0.38
68ref|XM_538483.2| PREDICTED: Canis familiaris similar to potassiu... 44 0.38
69emb|CR732076.2|CNS0GRTD Tetraodon nigroviridis full-length cDNA 44 0.38
70emb|AL451139.40| Human DNA sequence from clone RP11-569G9 on chr... 44 0.38
71emb|BX648412.1|HSM808560 Homo sapiens mRNA; cDNA DKFZp686H22235 ... 44 0.38
72gb|AF521018.1| Homo sapiens SOCIUS protein isoform 2 mRNA, compl... 44 0.38
73gb|DQ385537.1| Psilotum nudum class III homeodomain-leucine zipp... 44 0.38
74emb|CR749413.1| Homo sapiens mRNA; cDNA DKFZp686F04228 (from clo... 44 0.38
75dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 44 0.38
76gb|DQ385521.1| Psilotum nudum class III homeodomain-leucine zipp... 44 0.38
77emb|CR625017.1| full-length cDNA clone CS0DK008YF07 of HeLa cell... 44 0.38
78dbj|AK097368.1| Homo sapiens cDNA FLJ40049 fis, clone SYNOV2001708 44 0.38
79emb|CR612365.1| full-length cDNA clone CS0DL007YI04 of B cells (... 44 0.38
80dbj|AK094198.1| Homo sapiens cDNA FLJ36879 fis, clone BGGI11000193 44 0.38
81dbj|AK093258.1| Homo sapiens cDNA FLJ35939 fis, clone TESTI2011605 44 0.38
82emb|CR590200.1| full-length cDNA clone CS0DL011YH08 of B cells (... 44 0.38
83gb|AC124316.32| Mus musculus chromosome 17, clone RP24-222O13, c... 44 0.38
84dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
85gb|AF287300.1|AF287300 Rattus norvegicus tandem pore domain pota... 44 0.38
86ref|NM_022292.1| Rattus norvegicus potassium channel, subfamily ... 44 0.38
87dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 44 0.38
88ref|NM_199251.1| Mus musculus potassium channel, subfamily K, me... 44 0.38
89gb|AY007163.1| Homo sapiens clone CDABP0155 mRNA sequence 44 0.38
90emb|BX647774.1|HSM807920 Homo sapiens mRNA; cDNA DKFZp686O1259 (... 44 0.38
91dbj|AB052939.1| Mus musculus mntk1 mRNA, complete cds 44 0.38
92dbj|AP004463.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.38
93dbj|AK074358.1| Homo sapiens cDNA FLJ23778 fis, clone HEP20701 44 0.38
94gb|BC066002.1| Mus musculus cDNA sequence BC024479, mRNA (cDNA c... 44 0.38
95gb|AC073435.26| Mus musculus strain C57BL/6J chromosome 9 clone ... 44 0.38
96dbj|AU066557.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 44 0.38
97gb|BC108558.1| Xenopus laevis cDNA clone MGC:131026 IMAGE:798019... 42 1.5
98gb|AC108762.2| Oryza sativa (japonica cultivar-group) chromosome... 42 1.5
99ref|XM_479146.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.5
100gb|AC161812.3| Mus musculus chromosome 15, clone RP23-195I24, co... 42 1.5
101ref|XM_868865.1| PREDICTED: Bos taurus similar to FAS-associated... 42 1.5
102gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complet... 42 1.5
103ref|XM_751805.1| Ustilago maydis 521 hypothetical protein (UM007... 42 1.5
104ref|XM_532944.2| PREDICTED: Canis familiaris hypothetical LOC130... 42 1.5
105ref|XM_538738.2| PREDICTED: Canis familiaris similar to Exosome ... 42 1.5
106emb|AL590233.23| Human DNA sequence from clone RP13-93L13 on chr... 42 1.5
107emb|BX023094.1|CNS08PZE Single read from an extremity of a full-... 42 1.5
108emb|BX572596.1| Rhodopseudomonas palustris CGA009 complete genom... 42 1.5
109gb|AC104834.4| Mus Musculus Strain C57BL6/J Chromosome 15 RP23-2... 42 1.5
110gb|AE005750.1| Caulobacter crescentus CB15 section 76 of 359 of ... 42 1.5
111dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 1.5
112gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 1.5
113dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
114dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
115dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
116gb|AC156445.2| Volvox carteri clone JGIAOBO-25P15, complete sequ... 42 1.5
117dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 42 1.5
118dbj|AP006446.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
119dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
120dbj|AP005846.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
121dbj|AK071281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
122dbj|AK064834.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
123dbj|AK062257.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
124dbj|AB013791.1| Ceratopteris richardii mRNA for CRHB1, partial cds 42 1.5
125ref|NM_187946.1| Oryza sativa (japonica cultivar-group), Ozsa836... 40 5.9
126ref|XM_482973.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.9
127ref|XM_475190.1| Oryza sativa (japonica cultivar-group), predic... 40 5.9
128ref|XM_530793.1| PREDICTED: Pan troglodytes LOC461754 (LOC461754... 40 5.9
129ref|NM_197811.1| Oryza sativa (japonica cultivar-group) hypothet... 40 5.9
130ref|NM_195943.1| Oryza sativa (japonica cultivar-group) hypothet... 40 5.9
131gb|BT017144.1| Zea mays clone EL01N0366F12.c mRNA sequence 40 5.9
132ref|NM_001007595.1| Homo sapiens nuclear localized factor 2 (NLF... 40 5.9
133ref|XM_469706.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.9
134ref|XM_470403.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.9
135ref|XM_479147.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.9
136ref|XM_478529.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.9
137ref|XM_513752.1| PREDICTED: Pan troglodytes B-cell CLL/lymphoma ... 40 5.9
138gb|AC108758.2| Oryza sativa (japonica cultivar-group) chromosome... 40 5.9
139gb|AF411339.1| Homo sapiens brain-derived neurotrophic factor op... 40 5.9
140gb|AC135421.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.9
141ref|XM_424089.1| PREDICTED: Gallus gallus similar to cytoplasmic... 40 5.9
142gb|AC124327.9| Mus musculus chromosome 8, clone RP24-490I13, com... 40 5.9
143ref|XM_594925.2| PREDICTED: Bos taurus similar to acyl-Coenzyme ... 40 5.9
144gb|AY463276.1| Uncultured proteobacterium clone FOR14 carbon mon... 40 5.9
145ref|XM_582194.2| PREDICTED: Bos taurus similar to Homeobox prote... 40 5.9
146ref|NM_144831.2| Mus musculus DEAH (Asp-Glu-Ala-His) box polypep... 40 5.9
147ref|XM_580301.2| PREDICTED: Bos taurus similar to adenylate cycl... 40 5.9
148ref|NM_011141.1| Mus musculus POU domain, class 3, transcription... 40 5.9
149ref|NM_172755.2| Mus musculus splicing factor, arginine/serine-r... 40 5.9
150gb|BC045986.1| Danio rerio makorin, ring finger protein, 2, mRNA... 40 5.9
151ref|NM_194268.1| Mus musculus one cut domain, family member 2 (O... 40 5.9
152ref|NM_005811.2| Homo sapiens growth differentiation factor 11 (... 40 5.9
153gb|AY745194.1| Gallus gallus cytoplasmic activation- proliferati... 40 5.9
154gb|BC065064.1| Mus musculus DEAH (Asp-Glu-Ala-His) box polypepti... 40 5.9
155gb|AY264920.1| Ovis aries homeo box C13 (Hoxc13) gene, exon 1 an... 40 5.9
156gb|BC065352.1| Danio rerio makorin, ring finger protein, 2, mRNA... 40 5.9
157gb|AC092852.6| Oryza sativa chromosome 3 BAC OSJNBa0032G11 genom... 40 5.9
158ref|XM_001001997.1| PREDICTED: Mus musculus hypothetical protein... 40 5.9
159gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 5.9
160ref|XM_533770.2| PREDICTED: Canis familiaris similar to Membrane... 40 5.9
161emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 40 5.9
162gb|BC085956.1| Rattus norvegicus zinc finger, AN1-type domain 3,... 40 5.9
163gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosom... 40 5.9
164gb|AC106818.2| Homo sapiens chromosome 5 clone RP11-65F13, compl... 40 5.9
165gb|BC057305.1| Mus musculus splicing factor, arginine/serine-ric... 40 5.9
166gb|AC117188.3| Mus musculus BAC clone RP23-42E3 from 1, complete... 40 5.9
167gb|AC098886.4| Mus musculus BAC clone RP23-122M21 from 4, comple... 40 5.9
168gb|AC122004.2| Mus musculus BAC clone RP24-337O4 from 18, comple... 40 5.9
169gb|BC057390.1| Homo sapiens Ras-induced senescence 1, mRNA (cDNA... 40 5.9
170ref|NM_001012175.1| Rattus norvegicus zinc finger, AN1-type doma... 40 5.9
171gb|BC057181.1| Mus musculus cDNA clone IMAGE:5038990, partial cds 40 5.9
172emb|CR956634.3| Pig DNA sequence from clone CH242-277I8 on chrom... 40 5.9
173gb|AY242995.1| Mus musculus transcription factor ONECUT2 (Oc2) m... 40 5.9
174gb|BC018089.1| Homo sapiens hypothetical gene supported by AK124... 40 5.9
175gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, compl... 40 5.9
176gb|AY341860.1| Oryza sativa (japonica cultivar-group) WRKY20 mRN... 40 5.9
177gb|AC092554.3| Papio anubis clone RP41-414G17, complete sequence 40 5.9
178gb|AC120049.5| Homo sapiens chromosome 18, clone RP11-456K23, co... 40 5.9
179emb|BX067985.1|CNS09OMD Single read from an extremity of a full-... 40 5.9
180emb|Z29371.1|OCMRADCYV O.cuniculus mRNA for adenylyl cyclase ty... 40 5.9
181emb|X98515.1|SPSNBAGEN S.pristinaespiralis snbA gene 40 5.9
182emb|X78335.1|GGRARA21 Gallus gallus retinoic acid receptor alpha... 40 5.9
183emb|X73972.1|GGRARA1 G.gallus RAR-alpha1 mRNA for retinoic acid ... 40 5.9
184emb|X54628.1|MMOCT6GR M. musculus oct6 gene for the octamer bind... 40 5.9
185gb|AC103796.3| Homo sapiens chromosome 11, clone RP11-1033A18, c... 40 5.9
186emb|CR555306.1| Azoarcus sp. EbN1 complete genome 40 5.9
187emb|BX640449.1| Bordetella bronchiseptica strain RB50, complete ... 40 5.9
188emb|BX640434.1| Bordetella parapertussis strain 12822, complete ... 40 5.9
189emb|BX640420.1| Bordetella pertussis strain Tohama I, complete g... 40 5.9
190emb|AJ251217.1|PSP251217 Pseudomonas sp. B4 gene encoding putati... 40 5.9
191emb|AJ720561.1| Gallus gallus mRNA for hypothetical protein, clo... 40 5.9
192gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome 40 5.9
193gb|AC090668.7| Homo sapiens 12 BAC RP11-791O13 (Roswell Park Can... 40 5.9
194dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, compl... 40 5.9
195gb|AE006022.1| Caulobacter crescentus CB15 section 348 of 359 of... 40 5.9
196dbj|AK095719.1| Homo sapiens cDNA FLJ38400 fis, clone FEBRA2008159 40 5.9
197emb|CR611917.1| full-length cDNA clone CS0DI082YG05 of Placenta ... 40 5.9
198gb|AC107988.4| Homo sapiens chromosome 18, clone CTC-346I21, com... 40 5.9
199tpg|BK005060.1| TPA: TPA_inf: Oryza sativa (indica cultivar-grou... 40 5.9
200gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 5.9
201gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 gen... 40 5.9
202gb|AC084320.10| Oryza sativa chromosome 3 BAC OSJNBa0091J19 geno... 40 5.9
203gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 geno... 40 5.9
204dbj|AB094101.1| Betula maximowicziana DNA, microsatellite Bmax630 40 5.9
205gb|AC092749.1| Genomic sequence for Oryza sativa (japonica culti... 40 5.9
206gb|AC087599.14| Oryza sativa chromosome 10 BAC OSJNBa0057L21 gen... 40 5.9
207dbj|AK142226.1| Mus musculus 13 days embryo heart cDNA, RIKEN fu... 40 5.9
208gb|AY660573.1| Oryza sativa (japonica cultivar-group) cultivar T... 40 5.9
209dbj|AK148316.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-len... 40 5.9
210dbj|AK147659.1| Mus musculus adult male brain UNDEFINED_CELL_LIN... 40 5.9
211dbj|AK155423.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 5.9
212ref|XM_942917.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 5.9
213ref|XM_932488.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 5.9
214gb|CP000249.1| Frankia sp. CcI3, complete genome 40 5.9
215dbj|AK170616.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 5.9
216gb|AC151294.3| Mus musculus BAC clone RP23-137I7 from chromosome... 40 5.9
217gb|AC021766.6| Homo sapiens, clone RP11-9H20, complete sequence 40 5.9
218gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genom... 40 5.9
219gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 5.9
220dbj|AK077951.1| Mus musculus 13 days embryo male testis cDNA, RI... 40 5.9
221dbj|AK077950.1| Mus musculus 13 days embryo male testis cDNA, RI... 40 5.9
222dbj|AK042293.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 40 5.9
223gb|AY027651.1| Pseudomonas sp. Cam-1 bph operon, complete cds 40 5.9
224dbj|AK090169.1| Mus musculus 13 days embryo spinal cord cDNA, RI... 40 5.9
225tpg|BK001744.1| TPA: TPA_exp: Suid herpesvirus 1, complete genome 40 5.9
226gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 40 5.9
227dbj|AK078552.1| Mus musculus 12 days embryo female mullerian duc... 40 5.9
228gb|AF100907.1|AF100907 Homo sapiens bone morphogenetic protein 1... 40 5.9
229dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
230dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
231gb|AC099324.5| Oryza sativa chromosome 3 BAC OSJNBb0043P23 genom... 40 5.9
232gb|AC012671.7| Homo sapiens BAC clone RP11-554H10 from 2, comple... 40 5.9
233gb|AC104081.2| Homo sapiens BAC clone RP11-559A1 from 2, complet... 40 5.9
234gb|AC155722.9| Mus musculus 6 BAC RP24-204J8 (Roswell Park Cance... 40 5.9
235gb|M86348.1|PSEBPHA Pseudomonas sp. LB400 biphenyl dioxygenase (... 40 5.9
236gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic ... 40 5.9
237gb|AC073487.34| Homo sapiens 12 BAC RP11-762I7 (Roswell Park Can... 40 5.9
238gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genom... 40 5.9
239dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
240ref|NM_204536.1| Gallus gallus retinoic acid receptor alpha 1 is... 40 5.9
241gb|AF518875.1| Mus musculus arginine/serine-rich 14 splicing fac... 40 5.9
242ref|XM_345266.2| PREDICTED: Rattus norvegicus tripartite motif p... 40 5.9
243dbj|AP002817.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
244gb|AC104839.5| Homo sapiens BAC clone RP13-868N24 from 2, comple... 40 5.9
245dbj|AP004643.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
246dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 5.9
247dbj|AP006164.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
248dbj|AP005558.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
249gb|AC102106.14| Mus musculus chromosome 18, clone RP23-92B24, co... 40 5.9
250dbj|AP006056.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
251dbj|AP004741.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
252dbj|AP003525.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
253dbj|AP004674.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
254dbj|AP004836.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.9
255dbj|BS000240.1| Pan troglodytes chromosome 22 clone:RP43-055A16,... 40 5.9
256dbj|AK120376.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
257dbj|AK111249.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
258dbj|AK109814.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
259dbj|AK106301.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
260gb|AF028333.1|AF028333 Homo sapiens growth/differentiation facto... 40 5.9
261dbj|AK072209.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
262dbj|AK071363.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
263ref|NM_210542.1| Eremothecium gossypii AER332Wp (AER332W), mRNA 40 5.9
264dbj|AK070025.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
265emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 5.9
266dbj|AK066061.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
267dbj|AK065289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
268gb|AC140071.4| Mus musculus BAC clone RP23-394K8 from 3, complet... 40 5.9
269dbj|AK061799.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
270emb|AL359207.7| Human DNA sequence from clone RP11-533N14 on chr... 40 5.9
271emb|AL117192.5|CNS01DRE Human chromosome 14 DNA sequence BAC R-8... 40 5.9
272emb|AM087944.1| Aegilops caudata mRNA for putative avenin-like a... 40 5.9
273emb|AM087942.1| Aegilops cylindrica mRNA for putative avenin-lik... 40 5.9
274emb|AM087940.1| Triticum aestivum mRNA for putative avenin-like ... 40 5.9
275gb|BC083124.1| Mus musculus zinc finger, AN1-type domain 3, mRNA... 40 5.9
276ref|NM_148926.2| Mus musculus zinc finger, AN1-type domain 3 (Zf... 40 5.9
277gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 5.9
278gb|AC153592.3| Mus musculus 6 BAC RP23-20C15 (Roswell Park Cance... 40 5.9
279gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 5.9
280emb|BX072548.4|CNS09S4R Oryza sativa chromosome 11, . BAC OSJNBa... 40 5.9
281emb|BX000503.2|CNS08CDT Oryza sativa chromosome 12, . BAC OSJNBb... 40 5.9
282emb|AL805900.10| Mouse DNA sequence from clone RP23-85B14 on chr... 40 5.9
283emb|BX000496.1|CNS08CDM Oryza sativa chromosome 12, . BAC OSJNBa... 40 5.9
284gb|AC132481.4| Mus musculus BAC clone RP23-14I14 from 17, comple... 40 5.9
285gb|AC147475.3| Mus musculus BAC clone RP23-161B8 from 1, complet... 40 5.9
286gb|U83173.1|MMU83173 Mus musculus ROSA 26 region promoter DNA se... 40 5.9
287gb|AC087898.19| Mus musculus strain C57BL/6J chromosome 16 clone... 40 5.9
288ref|NM_001031365.1| Gallus gallus GPI-anchored membrane protein ... 40 5.9
289gb|AC126323.6| Homo sapiens chromosome 15, clone RP11-299H22, co... 40 5.9
290emb|AL845449.4| Mouse DNA sequence from clone RP23-211M20 on chr... 40 5.9
291emb|AL606907.9| Mouse DNA sequence from clone RP23-230F2 on chro... 40 5.9
292emb|AL590994.13| Mouse DNA sequence from clone RP23-382C19 on ch... 40 5.9
293gb|AC087425.2| Oryza sativa (japonica cultivar-group) chromosome... 40 5.9
294gb|AC105258.2| Oryza sativa (japonica cultivar-group) chromosome... 40 5.9
295gb|M34651.1|SH1PROIE Pseudorabies virus with upstream and downst... 40 5.9
296emb|X60202.1|HSNTFG Human DNA for the 5'flanking region of the b... 40 5.9
297gb|M88302.1|MUSPOUDOMD Mouse scip POU-domain protein, complete cds 40 5.9
298gb|M83673.1|PSEBPHABC P.pseudoalcaligenes dioxygenase (bphABC) g... 40 5.9

>gb|AC147427.2| Oryza sativa chromosome 3  B1394A07 genomic sequence, complete sequence
          Length = 175704

 Score =  194 bits (98), Expect = 2e-46
 Identities = 125/134 (93%)
 Strand = Plus / Plus

                                                                         
Query: 309   gcggcggggcgccgcaggtggacacaggcaagtacgtgcgctacacccccgagcaggtgg 368
             |||| ||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 91176 gcggaggggcgccgcaagtggacacgggcaagtacgtgcgctacaccccggagcaggtgg 91235

                                                                         
Query: 369   atgcgctggagcgcgtctacagcgagtgccccaagcccagctcgctccgccggcagcagc 428
             | ||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 91236 aggcgctggagcgggtctacggcgagtgccccaagcccagctcgctccgccgccagcagc 91295

                           
Query: 429   tcatacgcgagtgc 442
             |||| |||||||||
Sbjct: 91296 tcatccgcgagtgc 91309



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 117   ggcatgacgcggcggcgaccctggccctggctc 149
             ||||||||||||||||| || ||||| ||||||
Sbjct: 90967 ggcatgacgcggcggcgcccgtggccgtggctc 90999



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  194 bits (98), Expect = 2e-46
 Identities = 125/134 (93%)
 Strand = Plus / Minus

                                                                            
Query: 309      gcggcggggcgccgcaggtggacacaggcaagtacgtgcgctacacccccgagcaggtgg 368
                |||| ||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 24544684 gcggaggggcgccgcaagtggacacgggcaagtacgtgcgctacaccccggagcaggtgg 24544625

                                                                            
Query: 369      atgcgctggagcgcgtctacagcgagtgccccaagcccagctcgctccgccggcagcagc 428
                | ||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 24544624 aggcgctggagcgggtctacggcgagtgccccaagcccagctcgctccgccgccagcagc 24544565

                              
Query: 429      tcatacgcgagtgc 442
                |||| |||||||||
Sbjct: 24544564 tcatccgcgagtgc 24544551



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                            
Query: 335      ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
                ||||||||||||| |||||| || |  |||||||| ||||||||||| || |||  ||||
Sbjct: 31566247 ggcaagtacgtgcactacacgccgggtcaggtggaggcgctggagcgggtgtacgccgag 31566306

                              
Query: 395      tgccccaagcccag 408
                ||||||||||||||
Sbjct: 31566307 tgccccaagcccag 31566320



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                          
Query: 344    gtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgccccaag 403
              ||||||||||| || ||||||||||| ||||| ||||| || |||  ||| |||||||||
Sbjct: 529286 gtgcgctacacgcctgagcaggtggaggcgcttgagcgggtgtacgccgattgccccaag 529345

                
Query: 404    cc 405
              ||
Sbjct: 529346 cc 529347



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 117      ggcatgacgcggcggcgaccctggccctggctc 149
                ||||||||||||||||| || ||||| ||||||
Sbjct: 24544893 ggcatgacgcggcggcgcccgtggccgtggctc 24544861



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 297      ccggcggcggcagcggcggg 316
                ||||||||||||||||||||
Sbjct: 35256183 ccggcggcggcagcggcggg 35256202



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 34048889 cggcggcggcagcggcgggg 34048870



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 32061883 cggcggcggcagcggcgggg 32061864



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 297      ccggcggcggcagcggcggggcgc 320
                ||||||||||| ||||||||||||
Sbjct: 30323317 ccggcggcggcggcggcggggcgc 30323340



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  194 bits (98), Expect = 2e-46
 Identities = 125/134 (93%)
 Strand = Plus / Minus

                                                                            
Query: 309      gcggcggggcgccgcaggtggacacaggcaagtacgtgcgctacacccccgagcaggtgg 368
                |||| ||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 24462153 gcggaggggcgccgcaagtggacacgggcaagtacgtgcgctacaccccggagcaggtgg 24462094

                                                                            
Query: 369      atgcgctggagcgcgtctacagcgagtgccccaagcccagctcgctccgccggcagcagc 428
                | ||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 24462093 aggcgctggagcgggtctacggcgagtgccccaagcccagctcgctccgccgccagcagc 24462034

                              
Query: 429      tcatacgcgagtgc 442
                |||| |||||||||
Sbjct: 24462033 tcatccgcgagtgc 24462020



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                            
Query: 335      ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
                ||||||||||||| |||||| || |  |||||||| ||||||||||| || |||  ||||
Sbjct: 31656753 ggcaagtacgtgcactacacgccgggtcaggtggaggcgctggagcgggtgtacgccgag 31656812

                              
Query: 395      tgccccaagcccag 408
                ||||||||||||||
Sbjct: 31656813 tgccccaagcccag 31656826



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                          
Query: 344    gtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgccccaag 403
              ||||||||||| || ||||||||||| ||||| ||||| || |||  ||| |||||||||
Sbjct: 529284 gtgcgctacacgcctgagcaggtggaggcgcttgagcgggtgtacgccgattgccccaag 529343

                
Query: 404    cc 405
              ||
Sbjct: 529344 cc 529345



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 117      ggcatgacgcggcggcgaccctggccctggctc 149
                ||||||||||||||||| || ||||| ||||||
Sbjct: 24462362 ggcatgacgcggcggcgcccgtggccgtggctc 24462330



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 297      ccggcggcggcagcggcggg 316
                ||||||||||||||||||||
Sbjct: 35346255 ccggcggcggcagcggcggg 35346274



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 34139361 cggcggcggcagcggcgggg 34139342



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 32152395 cggcggcggcagcggcgggg 32152376



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 297      ccggcggcggcagcggcggggcgc 320
                ||||||||||| ||||||||||||
Sbjct: 30414739 ccggcggcggcggcggcggggcgc 30414762



to top

>dbj|AK103284.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033124M18, full
           insert sequence
          Length = 3082

 Score =  194 bits (98), Expect = 2e-46
 Identities = 125/134 (93%)
 Strand = Plus / Plus

                                                                       
Query: 309 gcggcggggcgccgcaggtggacacaggcaagtacgtgcgctacacccccgagcaggtgg 368
           |||| ||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||
Sbjct: 410 gcggaggggcgccgcaagtggacacgggcaagtacgtgcgctacaccccggagcaggtgg 469

                                                                       
Query: 369 atgcgctggagcgcgtctacagcgagtgccccaagcccagctcgctccgccggcagcagc 428
           | ||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 470 aggcgctggagcgggtctacggcgagtgccccaagcccagctcgctccgccgccagcagc 529

                         
Query: 429 tcatacgcgagtgc 442
           |||| |||||||||
Sbjct: 530 tcatccgcgagtgc 543



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 117 ggcatgacgcggcggcgaccctggccctggctc 149
           ||||||||||||||||| || ||||| ||||||
Sbjct: 201 ggcatgacgcggcggcgcccgtggccgtggctc 233



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  141 bits (71), Expect = 2e-30
 Identities = 113/127 (88%)
 Strand = Plus / Minus

                                                                            
Query: 316      ggcgccgcaggtggacacaggcaagtacgtgcgctacacccccgagcaggtggatgcgct 375
                |||||||||||||||| | || |||||||| || ||||| |||||||||||||| |||||
Sbjct: 25960572 ggcgccgcaggtggacgccgggaagtacgtccggtacacgcccgagcaggtggaggcgct 25960513

                                                                            
Query: 376      ggagcgcgtctacagcgagtgccccaagcccagctcgctccgccggcagcagctcatacg 435
                |||||| || |||| ||||||||||||||||||||| |||||||| ||||||||||| ||
Sbjct: 25960512 ggagcgggtgtacaccgagtgccccaagcccagctcactccgccgccagcagctcatccg 25960453

                       
Query: 436      cgagtgc 442
                 ||||||
Sbjct: 25960452 ggagtgc 25960446



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 101    gaggcggcgcgcggagggca 120
              ||||||||||||||||||||
Sbjct: 102528 gaggcggcgcgcggagggca 102547



to top

>dbj|AK102183.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086M14, full
           insert sequence
          Length = 3140

 Score =  141 bits (71), Expect = 2e-30
 Identities = 113/127 (88%)
 Strand = Plus / Plus

                                                                       
Query: 316 ggcgccgcaggtggacacaggcaagtacgtgcgctacacccccgagcaggtggatgcgct 375
           |||||||||||||||| | || |||||||| || ||||| |||||||||||||| |||||
Sbjct: 335 ggcgccgcaggtggacgccgggaagtacgtccggtacacgcccgagcaggtggaggcgct 394

                                                                       
Query: 376 ggagcgcgtctacagcgagtgccccaagcccagctcgctccgccggcagcagctcatacg 435
           |||||| || |||| ||||||||||||||||||||| |||||||| ||||||||||| ||
Sbjct: 395 ggagcgggtgtacaccgagtgccccaagcccagctcactccgccgccagcagctcatccg 454

                  
Query: 436 cgagtgc 442
            ||||||
Sbjct: 455 ggagtgc 461



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  141 bits (71), Expect = 2e-30
 Identities = 113/127 (88%)
 Strand = Plus / Minus

                                                                            
Query: 316      ggcgccgcaggtggacacaggcaagtacgtgcgctacacccccgagcaggtggatgcgct 375
                |||||||||||||||| | || |||||||| || ||||| |||||||||||||| |||||
Sbjct: 25888750 ggcgccgcaggtggacgccgggaagtacgtccggtacacgcccgagcaggtggaggcgct 25888691

                                                                            
Query: 376      ggagcgcgtctacagcgagtgccccaagcccagctcgctccgccggcagcagctcatacg 435
                |||||| || |||| ||||||||||||||||||||| |||||||| ||||||||||| ||
Sbjct: 25888690 ggagcgggtgtacaccgagtgccccaagcccagctcactccgccgccagcagctcatccg 25888631

                       
Query: 436      cgagtgc 442
                 ||||||
Sbjct: 25888630 ggagtgc 25888624



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 101    gaggcggcgcgcggagggca 120
              ||||||||||||||||||||
Sbjct: 102528 gaggcggcgcgcggagggca 102547



to top

>emb|AL713934.5|CNS07YPF Oryza sativa chromosome 12, . Partial sequence from BAC OJ1257_B09 of
             library Monsanto from chromosome 12 of cultivar Nipponbare
             of ssp. japonica of Oryza sativa (rice), complete sequence
          Length = 61296

 Score =  141 bits (71), Expect = 2e-30
 Identities = 113/127 (88%)
 Strand = Plus / Plus

                                                                         
Query: 316   ggcgccgcaggtggacacaggcaagtacgtgcgctacacccccgagcaggtggatgcgct 375
             |||||||||||||||| | || |||||||| || ||||| |||||||||||||| |||||
Sbjct: 14717 ggcgccgcaggtggacgccgggaagtacgtccggtacacgcccgagcaggtggaggcgct 14776

                                                                         
Query: 376   ggagcgcgtctacagcgagtgccccaagcccagctcgctccgccggcagcagctcatacg 435
             |||||| || |||| ||||||||||||||||||||| |||||||| ||||||||||| ||
Sbjct: 14777 ggagcgggtgtacaccgagtgccccaagcccagctcactccgccgccagcagctcatccg 14836

                    
Query: 436   cgagtgc 442
              ||||||
Sbjct: 14837 ggagtgc 14843



to top

>emb|AL713940.4|CNS07YPM Oryza sativa chromosome 12, . BAC OJ1327_A12 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 161806

 Score =  141 bits (71), Expect = 2e-30
 Identities = 113/127 (88%)
 Strand = Plus / Plus

                                                                          
Query: 316    ggcgccgcaggtggacacaggcaagtacgtgcgctacacccccgagcaggtggatgcgct 375
              |||||||||||||||| | || |||||||| || ||||| |||||||||||||| |||||
Sbjct: 151097 ggcgccgcaggtggacgccgggaagtacgtccggtacacgcccgagcaggtggaggcgct 151156

                                                                          
Query: 376    ggagcgcgtctacagcgagtgccccaagcccagctcgctccgccggcagcagctcatacg 435
              |||||| || |||| ||||||||||||||||||||| |||||||| ||||||||||| ||
Sbjct: 151157 ggagcgggtgtacaccgagtgccccaagcccagctcactccgccgccagcagctcatccg 151216

                     
Query: 436    cgagtgc 442
               ||||||
Sbjct: 151217 ggagtgc 151223



to top

>ref|NM_197030.1| Oryza sativa (japonica cultivar-group) putative homeodomain leucine
           zipper protein (OSJNBa0093B11.11), mRNA
          Length = 2523

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           |||||||||||||| ||||| || ||||||||||| ||||||||| | || |||  ||||
Sbjct: 82  ggcaagtacgtgcggtacacgccggagcaggtggaggcgctggagagggtgtacgccgag 141

                                              
Query: 395 tgccccaagcccagctcgctccgccggcagcagct 429
           |||||||||||||||||   |||||| ||||||||
Sbjct: 142 tgccccaagcccagctcctcccgccgccagcagct 176



to top

>gb|AY423716.1| Oryza sativa (japonica cultivar-group) homeodomain leucine-zipper
           protein Hox9 mRNA, complete cds
          Length = 3174

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           |||||||||||||| ||||| || ||||||||||| ||||||||| | || |||  ||||
Sbjct: 363 ggcaagtacgtgcggtacacgccggagcaggtggaggcgctggagagggtgtacgccgag 422

                                              
Query: 395 tgccccaagcccagctcgctccgccggcagcagct 429
           |||||||||||||||||   |||||| ||||||||
Sbjct: 423 tgccccaagcccagctcctcccgccgccagcagct 457



to top

>gb|AC024594.9| Oryza sativa chromosome 10 BAC OSJNBa0093B11 genomic sequence, complete
              sequence
          Length = 178692

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Minus

                                                                          
Query: 335    ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
              |||||||||||||| ||||| || ||||||||||| ||||||||| | || |||  ||||
Sbjct: 103130 ggcaagtacgtgcggtacacgccggagcaggtggaggcgctggagagggtgtacgccgag 103071

                                                 
Query: 395    tgccccaagcccagctcgctccgccggcagcagct 429
              |||||||||||||||||   |||||| ||||||||
Sbjct: 103070 tgccccaagcccagctcctcccgccgccagcagct 103036



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                            
Query: 335      ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
                |||||||||||||| ||||| || ||||||||||| ||||||||| | || |||  ||||
Sbjct: 17571501 ggcaagtacgtgcggtacacgccggagcaggtggaggcgctggagagggtgtacgccgag 17571560

                                                   
Query: 395      tgccccaagcccagctcgctccgccggcagcagct 429
                |||||||||||||||||   |||||| ||||||||
Sbjct: 17571561 tgccccaagcccagctcctcccgccgccagcagct 17571595



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                           
Query: 335     ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
               |||||||||||||  ||||| || || |||||||| ||||||||||| || |||  ||||
Sbjct: 2823176 ggcaagtacgtgcagtacacgccggatcaggtggaggcgctggagcgggtgtacgccgag 2823235

                               
Query: 395     tgccccaagcccagct 410
               ||||||||||||||||
Sbjct: 2823236 tgccccaagcccagct 2823251



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 300      gcggcggcagcggcggggcgccgc 323
                ||||||||||||| ||||||||||
Sbjct: 22001684 gcggcggcagcgggggggcgccgc 22001707



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 21388264 cggcggcggcagcggcgggg 21388245



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 10139559 cggcggcggcagcggcgggg 10139540



to top

>dbj|AK102830.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033109G06, full
           insert sequence
          Length = 3000

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           |||||||||||||| ||||| || ||||||||||| ||||||||| | || |||  ||||
Sbjct: 210 ggcaagtacgtgcggtacacgccggagcaggtggaggcgctggagagggtgtacgccgag 269

                                              
Query: 395 tgccccaagcccagctcgctccgccggcagcagct 429
           |||||||||||||||||   |||||| ||||||||
Sbjct: 270 tgccccaagcccagctcctcccgccgccagcagct 304



to top

>dbj|AK102603.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033098N12, full
           insert sequence
          Length = 3227

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           |||||||||||||| ||||| || ||||||||||| ||||||||| | || |||  ||||
Sbjct: 434 ggcaagtacgtgcggtacacgccggagcaggtggaggcgctggagagggtgtacgccgag 493

                                              
Query: 395 tgccccaagcccagctcgctccgccggcagcagct 429
           |||||||||||||||||   |||||| ||||||||
Sbjct: 494 tgccccaagcccagctcctcccgccgccagcagct 528



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                            
Query: 335      ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
                |||||||||||||| ||||| || ||||||||||| ||||||||| | || |||  ||||
Sbjct: 17580541 ggcaagtacgtgcggtacacgccggagcaggtggaggcgctggagagggtgtacgccgag 17580600

                                                   
Query: 395      tgccccaagcccagctcgctccgccggcagcagct 429
                |||||||||||||||||   |||||| ||||||||
Sbjct: 17580601 tgccccaagcccagctcctcccgccgccagcagct 17580635



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                           
Query: 335     ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
               |||||||||||||  ||||| || || |||||||| ||||||||||| || |||  ||||
Sbjct: 2823127 ggcaagtacgtgcagtacacgccggatcaggtggaggcgctggagcgggtgtacgccgag 2823186

                               
Query: 395     tgccccaagcccagct 410
               ||||||||||||||||
Sbjct: 2823187 tgccccaagcccagct 2823202



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 300      gcggcggcagcggcggggcgccgc 323
                ||||||||||||| ||||||||||
Sbjct: 22013347 gcggcggcagcgggggggcgccgc 22013370



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 21399527 cggcggcggcagcggcgggg 21399508



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 10145598 cggcggcggcagcggcgggg 10145579



to top

>gb|DQ385515.1| Phaeoceros carolinianus class III homeodomain-leucine zipper
           protein C3HDZ1 (C3HDZ1) mRNA, complete cds
          Length = 2586

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 338 aagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgc 397
           ||||| ||||| ||||||   ||||||||||| || |||||||| ||||||| ||| |||
Sbjct: 55  aagtatgtgcgttacaccaatgagcaggtggaggctctggagcgtgtctacaacgaatgc 114

                                              
Query: 398 cccaagcccagctcgctccgccggcagcagctcat 432
           ||||||||||||||  | || ||||||||||||||
Sbjct: 115 cccaagcccagctccattcgacggcagcagctcat 149



to top

>ref|NM_194843.1| Oryza sativa (japonica cultivar-group) putative homeodomain leucine
           zipper protein (OSJNBb0016M10.1), mRNA
          Length = 654

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           |||||||||||||  ||||| || || |||||||| ||||||||||| || |||  ||||
Sbjct: 472 ggcaagtacgtgcagtacacgccggatcaggtggaggcgctggagcgggtgtacgccgag 531

                           
Query: 395 tgccccaagcccagct 410
           ||||||||||||||||
Sbjct: 532 tgccccaagcccagct 547



to top

>gb|AC091665.3| Oryza sativa chromosome 10 clone OSJNBb0016M10, complete sequence
          Length = 118101

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                        
Query: 335  ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
            |||||||||||||  ||||| || || |||||||| ||||||||||| || |||  ||||
Sbjct: 4208 ggcaagtacgtgcagtacacgccggatcaggtggaggcgctggagcgggtgtacgccgag 4267

                            
Query: 395  tgccccaagcccagct 410
            ||||||||||||||||
Sbjct: 4268 tgccccaagcccagct 4283



to top

>dbj|AK059657.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-D05, full
           insert sequence
          Length = 1149

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           |||||||||||||  ||||| || || |||||||| ||||||||||| || |||  ||||
Sbjct: 739 ggcaagtacgtgcagtacacgccggatcaggtggaggcgctggagcgggtgtacgccgag 798

                           
Query: 395 tgccccaagcccagct 410
           ||||||||||||||||
Sbjct: 799 tgccccaagcccagct 814



to top

>ref|NM_188279.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2697

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 79/94 (84%)
 Strand = Plus / Plus

                                                                       
Query: 336 gcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagt 395
           ||||||||||| | ||||| || ||||||||||| ||||||||| |  | |||  |||||
Sbjct: 32  gcaagtacgtgaggtacacgccggagcaggtggaggcgctggagaggctgtactacgagt 91

                                             
Query: 396 gccccaagcccagctcgctccgccggcagcagct 429
           | |||||||| |||||||| || |||||||||||
Sbjct: 92  gtcccaagccgagctcgctgcggcggcagcagct 125



to top

>gb|AC133450.6| Oryza sativa chromosome 3 BAC OSJNBa0072F13 genomic sequence, complete
              sequence
          Length = 150743

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                          
Query: 335    ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
              ||||||||||||| |||||| || |  |||||||| ||||||||||| || |||  ||||
Sbjct: 114420 ggcaagtacgtgcactacacgccgggtcaggtggaggcgctggagcgggtgtacgccgag 114361

                            
Query: 395    tgccccaagcccag 408
              ||||||||||||||
Sbjct: 114360 tgccccaagcccag 114347



to top

>gb|AC107207.9| Oryza sativa chromosome 3 BAC OSJNBb0106M04 genomic sequence, complete
             sequence
          Length = 133449

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                         
Query: 335   ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
             ||||||||||||| |||||| || |  |||||||| ||||||||||| || |||  ||||
Sbjct: 26359 ggcaagtacgtgcactacacgccgggtcaggtggaggcgctggagcgggtgtacgccgag 26300

                           
Query: 395   tgccccaagcccag 408
             ||||||||||||||
Sbjct: 26299 tgccccaagcccag 26286



to top

>gb|DQ385532.1| Marchantia polymorpha class III homeodomain-leucine zipper (C3HDZ1)
           gene, complete cds
          Length = 9458

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           |||||||| |||||||||||   ||| |||||||| ||  |||||||||||||||  |||
Sbjct: 46  ggcaagtatgtgcgctacacaaacgaacaggtggaggctttggagcgcgtctacaatgag 105

                             
Query: 395 tgccccaagcccagctcg 412
           ||||| ||||||||||||
Sbjct: 106 tgcccgaagcccagctcg 123



to top

>gb|DQ385514.1| Marchantia polymorpha class III homeodomain-leucine zipper protein
           C3HDZ1 (C3HDZ1) mRNA, complete cds
          Length = 2583

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           |||||||| |||||||||||   ||| |||||||| ||  |||||||||||||||  |||
Sbjct: 46  ggcaagtatgtgcgctacacaaacgaacaggtggaggctttggagcgcgtctacaatgag 105

                             
Query: 395 tgccccaagcccagctcg 412
           ||||| ||||||||||||
Sbjct: 106 tgcccgaagcccagctcg 123



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                           
Query: 336     gcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagt 395
               ||||||||||| | ||||| || ||||||||||| ||||||||| |  | |||  |||||
Sbjct: 5430375 gcaagtacgtgaggtacacgccggagcaggtggaggcgctggagaggctgtactacgagt 5430316

                                                 
Query: 396     gccccaagcccagctcgctccgccggcagcagct 429
               | |||||||| |||||||| || |||||||||||
Sbjct: 5430315 gtcccaagccgagctcgctgcggcggcagcagct 5430282



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 239      cacggcgggcacggcgggcacggcgggg 266
                ||||| |||||||| |||||||||||||
Sbjct: 31383564 cacggggggcacggtgggcacggcgggg 31383537



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 296     cccggcggcggcagcggcgg 315
               ||||||||||||||||||||
Sbjct: 8743898 cccggcggcggcagcggcgg 8743879



to top

>dbj|AP003197.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1015E06
          Length = 164583

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 79/94 (84%)
 Strand = Plus / Minus

                                                                         
Query: 336   gcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagt 395
             ||||||||||| | ||||| || ||||||||||| ||||||||| |  | |||  |||||
Sbjct: 27215 gcaagtacgtgaggtacacgccggagcaggtggaggcgctggagaggctgtactacgagt 27156

                                               
Query: 396   gccccaagcccagctcgctccgccggcagcagct 429
             | |||||||| |||||||| || |||||||||||
Sbjct: 27155 gtcccaagccgagctcgctgcggcggcagcagct 27122



to top

>dbj|AK100250.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023060H19, full
            insert sequence
          Length = 2349

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                        
Query: 335  ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
            ||||||||||||| |||||| || |  |||||||| ||||||||||| || |||  ||||
Sbjct: 1011 ggcaagtacgtgcactacacgccgggtcaggtggaggcgctggagcgggtgtacgccgag 1070

                          
Query: 395  tgccccaagcccag 408
            ||||||||||||||
Sbjct: 1071 tgccccaagcccag 1084



to top

>gb|DQ385520.1| Selaginella kraussiana class III homeodomain-leucine zipper protein
           C3HDZ2 (C3HDZ2) mRNA, complete cds
          Length = 2523

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 89/108 (82%)
 Strand = Plus / Plus

                                                                       
Query: 333 caggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcg 392
           ||||||||||| | || ||||| ||||||||||| || ||| ||||||| ||||||| ||
Sbjct: 44  caggcaagtacatacggtacacgcccgagcaggtcgaggcgttggagcgtgtctacaacg 103

                                                           
Query: 393 agtgccccaagcccagctcgctccgccggcagcagctcatacgcgagt 440
           ||||||| || || || ||  |||| || ||||||||| | |||||||
Sbjct: 104 agtgcccgaaaccgagttcaatccggcgccagcagctcctccgcgagt 151



to top

>gb|DQ385539.1| Pseudotsuga menziesii class III homeodomain-leucine zipper (C3HDZ1)
           gene, complete cds
          Length = 5694

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 359 gagcaggtggatgcgctggagcgcgtctacagcgagtgccccaagcccagctcgctccgc 418
           |||||||| || || ||||||||||| ||||||||||| || ||||| ||||||||  | 
Sbjct: 73  gagcaggtcgaagctctggagcgcgtttacagcgagtgtccgaagccaagctcgcttagg 132

                      
Query: 419 cggcagcagct 429
           |||||||||||
Sbjct: 133 cggcagcagct 143



to top

>gb|DQ385528.1| Pseudotsuga menziesii class III homeodomain-leucine zipper protein
           C3HDZ1 (C3HDZ1) mRNA, complete cds
          Length = 2529

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 359 gagcaggtggatgcgctggagcgcgtctacagcgagtgccccaagcccagctcgctccgc 418
           |||||||| || || ||||||||||| ||||||||||| || ||||| ||||||||  | 
Sbjct: 73  gagcaggtcgaagctctggagcgcgtttacagcgagtgtccgaagccaagctcgcttagg 132

                      
Query: 419 cggcagcagct 429
           |||||||||||
Sbjct: 133 cggcagcagct 143



to top

>gb|DQ385540.1| Pseudotsuga menziesii class III homeodomain-leucine zipper (C3HDZ2)
           gene, complete cds
          Length = 5275

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           ||||||||||| || |||||  | || |||||||| || ||||| ||| ||||||  || 
Sbjct: 46  ggcaagtacgttcggtacactgcggaacaggtggaagctctggaacgcctctacaatgac 105

                                                 
Query: 395 tgccccaagcccagctcgctccgccggcagcagctcat 432
           ||||||||||||||||| || || || |||||||||||
Sbjct: 106 tgccccaagcccagctctctacgtcgccagcagctcat 143



to top

>gb|DQ385529.1| Pseudotsuga menziesii class III homeodomain-leucine zipper protein
           C3HDZ2 (C3HDZ2) mRNA, complete cds
          Length = 2520

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           ||||||||||| || |||||  | || |||||||| || ||||| ||| ||||||  || 
Sbjct: 46  ggcaagtacgttcggtacactgcggaacaggtggaagctctggaacgcctctacaatgac 105

                                                 
Query: 395 tgccccaagcccagctcgctccgccggcagcagctcat 432
           ||||||||||||||||| || || || |||||||||||
Sbjct: 106 tgccccaagcccagctctctacgtcgccagcagctcat 143



to top

>gb|DQ013803.1| Phyllostachys praecox HB1 mRNA, partial cds
          Length = 2623

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 335 ggcaagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgag 394
           |||||||||||||| ||||| || ||||||||||| ||||| |||||  | ||    |||
Sbjct: 32  ggcaagtacgtgcgatacacgccggagcaggtggaggcgctcgagcggatgtatgctgag 91

                            
Query: 395 tgccccaagcccagctc 411
           |||||||||||||||||
Sbjct: 92  tgccccaagcccagctc 108



to top

>gb|DQ385531.1| Taxus globosa class III homeodomain-leucine zipper protein C3HDZ2
           (C3HDZ2) mRNA, complete cds
          Length = 2532

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 359 gagcaggtggatgcgctggagcgcgtctacagcgagtgccccaagcccagctcgctccgc 418
           ||||||||||| || ||||||||| | ||| |||| || |||||||| |||||  | |||
Sbjct: 70  gagcaggtggaggctctggagcgcctgtaccgcgactgtcccaagccaagctccattcgc 129

                            
Query: 419 cggcagcagctcatacg 435
            ||||||||||||||||
Sbjct: 130 aggcagcagctcatacg 146



to top

>emb|AL939114.1|SCO939114 Streptomyces coelicolor A3(2) complete genome; segment 11/29
          Length = 313800

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 238    gcacggcgggcacggcgggcacggcgg 264
              |||||||||||||||||||||||||||
Sbjct: 139996 gcacggcgggcacggcgggcacggcgg 139970



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 246    ggcacggcgggcacggcggg 265
              ||||||||||||||||||||
Sbjct: 139997 ggcacggcgggcacggcggg 139978



to top

>ref|XM_468564.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2574

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 344 gtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgccccaag 403
           ||||||||||| || ||||||||||| ||||| ||||| || |||  ||| |||||||||
Sbjct: 85  gtgcgctacacgcctgagcaggtggaggcgcttgagcgggtgtacgccgattgccccaag 144

             
Query: 404 cc 405
           ||
Sbjct: 145 cc 146



to top

>gb|AY425991.1| Oryza sativa (japonica cultivar-group) homeodomain leucine-zipper
           protein Hox10 mRNA, complete cds
          Length = 3252

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 344 gtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgccccaag 403
           ||||||||||| || ||||||||||| ||||| ||||| || |||  ||| |||||||||
Sbjct: 495 gtgcgctacacgcctgagcaggtggaggcgcttgagcgggtgtacgccgattgccccaag 554

             
Query: 404 cc 405
           ||
Sbjct: 555 cc 556



to top

>emb|Y10293.1|SPSTTABCD Streptomyces spp. sttA, sttB, sttC, sttD and sttR genes
          Length = 5213

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                      
Query: 238  gcacggcgggcacggcgggcacggcg 263
            ||||||||||||||||||||||||||
Sbjct: 3604 gcacggcgggcacggcgggcacggcg 3579



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 244  cgggcacggcgggcacggcggg 265
            ||||||||||||||||||||||
Sbjct: 3607 cgggcacggcgggcacggcggg 3586



to top

>dbj|AK110678.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-169-H01, full
           insert sequence
          Length = 989

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 344 gtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgccccaag 403
           ||||||||||| || ||||||||||| ||||| ||||| || |||  ||| |||||||||
Sbjct: 501 gtgcgctacacgcctgagcaggtggaggcgcttgagcgggtgtacgccgattgccccaag 560

             
Query: 404 cc 405
           ||
Sbjct: 561 cc 562



to top

>dbj|AK102378.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091P14, full
           insert sequence
          Length = 3252

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 344 gtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgccccaag 403
           ||||||||||| || ||||||||||| ||||| ||||| || |||  ||| |||||||||
Sbjct: 495 gtgcgctacacgcctgagcaggtggaggcgcttgagcgggtgtacgccgattgccccaag 554

             
Query: 404 cc 405
           ||
Sbjct: 555 cc 556



to top

>gb|AC105733.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0043C10, complete sequence
          Length = 108688

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                         
Query: 344   gtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgccccaag 403
             ||||||||||| || ||||||||||| ||||| ||||| || |||  ||| |||||||||
Sbjct: 86632 gtgcgctacacgcctgagcaggtggaggcgcttgagcgggtgtacgccgattgccccaag 86573

               
Query: 404   cc 405
             ||
Sbjct: 86572 cc 86571



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
              complete sequence
          Length = 1813164

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 242    ggcgggcacggcgggcacggcgggg 266
              |||||||||||||||||||||||||
Sbjct: 338182 ggcgggcacggcgggcacggcgggg 338158



to top

>ref|NM_210848.1| Eremothecium gossypii AFL054Cp (AFL054C), mRNA
          Length = 2055

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 242 ggcgggcacggcgggcacggcgggg 266
           |||||||||||||||||||||||||
Sbjct: 52  ggcgggcacggcgggcacggcgggg 76



to top

>gb|DQ216582.1| Taeniopygia guttata clone 0058P0041C09 malate dehydrogenase
           mitochondrial-like mRNA, complete sequence
          Length = 1294

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 242 ggcgggcacggcgggcacggcggg 265
           ||||||||||||||||||||||||
Sbjct: 88  ggcgggcacggcgggcacggcggg 65



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 238 gcacggcgggcacggcgggc 257
           ||||||||||||||||||||
Sbjct: 83  gcacggcgggcacggcgggc 64



to top

>gb|DQ216580.1| Taeniopygia guttata clone 0058P0051G04 malate dehydrogenase
           mitochondrial-like mRNA, complete sequence
          Length = 1289

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 242 ggcgggcacggcgggcacggcggg 265
           ||||||||||||||||||||||||
Sbjct: 83  ggcgggcacggcgggcacggcggg 60



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 238 gcacggcgggcacggcgggc 257
           ||||||||||||||||||||
Sbjct: 78  gcacggcgggcacggcgggc 59



to top

>gb|DQ216577.1| Taeniopygia guttata clone 0063P0023A06 malate dehydrogenase
           mitochondrial-like mRNA, complete sequence
          Length = 1291

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 242 ggcgggcacggcgggcacggcggg 265
           ||||||||||||||||||||||||
Sbjct: 88  ggcgggcacggcgggcacggcggg 65



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 238 gcacggcgggcacggcgggc 257
           ||||||||||||||||||||
Sbjct: 83  gcacggcgggcacggcgggc 64



to top

>gb|DQ216576.1| Taeniopygia guttata clone 0063P0017D08 malate dehydrogenase
           mitochondrial-like mRNA, complete sequence
          Length = 1319

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 242 ggcgggcacggcgggcacggcggg 265
           ||||||||||||||||||||||||
Sbjct: 117 ggcgggcacggcgggcacggcggg 94



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 238 gcacggcgggcacggcgggc 257
           ||||||||||||||||||||
Sbjct: 112 gcacggcgggcacggcgggc 93



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                           
Query: 217     gatggcgggggcgatggtggtgcacggc 244
               ||||||||||||||||||| ||||||||
Sbjct: 3865473 gatggcgggggcgatggtgctgcacggc 3865446



to top

>gb|DQ216578.1| Taeniopygia guttata clone 0064P0018A04 malate dehydrogenase
           mitochondrial-like mRNA, complete sequence
          Length = 1288

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 243 gcgggcacggcgggcacggcggg 265
           |||||||||||||||||||||||
Sbjct: 85  gcgggcacggcgggcacggcggg 63



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 238 gcacggcgggcacggcgggc 257
           ||||||||||||||||||||
Sbjct: 81  gcacggcgggcacggcgggc 62



to top

>gb|AY501430.1| Zea mays rolled leaf1 mRNA, complete cds
          Length = 2700

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 341 tacgtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgcccc 400
           ||||||||||||||||| ||||| || || | ||| |||||  ||||||  || ||||||
Sbjct: 154 tacgtgcgctacaccccggagcaagttgaggtgctcgagcggctctacatagattgcccc 213

                      
Query: 401 aagcccagctc 411
           ||||| |||||
Sbjct: 214 aagccaagctc 224



to top

>ref|XM_502214.1| Yarrowia lipolytica CLIB122, YALI0C24189g predicted mRNA
          Length = 2052

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 241 cggcgggcacggcgggcacggcg 263
           |||||||||||||||||||||||
Sbjct: 145 cggcgggcacggcgggcacggcg 123



to top

>emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete genome; segment 18/29
          Length = 292100

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 356    cccgagcaggtggatgcgctgga 378
              |||||||||||||||||||||||
Sbjct: 123484 cccgagcaggtggatgcgctgga 123462



to top

>emb|AL939109.1|SCO939109 Streptomyces coelicolor A3(2) complete genome; segment 6/29
          Length = 277000

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 239    cacggcgggcacggcgggcacggcggg 265
              ||||||||||||||||| |||||||||
Sbjct: 252848 cacggcgggcacggcggacacggcggg 252822



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 241    cggcgggcacggcgggcacggcgg 264
              |||||| |||||||||||||||||
Sbjct: 252855 cggcggacacggcgggcacggcgg 252832



to top

>gb|DQ385533.1| Physcomitrella patens class III homeodomain-leucine zipper (C3HDZ1)
           gene, partial cds
          Length = 5211

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 338 aagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgt 384
           ||||| ||||||||||||  |||||| ||||| || |||||||||||
Sbjct: 16  aagtatgtgcgctacaccaacgagcaagtggaagcactggagcgcgt 62



to top

>gb|DQ385516.1| Physcomitrella patens class III homeodomain-leucine zipper protein
           C3HDZ1 (C3HDZ1) mRNA, complete cds
          Length = 2502

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 338 aagtacgtgcgctacacccccgagcaggtggatgcgctggagcgcgt 384
           ||||| ||||||||||||  |||||| ||||| || |||||||||||
Sbjct: 16  aagtatgtgcgctacaccaacgagcaagtggaagcactggagcgcgt 62



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 220      ggcgggggcgatggtggtgcacggcgg 246
                ||||| |||||||||||||||||||||
Sbjct: 29529099 ggcggcggcgatggtggtgcacggcgg 29529073



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 296      cccggcggcggcagcggcgg 315
                ||||||||||||||||||||
Sbjct: 11341760 cccggcggcggcagcggcgg 11341779



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 298     cggcggcggcagcggcgggg 317
               ||||||||||||||||||||
Sbjct: 5880256 cggcggcggcagcggcgggg 5880275



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 297     ccggcggcggcagcggcggg 316
               ||||||||||||||||||||
Sbjct: 5029520 ccggcggcggcagcggcggg 5029501



to top

>dbj|AP003634.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0655A07
          Length = 172473

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 220   ggcgggggcgatggtggtgcacggcgg 246
             ||||| |||||||||||||||||||||
Sbjct: 93605 ggcggcggcgatggtggtgcacggcgg 93579



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 46.1 bits (23), Expect = 0.096
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 241     cggcgggcacggcgggcacggcg 263
               |||||||||||||||||||||||
Sbjct: 3233332 cggcgggcacggcgggcacggcg 3233354



to top

>ref|NM_183008.1| Homo sapiens UBX domain containing 5 (UBXD5), transcript variant 2,
            mRNA
          Length = 1771

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1696 ggggccgggaccgggaccgggacagg 1671



to top

>ref|NM_146222.2| Mus musculus cDNA sequence BC024479 (BC024479), mRNA
          Length = 2307

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 293 tcgcccggcggcggcagcggcggggc 318
           ||||||||||||||||| ||||||||
Sbjct: 250 tcgcccggcggcggcagtggcggggc 275



to top

>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete
              sequence
          Length = 1178688

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 238    gcacggcgggcacggcgggcac 259
              ||||||||||||||||||||||
Sbjct: 834133 gcacggcgggcacggcgggcac 834154



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 242    ggcgggcacggcgggcacggcggg 265
              |||| |||||||||||||||||||
Sbjct: 834128 ggcgagcacggcgggcacggcggg 834151



to top

>ref|XM_600204.2| PREDICTED: Bos taurus similar to potassium channel, subfamily K,
            member 12 (LOC521931), mRNA
          Length = 2867

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 298  cggcggcggcagcggcggggcg 319
            ||||||||||||||||||||||
Sbjct: 1487 cggcggcggcagcggcggggcg 1466



to top

>gb|AC105958.11| Mus musculus chromosome 9, clone RP24-325P4, complete sequence
          Length = 195129

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 293    tcgcccggcggcggcagcggcggggc 318
              ||||||||||||||||| ||||||||
Sbjct: 104231 tcgcccggcggcggcagtggcggggc 104256



to top

>gb|AF370425.1| Homo sapiens PP2243 mRNA, complete cds
          Length = 1721

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1541 ggggccgggaccgggaccgggacagg 1516



to top

>ref|XM_541888.2| PREDICTED: Canis familiaris similar to DALR anticodon binding
           domain containing 3 isoform 1 (LOC484772), mRNA
          Length = 1959

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 241 cggcgggcacggcgggcacggc 262
           ||||||||||||||||||||||
Sbjct: 667 cggcgggcacggcgggcacggc 646



to top

>gb|AF267536.2| Takifugu rubripes NKX2.9 (nkx2.9) gene, exons 1 and 2 and complete cds;
             and Pax9 (pax9) gene, exons 1 through 4 and complete cds
          Length = 24431

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 260   ggcgggggcagggaccgggaccggga 285
             |||||||||||||| |||||||||||
Sbjct: 22030 ggcgggggcagggagcgggaccggga 22005



to top

>ref|XM_538483.2| PREDICTED: Canis familiaris similar to potassium channel, subfamily
           K, member 12 (LOC481362), mRNA
          Length = 1445

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 cggcggcggcagcggcggggcg 319
           ||||||||||||||||||||||
Sbjct: 69  cggcggcggcagcggcggggcg 48



to top

>emb|CR732076.2|CNS0GRTD Tetraodon nigroviridis full-length cDNA
          Length = 1324

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 298  cggcggcggcagcggcggggcg 319
            ||||||||||||||||||||||
Sbjct: 1071 cggcggcggcagcggcggggcg 1050



to top

>emb|AL451139.40| Human DNA sequence from clone RP11-569G9 on chromosome 1 Contains the
             3' end of a novel gene (DKFZP434L0117), the SH3BGRL3 gene
             for SH3 domain binding glutamic acid-rich protein like 3,
             the gene for socius (SOC), the CDW52 gene for CDW52
             antigen (CAMPATH-1 antigen), the AIM1L gene for absent in
             melanoma 1-like and a novel gene,, complete sequence
          Length = 145736

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 264   ggggcagggaccgggaccgggacagg 289
             ||||| ||||||||||||||||||||
Sbjct: 18784 ggggccgggaccgggaccgggacagg 18809



to top

>emb|BX648412.1|HSM808560 Homo sapiens mRNA; cDNA DKFZp686H22235 (from clone DKFZp686H22235)
          Length = 2590

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 2442 ggggccgggaccgggaccgggacagg 2417



to top

>gb|AF521018.1| Homo sapiens SOCIUS protein isoform 2 mRNA, complete cds
          Length = 1534

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1444 ggggccgggaccgggaccgggacagg 1419



to top

>gb|DQ385537.1| Psilotum nudum class III homeodomain-leucine zipper (C3HDZ1) gene,
           complete cds
          Length = 5927

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 359 gagcaggtggatgcgctggagcgcgtctacagcgagtgccccaagcccag 408
           ||||||||||| ||||| |||||  ||||||  ||||| |||||||||||
Sbjct: 70  gagcaggtggaggcgcttgagcgtctctacaatgagtgtcccaagcccag 119



to top

>emb|CR749413.1| Homo sapiens mRNA; cDNA DKFZp686F04228 (from clone DKFZp686F04228)
          Length = 2759

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 2575 ggggccgggaccgggaccgggacagg 2550



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 302     ggcggcagcggcggggcgccgc 323
               ||||||||||||||||||||||
Sbjct: 1757762 ggcggcagcggcggggcgccgc 1757741



to top

>gb|DQ385521.1| Psilotum nudum class III homeodomain-leucine zipper protein C3HDZ1
           (C3HDZ1) mRNA, partial cds
          Length = 2482

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 359 gagcaggtggatgcgctggagcgcgtctacagcgagtgccccaagcccag 408
           ||||||||||| ||||| |||||  ||||||  ||||| |||||||||||
Sbjct: 70  gagcaggtggaggcgcttgagcgtctctacaatgagtgtcccaagcccag 119



to top

>emb|CR625017.1| full-length cDNA clone CS0DK008YF07 of HeLa cells Cot 25-normalized
            of Homo sapiens (human)
          Length = 1745

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1668 ggggccgggaccgggaccgggacagg 1643



to top

>dbj|AK097368.1| Homo sapiens cDNA FLJ40049 fis, clone SYNOV2001708
          Length = 1920

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1845 ggggccgggaccgggaccgggacagg 1820



to top

>emb|CR612365.1| full-length cDNA clone CS0DL007YI04 of B cells (Ramos cell line) Cot
            25-normalized of Homo sapiens (human)
          Length = 1579

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1544 ggggccgggaccgggaccgggacagg 1519



to top

>dbj|AK094198.1| Homo sapiens cDNA FLJ36879 fis, clone BGGI11000193
          Length = 2278

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1199 ggggccgggaccgggaccgggacagg 1174



to top

>dbj|AK093258.1| Homo sapiens cDNA FLJ35939 fis, clone TESTI2011605
          Length = 1771

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1696 ggggccgggaccgggaccgggacagg 1671



to top

>emb|CR590200.1| full-length cDNA clone CS0DL011YH08 of B cells (Ramos cell line) Cot
            25-normalized of Homo sapiens (human)
          Length = 1818

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1803 ggggccgggaccgggaccgggacagg 1778



to top

>gb|AC124316.32| Mus musculus chromosome 17, clone RP24-222O13, complete sequence
          Length = 223552

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 298   cggcggcggcagcggcggggcg 319
             ||||||||||||||||||||||
Sbjct: 83092 cggcggcggcagcggcggggcg 83113



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                            
Query: 344      gtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgccccaag 403
                |||| |||||| || ||||||||||| ||||| ||||| || || | ||| |||||||||
Sbjct: 20463304 gtgcactacacgcctgagcaggtggaggcgcttgagcgggtgtataccgattgccccaag 20463363

                  
Query: 404      cc 405
                ||
Sbjct: 20463364 cc 20463365



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 23641050 cggcggcggcagcggcgggg 23641069



to top

>gb|AF287300.1|AF287300 Rattus norvegicus tandem pore domain potassium channel THIK-2
           (Kcnk12) mRNA, complete cds
          Length = 1900

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 cggcggcggcagcggcggggcg 319
           ||||||||||||||||||||||
Sbjct: 536 cggcggcggcagcggcggggcg 515



to top

>ref|NM_022292.1| Rattus norvegicus potassium channel, subfamily K, member 12
           (Kcnk12), mRNA
          Length = 1900

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 cggcggcggcagcggcggggcg 319
           ||||||||||||||||||||||
Sbjct: 536 cggcggcggcagcggcggggcg 515



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 241     cggcgggcacggcgggcacggc 262
               ||||||||||||||||||||||
Sbjct: 4233510 cggcgggcacggcgggcacggc 4233489



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 241     cggcgggcacggcgggcacggcgggggc 268
               ||||||| ||||||| ||||||||||||
Sbjct: 5098577 cggcgggtacggcggccacggcgggggc 5098550



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 239    cacggcgggcacggcgggca 258
              ||||||||||||||||||||
Sbjct: 451305 cacggcgggcacggcgggca 451286



to top

>ref|NM_199251.1| Mus musculus potassium channel, subfamily K, member 12 (Kcnk12),
           mRNA
          Length = 1952

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 cggcggcggcagcggcggggcg 319
           ||||||||||||||||||||||
Sbjct: 587 cggcggcggcagcggcggggcg 566



to top

>gb|AY007163.1| Homo sapiens clone CDABP0155 mRNA sequence
          Length = 1295

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 1211 ggggccgggaccgggaccgggacagg 1186



to top

>emb|BX647774.1|HSM807920 Homo sapiens mRNA; cDNA DKFZp686O1259 (from clone DKFZp686O1259)
          Length = 2701

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 2541 ggggccgggaccgggaccgggacagg 2516



to top

>dbj|AB052939.1| Mus musculus mntk1 mRNA, complete cds
          Length = 1952

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 298 cggcggcggcagcggcggggcg 319
           ||||||||||||||||||||||
Sbjct: 587 cggcggcggcagcggcggggcg 566



to top

>dbj|AP004463.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0456B03
          Length = 152973

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                         
Query: 344   gtgcgctacacccccgagcaggtggatgcgctggagcgcgtctacagcgagtgccccaag 403
             |||| |||||| || ||||||||||| ||||| ||||| || || | ||| |||||||||
Sbjct: 93934 gtgcactacacgcctgagcaggtggaggcgcttgagcgggtgtataccgattgccccaag 93993

               
Query: 404   cc 405
             ||
Sbjct: 93994 cc 93995



to top

>dbj|AK074358.1| Homo sapiens cDNA FLJ23778 fis, clone HEP20701
          Length = 2431

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 264  ggggcagggaccgggaccgggacagg 289
            ||||| ||||||||||||||||||||
Sbjct: 2261 ggggccgggaccgggaccgggacagg 2236



to top

>gb|BC066002.1| Mus musculus cDNA sequence BC024479, mRNA (cDNA clone MGC:90123
           IMAGE:5701381), complete cds
          Length = 2307

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 293 tcgcccggcggcggcagcggcggggc 318
           ||||||||||||||||| ||||||||
Sbjct: 250 tcgcccggcggcggcagtggcggggc 275



to top

>gb|AC073435.26| Mus musculus strain C57BL/6J chromosome 9 clone rp23-383h20, complete
              sequence
          Length = 221953

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 293    tcgcccggcggcggcagcggcggggc 318
              ||||||||||||||||| ||||||||
Sbjct: 213784 tcgcccggcggcggcagtggcggggc 213759



to top

>dbj|AU066557.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, paraquat
           inducible, complete cds, clone:PQ2
          Length = 665

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 298 cggcggcggcagcggcggggcg 319
           ||||||||||||||||||||||
Sbjct: 172 cggcggcggcagcggcggggcg 193



to top

>gb|BC108558.1| Xenopus laevis cDNA clone MGC:131026 IMAGE:7980196, complete cds
          Length = 1403

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 259 cggcgggggcagggaccgggaccgg 283
           |||||| ||||||||||||||||||
Sbjct: 740 cggcggcggcagggaccgggaccgg 764



to top

>gb|AC108762.2| Oryza sativa (japonica cultivar-group) chromosome 9 clone
             OSJNBb0052C07, complete sequence
          Length = 154528

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 298   cggcggcggcagcggcggggc 318
             |||||||||||||||||||||
Sbjct: 81706 cggcggcggcagcggcggggc 81686



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 297    ccggcggcggcagcggcggg 316
              ||||||||||||||||||||
Sbjct: 142906 ccggcggcggcagcggcggg 142887



to top

>ref|XM_479146.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1816

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 295  gcccggcggcggcagcggcgg 315
            |||||||||||||||||||||
Sbjct: 1399 gcccggcggcggcagcggcgg 1419



to top

>gb|AC161812.3| Mus musculus chromosome 15, clone RP23-195I24, complete sequence
          Length = 204464

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 262    cgggggcagggaccgggaccgggac 286
              ||||||| |||||||||||||||||
Sbjct: 176991 cgggggcggggaccgggaccgggac 176967



to top

>ref|XM_868865.1| PREDICTED: Bos taurus similar to FAS-associated factor 1 (FAF1
           protein) (LOC616759), partial mRNA
          Length = 1156

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 cgcccggcggcggcagcggcg 314
           |||||||||||||||||||||
Sbjct: 1   cgcccggcggcggcagcggcg 21



to top

>gb|CP000353.1| Ralstonia metallidurans CH34 megaplasmid, complete sequence
          Length = 2580084

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 304    cggcagcggcggggcgccgca 324
              |||||||||||||||||||||
Sbjct: 522911 cggcagcggcggggcgccgca 522931



to top

>ref|XM_751805.1| Ustilago maydis 521 hypothetical protein (UM00751.1) partial mRNA
          Length = 5733

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 299  ggcggcggcagcggcggggcg 319
            |||||||||||||||||||||
Sbjct: 5530 ggcggcggcagcggcggggcg 5550



to top

>ref|XM_532944.2| PREDICTED: Canis familiaris hypothetical LOC130733 (LOC475737),
           mRNA
          Length = 1850

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 295 gcccggcggcggcagcggcggggcg 319
           ||||||||||||| |||||||||||
Sbjct: 179 gcccggcggcggccgcggcggggcg 203



to top

>ref|XM_538738.2| PREDICTED: Canis familiaris similar to Exosome complex exonuclease
           RRP40 (Ribosomal RNA processing protein 40) (Exosome
           component 3) (p10) (LOC481616), mRNA
          Length = 1100

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 295 gcccggcggcggcagcggcgg 315
           |||||||||||||||||||||
Sbjct: 270 gcccggcggcggcagcggcgg 290



to top

>emb|AL590233.23| Human DNA sequence from clone RP13-93L13 on chromosome 9 Contains a
            ubiquitin-conjugating enzyme E2 pseudogene, a
            proliferation-associated 2G4, 38kDa (PA2G4) pseuodgene,
            the 5' end of the SEMA4D gene for sema domain,
            immunoglobulin domain (Ig), transmembrane domain (TM) and
            short cytoplasmic domain, (semaphorin) 4D and a CpG
            island, complete sequence
          Length = 109008

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 295  gcccggcggcggcagcggcgg 315
            |||||||||||||||||||||
Sbjct: 4358 gcccggcggcggcagcggcgg 4338



to top

>emb|BX023094.1|CNS08PZE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 103

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 261 gcgggggcagggaccgggaccgggacagg 289
           |||||| |||||||||| |||||||||||
Sbjct: 63  gcggggacagggaccggcaccgggacagg 35



to top

>emb|BX572596.1| Rhodopseudomonas palustris CGA009 complete genome; segment 4/16
          Length = 348942

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 242   ggcgggcacggcgggcacggcgggg 266
             |||||||||| ||||||||||||||
Sbjct: 86179 ggcgggcacgccgggcacggcgggg 86155



to top

>gb|AC104834.4| Mus Musculus Strain C57BL6/J Chromosome 15 RP23-274F23, complete sequence
          Length = 215113

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 262    cgggggcagggaccgggaccgggac 286
              ||||||| |||||||||||||||||
Sbjct: 103042 cgggggcggggaccgggaccgggac 103066



to top

>gb|AE005750.1| Caulobacter crescentus CB15 section 76 of 359 of the complete genome
          Length = 11605

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 300  gcggcggcagcggcggggcgccgcaggtg 328
            |||||||| |||||||||||||| |||||
Sbjct: 7578 gcggcggcggcggcggggcgccgaaggtg 7550



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 297     ccggcggcggcagcggcggggcgccgcag 325
               ||||||||||| ||||||||||| |||||
Sbjct: 1455478 ccggcggcggcggcggcggggcggcgcag 1455506



to top

>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV,
              complete sequence
          Length = 1466886

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 241    cggcgggcacggcgggcacggcggg 265
              ||||||||||||||||| |||||||
Sbjct: 980234 cggcgggcacggcgggcgcggcggg 980258



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 295     gcccggcggcggcagcggcgg 315
               |||||||||||||||||||||
Sbjct: 4693245 gcccggcggcggcagcggcgg 4693265



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 297      ccggcggcggcagcggcggggcgc 320
                ||||||||||| ||||||||||||
Sbjct: 22338351 ccggcggcggcggcggcggggcgc 22338328



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 295      gcccggcggcggcagcggcgg 315
                |||||||||||||||||||||
Sbjct: 25205964 gcccggcggcggcagcggcgg 25205984



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 298      cggcggcggcagcggcgggg 317
                ||||||||||||||||||||
Sbjct: 25219951 cggcggcggcagcggcgggg 25219970



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 297      ccggcggcggcagcggcggggcgc 320
                ||||||||||| ||||||||||||
Sbjct: 20736884 ccggcggcggcggcggcggggcgc 20736861



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 298     cggcggcggcagcggcggggcgccg 322
               |||||||||||||||||| ||||||
Sbjct: 6532382 cggcggcggcagcggcggcgcgccg 6532358



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 298     cggcggcggcagcggcgggg 317
               ||||||||||||||||||||
Sbjct: 3926126 cggcggcggcagcggcgggg 3926107



to top

>gb|AC156445.2| Volvox carteri clone JGIAOBO-25P15, complete sequence
          Length = 31713

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 295  gcccggcggcggcagcggcgg 315
            |||||||||||||||||||||
Sbjct: 7577 gcccggcggcggcagcggcgg 7597



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 243    gcgggcacggcgggcacggcg 263
              |||||||||||||||||||||
Sbjct: 313189 gcgggcacggcgggcacggcg 313169



to top

>dbj|AP006446.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1097H10
          Length = 159732

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 295   gcccggcggcggcagcggcgg 315
             |||||||||||||||||||||
Sbjct: 10849 gcccggcggcggcagcggcgg 10869



to top

>dbj|AP005198.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0616D06
          Length = 153800

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 295   gcccggcggcggcagcggcgg 315
             |||||||||||||||||||||
Sbjct: 22635 gcccggcggcggcagcggcgg 22655



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 298   cggcggcggcagcggcgggg 317
             ||||||||||||||||||||
Sbjct: 36622 cggcggcggcagcggcgggg 36641



to top

>dbj|AP005846.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:B1307A11
          Length = 131538

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 298   cggcggcggcagcggcggggcgccg 322
             |||||||||||||||||| ||||||
Sbjct: 92995 cggcggcggcagcggcggcgcgccg 92971



to top

>dbj|AK071281.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086E05, full
            insert sequence
          Length = 1817

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 295  gcccggcggcggcagcggcgg 315
            |||||||||||||||||||||
Sbjct: 1400 gcccggcggcggcagcggcgg 1420



to top

>dbj|AK064834.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000F19, full
           insert sequence
          Length = 1601

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 298 cggcggcggcagcggcggggc 318
           |||||||||||||||||||||
Sbjct: 475 cggcggcggcagcggcggggc 455



to top

>dbj|AK062257.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-047-G09, full
           insert sequence
          Length = 1508

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 298 cggcggcggcagcggcggggc 318
           |||||||||||||||||||||
Sbjct: 531 cggcggcggcagcggcggggc 511



to top

>dbj|AB013791.1| Ceratopteris richardii mRNA for CRHB1, partial cds
          Length = 765

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 422 cagcagctcatacgcgagtgc 442
           |||||||||||||||||||||
Sbjct: 143 cagcagctcatacgcgagtgc 163



to top

>ref|NM_187946.1| Oryza sativa (japonica cultivar-group), Ozsa8366 predicted mRNA
          Length = 885

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 455 cccggcggcggcagcggcgg 436



to top

>ref|XM_482973.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1880

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 285 cggcggcggcagcggcgggg 304



to top

>ref|XM_475190.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1158

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 296 cccggcggcggcagcggcggggcg 319
           |||||||||||| |||||||||||
Sbjct: 428 cccggcggcggcggcggcggggcg 405



to top

>ref|XM_530793.1| PREDICTED: Pan troglodytes LOC461754 (LOC461754), mRNA
          Length = 1917

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 55  cccggcggcggcagcggcgg 36



to top

>ref|NM_197811.1| Oryza sativa (japonica cultivar-group) hypothetical protein
            (OSJNBa0057L21.6), mRNA
          Length = 2076

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  gcggcggcagcggcggggcgccgc 323
            ||||||||||||| ||||||||||
Sbjct: 1104 gcggcggcagcgggggggcgccgc 1081



to top

>ref|NM_195943.1| Oryza sativa (japonica cultivar-group) hypothetical protein
           (OSJNBb0023M11.12), mRNA
          Length = 972

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 162 cggcggcggcagcggcgggg 181



to top

>gb|BT017144.1| Zea mays clone EL01N0366F12.c mRNA sequence
          Length = 1174

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 827 cccggcggcggcagcggcgg 808



to top

>ref|NM_001007595.1| Homo sapiens nuclear localized factor 2 (NLF2), mRNA
          Length = 1329

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 302 ggcggcagcggcggggcgccgcag 325
           ||||||||||||||||| ||||||
Sbjct: 655 ggcggcagcggcggggccccgcag 632



to top

>ref|XM_469706.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1731

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 297 ccggcggcggcagcggcggggcgc 320
           ||||||||||| ||||||||||||
Sbjct: 379 ccggcggcggcggcggcggggcgc 356



to top

>ref|XM_470403.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1631

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 297  ccggcggcggcagcggcggg 316
            ||||||||||||||||||||
Sbjct: 1111 ccggcggcggcagcggcggg 1092



to top

>ref|XM_479147.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 492

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 345 cggcggcggcagcggcgggg 326



to top

>ref|XM_478529.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 871

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 297 ccggcggcggcagcggcggggcgc 320
           ||||||||||| ||||||||||||
Sbjct: 245 ccggcggcggcggcggcggggcgc 268



to top

>ref|XM_513752.1| PREDICTED: Pan troglodytes B-cell CLL/lymphoma 9 (LOC457248), mRNA
          Length = 4684

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 21  cccggcggcggcagcggcgg 2



to top

>gb|AC108758.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
              OSJNBa0066E19, complete sequence
          Length = 145575

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 297    ccggcggcggcagcggcggg 316
              ||||||||||||||||||||
Sbjct: 126445 ccggcggcggcagcggcggg 126464



to top

>gb|AF411339.1| Homo sapiens brain-derived neurotrophic factor opposite strand (BDNFOS)
             gene, partial sequence; and brain-derived neurotrophic
             factor (BDNF) gene, complete cds
          Length = 115886

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 298   cggcggcggcagcggcgggg 317
             ||||||||||||||||||||
Sbjct: 53391 cggcggcggcagcggcgggg 53372



to top

>gb|AC135421.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0012G21, complete sequence
          Length = 135750

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   ccggcggcggcagcggcggg 316
             ||||||||||||||||||||
Sbjct: 30796 ccggcggcggcagcggcggg 30815



to top

>ref|XM_424089.1| PREDICTED: Gallus gallus similar to cytoplasmic
           activation/proliferation-associated protein 1; caprin-1
           (LOC426445), partial mRNA
          Length = 1652

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 538 cccggcggcggcagcggcgg 557



to top

>gb|AC124327.9| Mus musculus chromosome 8, clone RP24-490I13, complete sequence
          Length = 141781

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 298   cggcggcggcagcggcgggg 317
             ||||||||||||||||||||
Sbjct: 94326 cggcggcggcagcggcgggg 94345



to top

>ref|XM_594925.2| PREDICTED: Bos taurus similar to acyl-Coenzyme A binding domain
           containing 3 (LOC516766), mRNA
          Length = 1185

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 298 cggcggcggcagcggcggggcgcc 321
           ||||||||||||| ||||||||||
Sbjct: 873 cggcggcggcagcagcggggcgcc 850



to top

>gb|AY463276.1| Uncultured proteobacterium clone FOR14 carbon monoxide
           dehydrogenase form I large subunit (coxL) gene, partial
           cds
          Length = 448

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 133 gaccctggccctggctcatc 152
           ||||||||||||||||||||
Sbjct: 427 gaccctggccctggctcatc 408



to top

>ref|XM_582194.2| PREDICTED: Bos taurus similar to Homeobox protein Hox-C13 (Hox-3G),
           transcript variant 1 (LOC538716), mRNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 85  cggcggcggcagcggcgggg 104



to top

>ref|NM_144831.2| Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 8 (Dhx8), mRNA
          Length = 4344

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 gggaccgggaccgggacagg 289
           ||||||||||||||||||||
Sbjct: 660 gggaccgggaccgggacagg 679



to top

>ref|XM_580301.2| PREDICTED: Bos taurus similar to adenylate cyclase 5 (LOC538432),
           mRNA
          Length = 1701

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 cggcggcagcggcggggcgc 320
           ||||||||||||||||||||
Sbjct: 886 cggcggcagcggcggggcgc 905



to top

>ref|NM_011141.1| Mus musculus POU domain, class 3, transcription factor 1 (Pou3f1),
           mRNA
          Length = 1517

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 299 ggcggcggcagcggcggggcgccgcagg 326
           ||||||||| ||||||||||| ||||||
Sbjct: 15  ggcggcggcggcggcggggcggcgcagg 42



to top

>ref|NM_172755.2| Mus musculus splicing factor, arginine/serine-rich 14 (Sfrs14),
           mRNA
          Length = 3891

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 375 cggcggcggcagcggcgggg 394



to top

>gb|BC045986.1| Danio rerio makorin, ring finger protein, 2, mRNA (cDNA clone
           MGC:56198 IMAGE:5600186), complete cds
          Length = 1519

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 539 cccggcggcggcagcggcgg 520



to top

>ref|NM_194268.1| Mus musculus one cut domain, family member 2 (Onecut2), mRNA
          Length = 1664

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 124 cggcggcggcagcggcgggg 143



to top

>ref|NM_005811.2| Homo sapiens growth differentiation factor 11 (GDF11), mRNA
          Length = 1662

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 145 cggcggcggcagcggcgggg 164



to top

>gb|AY745194.1| Gallus gallus cytoplasmic activation- proliferation-associated
           protein 1 mRNA, complete cds
          Length = 2109

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 72  cccggcggcggcagcggcgg 91



to top

>gb|BC065064.1| Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 8, mRNA (cDNA
           clone IMAGE:6401091), partial cds
          Length = 4283

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 gggaccgggaccgggacagg 289
           ||||||||||||||||||||
Sbjct: 589 gggaccgggaccgggacagg 608



to top

>gb|AY264920.1| Ovis aries homeo box C13 (Hoxc13) gene, exon 1 and partial cds
          Length = 1861

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  cggcggcggcagcggcgggg 317
            ||||||||||||||||||||
Sbjct: 1211 cggcggcggcagcggcgggg 1230



to top

>gb|BC065352.1| Danio rerio makorin, ring finger protein, 2, mRNA (cDNA clone
           MGC:77393 IMAGE:6969527), complete cds
          Length = 2004

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 527 cccggcggcggcagcggcgg 508



to top

>gb|AC092852.6| Oryza sativa chromosome 3 BAC OSJNBa0032G11 genomic sequence, complete
              sequence
          Length = 156606

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 297    ccggcggcggcagcggcggg 316
              ||||||||||||||||||||
Sbjct: 134944 ccggcggcggcagcggcggg 134963



to top

>ref|XM_001001997.1| PREDICTED: Mus musculus hypothetical protein LOC668520 (LOC668520),
           mRNA
          Length = 792

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 377 cccggcggcggcagcggcgg 396



to top

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 309     gcggcggggcgccgcaggtg 328
               ||||||||||||||||||||
Sbjct: 1682970 gcggcggggcgccgcaggtg 1682989



to top

>ref|XM_533770.2| PREDICTED: Canis familiaris similar to Membrane associated guanylate
            kinase, WW and PDZ domain containing protein 1
            (BAI1-associated protein 1) (BAP-1) (Membrane associated
            guanylate kinase inverted-1) (MAGI-1) (Atrophin-1
            interacting protein 3) (AIP3) (WW domain-containing p...
            (LOC476565), mRNA
          Length = 4782

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 270  gggaccgggaccgggacagg 289
            ||||||||||||||||||||
Sbjct: 4478 gggaccgggaccgggacagg 4497



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 359    gagcaggtggatgcgctgga 378
              ||||||||||||||||||||
Sbjct: 757802 gagcaggtggatgcgctgga 757821



to top

>gb|BC085956.1| Rattus norvegicus zinc finger, AN1-type domain 3, mRNA (cDNA clone
           MGC:95308 IMAGE:7134959), complete cds
          Length = 2617

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 33  cggcggcggcagcggcgggg 14



to top

>gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosome 7, complete sequence
          Length = 152908

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      ctttcccttcccttccatcc 20
              ||||||||||||||||||||
Sbjct: 143518 ctttcccttcccttccatcc 143537



to top

>gb|AC106818.2| Homo sapiens chromosome 5 clone RP11-65F13, complete sequence
          Length = 180056

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 296   cccggcggcggcagcggcgg 315
             ||||||||||||||||||||
Sbjct: 48649 cccggcggcggcagcggcgg 48668



to top

>gb|BC057305.1| Mus musculus splicing factor, arginine/serine-rich 14, mRNA (cDNA
           clone MGC:66544 IMAGE:6822887), complete cds
          Length = 4296

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 35  cggcggcggcagcggcgggg 54



to top

>gb|AC117188.3| Mus musculus BAC clone RP23-42E3 from 1, complete sequence
          Length = 226443

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 296    cccggcggcggcagcggcgg 315
              ||||||||||||||||||||
Sbjct: 154334 cccggcggcggcagcggcgg 154353



to top

>gb|AC098886.4| Mus musculus BAC clone RP23-122M21 from 4, complete sequence
          Length = 219825

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 299    ggcggcggcagcggcggggcgccgcagg 326
              ||||||||| ||||||||||| ||||||
Sbjct: 113991 ggcggcggcggcggcggggcggcgcagg 113964



to top

>gb|AC122004.2| Mus musculus BAC clone RP24-337O4 from 18, complete sequence
          Length = 133247

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 262   cgggggcagggaccgggaccgggacagg 289
             ||||||||||||| ||||| ||||||||
Sbjct: 56086 cgggggcagggacagggacagggacagg 56059



to top

>gb|BC057390.1| Homo sapiens Ras-induced senescence 1, mRNA (cDNA clone MGC:57838
            IMAGE:6175193), complete cds
          Length = 1798

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 298  cggcggcggcagcggcgggg 317
            ||||||||||||||||||||
Sbjct: 1077 cggcggcggcagcggcgggg 1058



to top

>ref|NM_001012175.1| Rattus norvegicus zinc finger, AN1-type domain 3 (Zfand3), mRNA
          Length = 2617

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 33  cggcggcggcagcggcgggg 14



to top

>gb|BC057181.1| Mus musculus cDNA clone IMAGE:5038990, partial cds
          Length = 1848

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 236 gtgcacggcgggcacggcgg 255
           ||||||||||||||||||||
Sbjct: 222 gtgcacggcgggcacggcgg 203



to top

>emb|CR956634.3| Pig DNA sequence from clone CH242-277I8 on chromosome 17, complete
             sequence
          Length = 206278

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   ggcggcggcagcggcggggc 318
             ||||||||||||||||||||
Sbjct: 98539 ggcggcggcagcggcggggc 98520



to top

>gb|AY242995.1| Mus musculus transcription factor ONECUT2 (Oc2) mRNA, complete cds
          Length = 1664

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 124 cggcggcggcagcggcgggg 143



to top

>gb|BC018089.1| Homo sapiens hypothetical gene supported by AK124699, mRNA (cDNA
           clone IMAGE:4798404)
          Length = 992

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 24  cccggcggcggcagcggcgg 5



to top

>gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, complete sequence
          Length = 1471779

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 355     ccccgagcaggtggatgcgc 374
               ||||||||||||||||||||
Sbjct: 1251351 ccccgagcaggtggatgcgc 1251370



to top

>gb|AY341860.1| Oryza sativa (japonica cultivar-group) WRKY20 mRNA, complete cds
          Length = 1630

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 101 gaggcggcgcgcggagggca 120
           ||||||||||||||||||||
Sbjct: 478 gaggcggcgcgcggagggca 459



to top

>gb|AC092554.3| Papio anubis clone RP41-414G17, complete sequence
          Length = 167543

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 300   gcggcggcagcggcggggcg 319
             ||||||||||||||||||||
Sbjct: 33871 gcggcggcagcggcggggcg 33852



to top

>gb|AC120049.5| Homo sapiens chromosome 18, clone RP11-456K23, complete sequence
          Length = 125488

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 100   ggaggcggcgcgcggagggc 119
             ||||||||||||||||||||
Sbjct: 84872 ggaggcggcgcgcggagggc 84853



to top

>emb|BX067985.1|CNS09OMD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 848 cccggcggcggcagcggcgg 829



to top

>emb|Z29371.1|OCMRADCYV O.cuniculus  mRNA for adenylyl cyclase type V
          Length = 4995

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 301 cggcggcagcggcggggcgc 320
           ||||||||||||||||||||
Sbjct: 940 cggcggcagcggcggggcgc 959



to top

>emb|X98515.1|SPSNBAGEN S.pristinaespiralis snbA gene
          Length = 1879

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 ggcgggcacggcgggcacgg 261
           ||||||||||||||||||||
Sbjct: 566 ggcgggcacggcgggcacgg 547



to top

>emb|X78335.1|GGRARA21 Gallus gallus retinoic acid receptor alpha isoform 2-1 mRNA
          Length = 1494

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 346 gcgctacacccccgagcagg 365
           ||||||||||||||||||||
Sbjct: 813 gcgctacacccccgagcagg 832



to top

>emb|X73972.1|GGRARA1 G.gallus RAR-alpha1 mRNA for retinoic acid receptor
          Length = 1552

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 346 gcgctacacccccgagcagg 365
           ||||||||||||||||||||
Sbjct: 882 gcgctacacccccgagcagg 901



to top

>emb|X54628.1|MMOCT6GR M. musculus oct6 gene for the octamer binding factor oct6
          Length = 1517

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 299 ggcggcggcagcggcggggcgccgcagg 326
           ||||||||| ||||||||||| ||||||
Sbjct: 15  ggcggcggcggcggcggggcggcgcagg 42



to top

>gb|AC103796.3| Homo sapiens chromosome 11, clone RP11-1033A18, complete sequence
          Length = 211799

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  cggcggcggcagcggcgggg 317
            ||||||||||||||||||||
Sbjct: 3881 cggcggcggcagcggcgggg 3900



to top

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 294    cgcccggcggcggcagcggc 313
              ||||||||||||||||||||
Sbjct: 804046 cgcccggcggcggcagcggc 804065



to top

>emb|BX640449.1| Bordetella bronchiseptica strain RB50, complete genome; segment 13/16
          Length = 348074

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 302    ggcggcagcggcggggcgcc 321
              ||||||||||||||||||||
Sbjct: 314700 ggcggcagcggcggggcgcc 314681



to top

>emb|BX640434.1| Bordetella parapertussis strain 12822, complete genome; segment 12/14
          Length = 344805

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 302    ggcggcagcggcggggcgcc 321
              ||||||||||||||||||||
Sbjct: 258590 ggcggcagcggcggggcgcc 258571



to top

>emb|BX640420.1| Bordetella pertussis strain Tohama I, complete genome; segment 10/12
          Length = 348134

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 302    ggcggcagcggcggggcgcc 321
              ||||||||||||||||||||
Sbjct: 114338 ggcggcagcggcggggcgcc 114319



to top

>emb|AJ251217.1|PSP251217 Pseudomonas sp. B4 gene encoding putative transposase, ORF0 and ORF1
            DNA, bphA1, bphA2, bphA3 and bphA4 genes
          Length = 6012

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 355  ccccgagcaggtggatgcgc 374
            ||||||||||||||||||||
Sbjct: 4888 ccccgagcaggtggatgcgc 4869



to top

>emb|AJ720561.1| Gallus gallus mRNA for hypothetical protein, clone 20e8
          Length = 2247

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 gcccggcggcggcagcggcg 314
           ||||||||||||||||||||
Sbjct: 264 gcccggcggcggcagcggcg 283



to top

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 124     cgcggcggcgaccctggccctggc 147
               ||||||| ||||||||||||||||
Sbjct: 2536868 cgcggcgtcgaccctggccctggc 2536845



to top

>gb|AC090668.7| Homo sapiens 12 BAC RP11-791O13 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 111375

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 137    ctggccctggctcatcctct 156
              ||||||||||||||||||||
Sbjct: 107174 ctggccctggctcatcctct 107155



to top

>dbj|AP008232.1| Sodalis glossinidius str. 'morsitans' DNA, complete genome
          Length = 4171146

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 301    cggcggcagcggcggggcgc 320
              ||||||||||||||||||||
Sbjct: 270122 cggcggcagcggcggggcgc 270141



to top

>gb|AE006022.1| Caulobacter crescentus CB15 section 348 of 359 of the complete genome
          Length = 10637

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 128  gcggcgaccctggccctggc 147
            ||||||||||||||||||||
Sbjct: 5383 gcggcgaccctggccctggc 5364



to top

>dbj|AK095719.1| Homo sapiens cDNA FLJ38400 fis, clone FEBRA2008159
          Length = 2869

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 25  cccggcggcggcagcggcgg 6



to top

>emb|CR611917.1| full-length cDNA clone CS0DI082YG05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1147

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 112 cggcggcggcagcggcgggg 131



to top

>gb|AC107988.4| Homo sapiens chromosome 18, clone CTC-346I21, complete sequence
          Length = 116247

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 100  ggaggcggcgcgcggagggc 119
            ||||||||||||||||||||
Sbjct: 4714 ggaggcggcgcgcggagggc 4733



to top

>tpg|BK005060.1| TPA: TPA_inf: Oryza sativa (indica cultivar-group) WRKY
           transcription factor 57 (WRKY57) gene, complete cds
          Length = 3018

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 101 gaggcggcgcgcggagggca 120
           ||||||||||||||||||||
Sbjct: 429 gaggcggcgcgcggagggca 410



to top

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 94     tccacgggaggcggcgcgcg 113
              ||||||||||||||||||||
Sbjct: 951617 tccacgggaggcggcgcgcg 951636



to top

>gb|AC077693.19| Oryza sativa chromosome 10 BAC OSJNBa0095C07 genomic sequence,
            complete sequence
          Length = 187707

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 300  gcggcggcagcggcggggcgccgc 323
            ||||||||||||| ||||||||||
Sbjct: 6228 gcggcggcagcgggggggcgccgc 6251



to top

>gb|AC084320.10| Oryza sativa chromosome 3 BAC OSJNBa0091J19 genomic sequence, complete
             sequence
          Length = 178158

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 298   cggcggcggcagcggcgggg 317
             ||||||||||||||||||||
Sbjct: 63008 cggcggcggcagcggcgggg 62989



to top

>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete
             sequence
          Length = 147117

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 298   cggcggcggcagcggcgggg 317
             ||||||||||||||||||||
Sbjct: 63277 cggcggcggcagcggcgggg 63258



to top

>dbj|AB094101.1| Betula maximowicziana DNA, microsatellite Bmax630
          Length = 232

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 196 cggcggcggcagcggcgggg 215



to top

>gb|AC092749.1| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar
             Nipponbare clone OSJNBb0023M11, from chromosome 10,
             complete sequence
          Length = 138668

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 298   cggcggcggcagcggcgggg 317
             ||||||||||||||||||||
Sbjct: 59780 cggcggcggcagcggcgggg 59761



to top

>gb|AC087599.14| Oryza sativa chromosome 10 BAC OSJNBa0057L21 genomic sequence,
            complete sequence
          Length = 183046

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 300  gcggcggcagcggcggggcgccgc 323
            ||||||||||||| ||||||||||
Sbjct: 6637 gcggcggcagcgggggggcgccgc 6614



to top

>dbj|AK142226.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:D330014J18 product:DEAH (Asp-Glu-Ala-His)
           box polypeptide 8, full insert sequence
          Length = 4250

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 gggaccgggaccgggacagg 289
           ||||||||||||||||||||
Sbjct: 594 gggaccgggaccgggacagg 613



to top

>gb|AY660573.1| Oryza sativa (japonica cultivar-group) cultivar TP309 putative D
           type cyclin gene, partial cds
          Length = 1036

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 623 cggcggcggcagcggcgggg 642



to top

>dbj|AK148316.1| Mus musculus B16 F10Y cells cDNA, RIKEN full-length enriched
           library, clone:G370087H04 product:testis expressed gene
           27, full insert sequence
          Length = 3450

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 79  cggcggcggcagcggcgggg 60



to top

>dbj|AK147659.1| Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN
           full-length enriched library, clone:M5C1102K16
           product:B-cell CLL/lymphoma 9, full insert sequence
          Length = 6103

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 34  cccggcggcggcagcggcgg 15



to top

>dbj|AK155423.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630226D05
           product:growth factor receptor bound protein
           2-associated protein 1, full insert sequence
          Length = 4864

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 236 gtgcacggcgggcacggcgg 255
           ||||||||||||||||||||
Sbjct: 822 gtgcacggcgggcacggcgg 803



to top

>ref|XM_942917.1| PREDICTED: Homo sapiens hypothetical protein LOC647650 (LOC647650),
           mRNA
          Length = 1053

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 507 cccggcggcggcagcggcgg 488



to top

>ref|XM_932488.1| PREDICTED: Homo sapiens hypothetical protein LOC644880 (LOC644880),
           mRNA
          Length = 1242

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 696 cccggcggcggcagcggcgg 677



to top

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 246     ggcacggcgggcacggcggg 265
               ||||||||||||||||||||
Sbjct: 2665025 ggcacggcgggcacggcggg 2665006



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 238     gcacggcgggcacggcgggc 257
               ||||||||||||||||||||
Sbjct: 2665024 gcacggcgggcacggcgggc 2665005



to top

>dbj|AK170616.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630110L04
           product:DEAH (Asp-Glu-Ala-His) box polypeptide 8, full
           insert sequence
          Length = 4245

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 gggaccgggaccgggacagg 289
           ||||||||||||||||||||
Sbjct: 588 gggaccgggaccgggacagg 607



to top

>gb|AC151294.3| Mus musculus BAC clone RP23-137I7 from chromosome 17, complete sequence
          Length = 206868

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 298    cggcggcggcagcggcgggg 317
              ||||||||||||||||||||
Sbjct: 199661 cggcggcggcagcggcgggg 199642



to top

>gb|AC021766.6| Homo sapiens, clone RP11-9H20, complete sequence
          Length = 151558

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 100   ggaggcggcgcgcggagggc 119
             ||||||||||||||||||||
Sbjct: 33781 ggaggcggcgcgcggagggc 33762



to top

>gb|AC092558.4| Oryza sativa chromosome 3 BAC OSJNBb0036F07 genomic sequence, complete
              sequence
          Length = 130359

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 297    ccggcggcggcagcggcggggcgc 320
              ||||||||||| ||||||||||||
Sbjct: 114997 ccggcggcggcggcggcggggcgc 115020



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V, complete
               sequence
          Length = 1519138

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 245     gggcacggcgggcacggcgggggc 268
               ||||| ||||||||||||||||||
Sbjct: 1247351 gggcatggcgggcacggcgggggc 1247374



to top

>dbj|AK077951.1| Mus musculus 13 days embryo male testis cDNA, RIKEN full-length
           enriched library, clone:6030458K23 product:similar to
           CHOLINE TRANSPORTER-LIKE PROTEIN 1, SPLICE VARIANT A
           [Rattus norvegicus], full insert sequence
          Length = 1941

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 80  cccggcggcggcagcggcgg 61



to top

>dbj|AK077950.1| Mus musculus 13 days embryo male testis cDNA, RIKEN full-length
           enriched library, clone:6030458J16
           product:unclassifiable, full insert sequence
          Length = 2179

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 68  cccggcggcggcagcggcgg 49



to top

>dbj|AK042293.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630079E18 product:hypothetical
           D111/G-patch domain/Aminoacyl-transfer RNA synthetases
           class-I/Glutamic acid-rich region/SWAP / SURP containing
           protein, full insert sequence
          Length = 3684

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 383 cggcggcggcagcggcgggg 402



to top

>gb|AY027651.1| Pseudomonas sp. Cam-1 bph operon, complete cds
          Length = 6137

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 355  ccccgagcaggtggatgcgc 374
            ||||||||||||||||||||
Sbjct: 3021 ccccgagcaggtggatgcgc 3002



to top

>dbj|AK090169.1| Mus musculus 13 days embryo spinal cord cDNA, RIKEN full-length
           enriched library, clone:G630010A09 product:Rab3
           interacting protein 1, full insert sequence
          Length = 1558

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 296 cccggcggcggcagcggcgg 315
           ||||||||||||||||||||
Sbjct: 165 cccggcggcggcagcggcgg 146



to top

>tpg|BK001744.1| TPA: TPA_exp: Suid herpesvirus 1, complete genome
          Length = 143461

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 270    gggaccgggaccgggacagg 289
              ||||||||||||||||||||
Sbjct: 134490 gggaccgggaccgggacagg 134509



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 270    gggaccgggaccgggacagg 289
              ||||||||||||||||||||
Sbjct: 110112 gggaccgggaccgggacagg 110093



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 297    ccggcggcggcagcggcggg 316
              ||||||||||||||||||||
Sbjct: 669012 ccggcggcggcagcggcggg 668993



to top

>dbj|AK078552.1| Mus musculus 12 days embryo female mullerian duct includes
           surrounding region cDNA, RIKEN full-length enriched
           library, clone:6820449B07 product:ATP-DEPENDENT HELICASE
           DDX8 (RNA HELICASE HRH1) (DEAH-BOX PROTEIN 8) homolog
           [Homo sapiens], full insert sequence
          Length = 3856

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 gggaccgggaccgggacagg 289
           ||||||||||||||||||||
Sbjct: 599 gggaccgggaccgggacagg 618



to top

>gb|AF100907.1|AF100907 Homo sapiens bone morphogenetic protein 11 (BMP11) mRNA, complete
           cds
          Length = 1443

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 145 cggcggcggcagcggcgggg 164



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11,
              complete sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 101    gaggcggcgcgcggagggca 120
              ||||||||||||||||||||
Sbjct: 106722 gaggcggcgcgcggagggca 106741



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 297      ccggcggcggcagcggcggg 316
                ||||||||||||||||||||
Sbjct: 21778387 ccggcggcggcagcggcggg 21778406



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 296      cccggcggcggcagcggcggggcg 319
                |||||||||||| |||||||||||
Sbjct: 18798102 cccggcggcggcggcggcggggcg 18798125



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 44/52 (84%)
 Strand = Plus / Plus

                                                                   
Query: 359     gagcaggtggatgcgctggagcgcgtctacagcgagtgccccaagcccagct 410
               ||||||||||| ||||| ||||| || ||||  |||||||| ||||| ||||
Sbjct: 3331313 gagcaggtggaggcgctagagcgggtgtacactgagtgccctaagcctagct 3331364



to top

>gb|AC099324.5| Oryza sativa chromosome 3 BAC OSJNBb0043P23 genomic sequence, complete
              sequence
          Length = 116443

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 297    ccggcggcggcagcggcggg 316
              ||||||||||||||||||||
Sbjct: 112271 ccggcggcggcagcggcggg 112252



to top

>gb|AC012671.7| Homo sapiens BAC clone RP11-554H10 from 2, complete sequence
          Length = 198694

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 133  gaccctggccctggctcatcctct 156
            ||||||||| ||||||||||||||
Sbjct: 4161 gaccctggctctggctcatcctct 4184



to top

>gb|AC104081.2| Homo sapiens BAC clone RP11-559A1 from 2, complete sequence
          Length = 142118

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 133   gaccctggccctggctcatcctct 156
             ||||||||| ||||||||||||||
Sbjct: 66896 gaccctggctctggctcatcctct 66919



to top

>gb|AC155722.9| Mus musculus 6 BAC RP24-204J8 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 198481

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 296    cccggcggcggcagcggcgg 315
              ||||||||||||||||||||
Sbjct: 181429 cccggcggcggcagcggcgg 181410



to top

>gb|M86348.1|PSEBPHA Pseudomonas sp. LB400 biphenyl dioxygenase (bphA), biphenyl
            dioxygenase (bphE), biphenyl dioxygenase (bphF) and
            biphenyl dioxygenase (bphG)s, complete cds, and
            dihydrodiol dehydrogenase (bphB), partial cds
          Length = 5700

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 355  ccccgagcaggtggatgcgc 374
            ||||||||||||||||||||
Sbjct: 4462 ccccgagcaggtggatgcgc 4443



to top

>gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete
             sequence
          Length = 163828

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 298   cggcggcggcagcggcgggg 317
             ||||||||||||||||||||
Sbjct: 12701 cggcggcggcagcggcgggg 12682



to top

>gb|AC073487.34| Homo sapiens 12 BAC RP11-762I7 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 54666

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  cggcggcggcagcggcgggg 317
            ||||||||||||||||||||
Sbjct: 8234 cggcggcggcagcggcgggg 8253



to top

>gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genomic sequence,
            complete sequence
          Length = 172337

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 298  cggcggcggcagcggcgggg 317
            ||||||||||||||||||||
Sbjct: 8802 cggcggcggcagcggcgggg 8821



to top

>dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0481E12
          Length = 161563

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 239    cacggcgggcacggcgggcacggcgggg 266
              ||||| |||||||| |||||||||||||
Sbjct: 137847 cacggggggcacggtgggcacggcgggg 137820



to top

>ref|NM_204536.1| Gallus gallus retinoic acid receptor alpha 1 isoform (RAR-ALPHA1),
           mRNA
          Length = 1552

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 346 gcgctacacccccgagcagg 365
           ||||||||||||||||||||
Sbjct: 882 gcgctacacccccgagcagg 901



to top

>gb|AF518875.1| Mus musculus arginine/serine-rich 14 splicing factor (Sfrs14) mRNA,
           complete cds
          Length = 3891

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 298 cggcggcggcagcggcgggg 317
           ||||||||||||||||||||
Sbjct: 375 cggcggcggcagcggcgggg 394



to top

>ref|XM_345266.2| PREDICTED: Rattus norvegicus tripartite motif protein 33
           (predicted) (Trim33_predicted), mRNA
          Length = 3435

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 270 gggaccgggaccgggacagg 289
           ||||||||||||||||||||
Sbjct: 320 gggaccgggaccgggacagg 301



to top

>dbj|AP002817.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0699D11
          Length = 140825

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 296   cccggcggcggcagcggcgg 315
             ||||||||||||||||||||
Sbjct: 61355 cccggcggcggcagcggcgg 61336



to top

>gb|AC104839.5| Homo sapiens BAC clone RP13-868N24 from 2, complete sequence
          Length = 38569

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 1    ctttcccttcccttccatcc 20
            ||||||||||||||||||||
Sbjct: 8690 ctttcccttcccttccatcc 8709



to top

>dbj|AP004643.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1113_A10
          Length = 160089

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 298   cggcggcggcagcggcgggg 317
             ||||||||||||||||||||
Sbjct: 48646 cggcggcggcagcggcgggg 48665



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 289     gtcgtcgcccggcggcggcagcgg 312
               ||||||| ||||||||||||||||
Sbjct: 1358783 gtcgtcgaccggcggcggcagcgg 1358806



to top

>dbj|AP006164.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:B1386G10
          Length = 121827

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 296   cccggcggcggcagcggcgg 315
             ||||||||||||||||||||
Sbjct: 29469 cccggcggcggcagcggcgg 29488



to top

>dbj|AP005558.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OJ1155_H10
          Length = 140475

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 297    ccggcggcggcagcggcggggcgc 320
              ||||||||||| ||||||||||||
Sbjct: 100359 ccggcggcggcggcggcggggcgc 100336



to top

>gb|AC102106.14| Mus musculus chromosome 18, clone RP23-92B24, complete sequence
          Length = 230823

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 298    cggcggcggcagcggcgggg 317
              ||||||||||||||||||||
Sbjct: 136573 cggcggcggcagcggcgggg 136554



to top

>dbj|AP006056.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:B1172G12
          Length = 171974

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   ccggcggcggcagcggcggg 316
             ||||||||||||||||||||
Sbjct: 71634 ccggcggcggcagcggcggg 71615


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,914,859
Number of Sequences: 3902068
Number of extensions: 2914859
Number of successful extensions: 148621
Number of sequences better than 10.0: 298
Number of HSP's better than 10.0 without gapping: 321
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 141764
Number of HSP's gapped (non-prelim): 6842
length of query: 442
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 420
effective length of database: 17,147,199,772
effective search space: 7201823904240
effective search space used: 7201823904240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top