ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl02e11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 165 1e-37
2gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 165 1e-37
3emb|AL731756.4|CNS08C85 Oryza sativa chromosome 12, . BAC OJ1220... 165 1e-37
4gb|AC130835.3| Mus musculus BAC clone RP24-132F18 from chromosom... 42 1.5
5gb|AC010165.10|AC010165 Homo sapiens chromosome 5 clone RP11-17J... 42 1.5
6ref|NM_178710.3| Mus musculus SNF1-like kinase 2 (Snf1lk2), mRNA 40 5.8
7gb|AC169699.1| Rhesus Macaque BAC CH250-12P18 (Children's Hospi... 40 5.8
8gb|AC124110.8| Mus musculus chromosome 1, clone RP24-343C13, com... 40 5.8
9gb|AC131592.10| Mus musculus chromosome 1, clone RP24-547I3, com... 40 5.8
10gb|AC103406.7| Mus musculus chromosome 9, clone RP23-106O8, comp... 40 5.8
11gb|AC131695.4| Mus musculus BAC clone RP23-396F8 from chromosome... 40 5.8
12gb|DQ188032.1| Rattus norvegicus salt-inducible kinase 2 (Snf1lk... 40 5.8
13gb|AC127322.4| Mus musculus BAC clone RP23-238A8 from chromosome... 40 5.8
14emb|AL606468.8| Human DNA sequence from clone RP11-15I11 on chro... 40 5.8
15emb|AL353148.8| Human DNA sequence from clone RP11-298H24 on chr... 40 5.8
16emb|AL049695.20|HSJ236J16 Human DNA sequence from clone RP1-236J... 40 5.8
17gb|AC163089.3| Mus musculus chromosome 5, clone RP23-346P15, com... 40 5.8
18gb|AC067964.18| Mus Musculus Strain C57BL6/J Chromosome 5 RP23-3... 40 5.8
19gb|AC022140.6| Homo sapiens chromosome 5 clone CTD-2306M5, compl... 40 5.8
20gb|AF307062.1|AF307062 Digitalis purpurea E2 Adh gene, partial cds 40 5.8
21gb|AF307061.1|AF307061 Digitalis purpurea E1 Adh gene, partial cds 40 5.8
22gb|AC010347.4| Homo sapiens chromosome 5 clone CTD-2018C9, compl... 40 5.8
23dbj|AK090386.1| Mus musculus 11 days embryo spinal cord cDNA, RI... 40 5.8
24gb|AC104697.2| Homo sapiens BAC clone RP11-454B3 from 2, complet... 40 5.8
25gb|AC010546.10| Homo sapiens chromosome 16 clone RP11-50O21, com... 40 5.8
26ref|XM_236228.3| PREDICTED: Rattus norvegicus similar to salt in... 40 5.8
27gb|AC160568.2| Pan troglodytes BAC clone CH251-293A11 from chrom... 40 5.8
28dbj|AB067780.1| Mus musculus SIK2 mRNA for salt inducible kinase... 40 5.8
29gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete ge... 40 5.8
30emb|AL772213.7| Mouse DNA sequence from clone RP23-104G16 on chr... 40 5.8

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  165 bits (83), Expect = 1e-37
 Identities = 218/263 (82%)
 Strand = Plus / Minus

                                                                           
Query: 115     agcaatggtgctaggcctccgtactaagacaaagaaggatgctgccatccatgtagattt 174
               ||||||||||||||||||||| || ||||| | |||||||||  || |||||||||| ||
Sbjct: 7445127 agcaatggtgctaggcctccgaaccaagacgaggaaggatgcatccttccatgtagactt 7445068

                                                                           
Query: 175     caacatcttcatccgggagataagtccatggcccccttctgaatctctcaagtctttgcg 234
               ||| |||||||| |  || || || ||||||||||||||||| || ||||||||||||  
Sbjct: 7445067 caatatcttcattcaagaaatcagcccatggcccccttctgagtccctcaagtctttgaa 7445008

                                                                           
Query: 235     ttctgtggttcttttttgggaaaatggtgaacgcaattcagggaagacaaacaccgttgc 294
                |||||||| || |||||||||||||| || |||||||| |||||||| ||  | |||||
Sbjct: 7445007 atctgtggtcctcttttgggaaaatggcgagcgcaattcggggaagaccaatgctgttgc 7444948

                                                                           
Query: 295     accttcagtccgctcaggatccacatcagggaagatcgaatttaacgagttcataagcat 354
                |||||| |  | |||||  |||||  ||||||| | |||||||| |||||||| | | |
Sbjct: 7444947 gccttcaattggatcaggtaccacagtagggaaggttgaatttaatgagttcatcaacct 7444888

                                      
Query: 355     acaggttgtttttcagaaggagg 377
               ||||| |||||||||||||||||
Sbjct: 7444887 acaggctgtttttcagaaggagg 7444865



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  165 bits (83), Expect = 1e-37
 Identities = 218/263 (82%)
 Strand = Plus / Minus

                                                                           
Query: 115     agcaatggtgctaggcctccgtactaagacaaagaaggatgctgccatccatgtagattt 174
               ||||||||||||||||||||| || ||||| | |||||||||  || |||||||||| ||
Sbjct: 7445006 agcaatggtgctaggcctccgaaccaagacgaggaaggatgcatccttccatgtagactt 7444947

                                                                           
Query: 175     caacatcttcatccgggagataagtccatggcccccttctgaatctctcaagtctttgcg 234
               ||| |||||||| |  || || || ||||||||||||||||| || ||||||||||||  
Sbjct: 7444946 caatatcttcattcaagaaatcagcccatggcccccttctgagtccctcaagtctttgaa 7444887

                                                                           
Query: 235     ttctgtggttcttttttgggaaaatggtgaacgcaattcagggaagacaaacaccgttgc 294
                |||||||| || |||||||||||||| || |||||||| |||||||| ||  | |||||
Sbjct: 7444886 atctgtggtcctcttttgggaaaatggcgagcgcaattcggggaagaccaatgctgttgc 7444827

                                                                           
Query: 295     accttcagtccgctcaggatccacatcagggaagatcgaatttaacgagttcataagcat 354
                |||||| |  | |||||  |||||  ||||||| | |||||||| |||||||| | | |
Sbjct: 7444826 gccttcaattggatcaggtaccacagtagggaaggttgaatttaatgagttcatcaacct 7444767

                                      
Query: 355     acaggttgtttttcagaaggagg 377
               ||||| |||||||||||||||||
Sbjct: 7444766 acaggctgtttttcagaaggagg 7444744



to top

>emb|AL731756.4|CNS08C85 Oryza sativa chromosome 12, . BAC OJ1220_D01 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 98782

 Score =  165 bits (83), Expect = 1e-37
 Identities = 218/263 (82%)
 Strand = Plus / Minus

                                                                         
Query: 115   agcaatggtgctaggcctccgtactaagacaaagaaggatgctgccatccatgtagattt 174
             ||||||||||||||||||||| || ||||| | |||||||||  || |||||||||| ||
Sbjct: 34803 agcaatggtgctaggcctccgaaccaagacgaggaaggatgcatccttccatgtagactt 34744

                                                                         
Query: 175   caacatcttcatccgggagataagtccatggcccccttctgaatctctcaagtctttgcg 234
             ||| |||||||| |  || || || ||||||||||||||||| || ||||||||||||  
Sbjct: 34743 caatatcttcattcaagaaatcagcccatggcccccttctgagtccctcaagtctttgaa 34684

                                                                         
Query: 235   ttctgtggttcttttttgggaaaatggtgaacgcaattcagggaagacaaacaccgttgc 294
              |||||||| || |||||||||||||| || |||||||| |||||||| ||  | |||||
Sbjct: 34683 atctgtggtcctcttttgggaaaatggcgagcgcaattcggggaagaccaatgctgttgc 34624

                                                                         
Query: 295   accttcagtccgctcaggatccacatcagggaagatcgaatttaacgagttcataagcat 354
              |||||| |  | |||||  |||||  ||||||| | |||||||| |||||||| | | |
Sbjct: 34623 gccttcaattggatcaggtaccacagtagggaaggttgaatttaatgagttcatcaacct 34564

                                    
Query: 355   acaggttgtttttcagaaggagg 377
             ||||| |||||||||||||||||
Sbjct: 34563 acaggctgtttttcagaaggagg 34541



to top

>gb|AC130835.3| Mus musculus BAC clone RP24-132F18 from chromosome 19, complete sequence
          Length = 170078

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 91     agctccatcagtttctagtgt 111
              |||||||||||||||||||||
Sbjct: 126426 agctccatcagtttctagtgt 126406



to top

>gb|AC010165.10|AC010165 Homo sapiens chromosome 5 clone RP11-17J3, complete sequence
          Length = 168909

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 237   ctgtggttcttttttgggaaa 257
             |||||||||||||||||||||
Sbjct: 23846 ctgtggttcttttttgggaaa 23826



to top

>ref|NM_178710.3| Mus musculus SNF1-like kinase 2 (Snf1lk2), mRNA
          Length = 3561

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 112  ttcagcaatggtgctaggcc 131
            ||||||||||||||||||||
Sbjct: 1284 ttcagcaatggtgctaggcc 1265



to top

>gb|AC169699.1| Rhesus Macaque  BAC CH250-12P18 (Children's Hospital Oakland Research
              Institute Rhesus macaque Adult Male BAC Library) complete
              sequence
          Length = 209387

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 61     tcatcattcagtattcagatacca 84
              |||| |||||||||||||||||||
Sbjct: 182008 tcattattcagtattcagatacca 181985



to top

>gb|AC124110.8| Mus musculus chromosome 1, clone RP24-343C13, complete sequence
          Length = 149487

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 309  caggatccacatcagggaag 328
            ||||||||||||||||||||
Sbjct: 5134 caggatccacatcagggaag 5153



to top

>gb|AC131592.10| Mus musculus chromosome 1, clone RP24-547I3, complete sequence
          Length = 154667

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 309   caggatccacatcagggaag 328
             ||||||||||||||||||||
Sbjct: 29290 caggatccacatcagggaag 29271



to top

>gb|AC103406.7| Mus musculus chromosome 9, clone RP23-106O8, complete sequence
          Length = 174604

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 112    ttcagcaatggtgctaggcc 131
              ||||||||||||||||||||
Sbjct: 108857 ttcagcaatggtgctaggcc 108838



to top

>gb|AC131695.4| Mus musculus BAC clone RP23-396F8 from chromosome 6, complete sequence
          Length = 199679

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 242    gttcttttttgggaaaatggtgaa 265
              |||||||||||||||| |||||||
Sbjct: 195280 gttcttttttgggaaactggtgaa 195303



to top

>gb|DQ188032.1| Rattus norvegicus salt-inducible kinase 2 (Snf1lk2) mRNA, complete
            cds
          Length = 7000

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 112  ttcagcaatggtgctaggcc 131
            ||||||||||||||||||||
Sbjct: 1131 ttcagcaatggtgctaggcc 1112



to top

>gb|AC127322.4| Mus musculus BAC clone RP23-238A8 from chromosome 6, complete sequence
          Length = 179698

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 242    gttcttttttgggaaaatggtgaa 265
              |||||||||||||||| |||||||
Sbjct: 157178 gttcttttttgggaaactggtgaa 157155



to top

>emb|AL606468.8| Human DNA sequence from clone RP11-15I11 on chromosome 1 Contains the 3'
              end of the RAMP gene for RA-regulated nuclear
              matrix-associated protein, a novel gene and the 3' end of a
              novel gene, complete sequence
          Length = 160200

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 377    gactcatctggaaagtggca 396
              ||||||||||||||||||||
Sbjct: 141754 gactcatctggaaagtggca 141735



to top

>emb|AL353148.8| Human DNA sequence from clone RP11-298H24 on chromosome 10 Contains a
              novel gene, complete sequence
          Length = 181308

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 214    tgaatctctcaagtctttgc 233
              ||||||||||||||||||||
Sbjct: 117666 tgaatctctcaagtctttgc 117685



to top

>emb|AL049695.20|HSJ236J16 Human DNA sequence from clone RP1-236J16 on chromosome 6q21-22.1
             Contains a cytokine inducible SH2-containing protein 6
             (CISH6) pseudogene, complete sequence
          Length = 106348

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 245   cttttttgggaaaatggtga 264
             ||||||||||||||||||||
Sbjct: 77144 cttttttgggaaaatggtga 77125



to top

>gb|AC163089.3| Mus musculus chromosome 5, clone RP23-346P15, complete sequence
          Length = 197826

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     tgcgtttggattcaccctga 27
             ||||||||||||||||||||
Sbjct: 30116 tgcgtttggattcaccctga 30097



to top

>gb|AC067964.18| Mus Musculus Strain C57BL6/J Chromosome 5 RP23-337K7, complete sequence
          Length = 219769

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      tgcgtttggattcaccctga 27
              ||||||||||||||||||||
Sbjct: 173809 tgcgtttggattcaccctga 173790



to top

>gb|AC022140.6| Homo sapiens chromosome 5 clone CTD-2306M5, complete sequence
          Length = 93133

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   tctgaatctctcaagtcttt 231
             ||||||||||||||||||||
Sbjct: 73186 tctgaatctctcaagtcttt 73167



to top

>gb|AF307062.1|AF307062 Digitalis purpurea E2 Adh gene, partial cds
          Length = 350

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 267 gcaattcagggaagacaaac 286
           ||||||||||||||||||||
Sbjct: 75  gcaattcagggaagacaaac 94



to top

>gb|AF307061.1|AF307061 Digitalis purpurea E1 Adh gene, partial cds
          Length = 350

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 267 gcaattcagggaagacaaac 286
           ||||||||||||||||||||
Sbjct: 75  gcaattcagggaagacaaac 94



to top

>gb|AC010347.4| Homo sapiens chromosome 5 clone CTD-2018C9, complete sequence
          Length = 146638

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 212    tctgaatctctcaagtcttt 231
              ||||||||||||||||||||
Sbjct: 146529 tctgaatctctcaagtcttt 146548



to top

>dbj|AK090386.1| Mus musculus 11 days embryo spinal cord cDNA, RIKEN full-length
            enriched library, clone:G630080D20 product:weakly similar
            to PROBABLE SERINE/THREONINE PROTEIN KINASE SNF1LK (EC
            2.7.1.-) (SALT- INDUCIBLE PROTEIN KINASE) (PROTEIN KINASE
            KID2) [Rattus norvegicus], full insert sequence
          Length = 3567

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 112  ttcagcaatggtgctaggcc 131
            ||||||||||||||||||||
Sbjct: 1185 ttcagcaatggtgctaggcc 1166



to top

>gb|AC104697.2| Homo sapiens BAC clone RP11-454B3 from 2, complete sequence
          Length = 159797

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 66     attcagtattcagataccatccat 89
              |||||||||||||||| |||||||
Sbjct: 139082 attcagtattcagataacatccat 139059



to top

>gb|AC010546.10| Homo sapiens chromosome 16 clone RP11-50O21, complete sequence
          Length = 181955

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 206    cccccttctgaatctctcaagtct 229
              ||||||||||| ||||||||||||
Sbjct: 127905 cccccttctgagtctctcaagtct 127882



to top

>ref|XM_236228.3| PREDICTED: Rattus norvegicus similar to salt inducible kinase 2
            (LOC315649), mRNA
          Length = 3306

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 112  ttcagcaatggtgctaggcc 131
            ||||||||||||||||||||
Sbjct: 1824 ttcagcaatggtgctaggcc 1805



to top

>gb|AC160568.2| Pan troglodytes BAC clone CH251-293A11 from chromosome unknown,
             complete sequence
          Length = 159393

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 206   cccccttctgaatctctcaagtct 229
             ||||||||||| ||||||||||||
Sbjct: 72936 cccccttctgagtctctcaagtct 72913



to top

>dbj|AB067780.1| Mus musculus SIK2 mRNA for salt inducible kinase 2, complete cds
          Length = 2986

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 112  ttcagcaatggtgctaggcc 131
            ||||||||||||||||||||
Sbjct: 1185 ttcagcaatggtgctaggcc 1166



to top

>gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete genome
          Length = 1664970

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     atccataagctccatcagtt 103
              ||||||||||||||||||||
Sbjct: 511159 atccataagctccatcagtt 511140



to top

>emb|AL772213.7| Mouse DNA sequence from clone RP23-104G16 on chromosome 2, complete
             sequence
          Length = 218975

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    cagtttctagtgtttcagca 118
             ||||||||||||||||||||
Sbjct: 66550 cagtttctagtgtttcagca 66569


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,118,938
Number of Sequences: 3902068
Number of extensions: 4118938
Number of successful extensions: 79647
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79562
Number of HSP's gapped (non-prelim): 82
length of query: 429
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 407
effective length of database: 17,147,199,772
effective search space: 6978910307204
effective search space used: 6978910307204
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top