>emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on chromosome 6 Contains the
NEU1 gene for sialidase 1 (lysosomal sialidase), the
C6orf29 gene for chromosome 6 open reading frame 29, the
BAT8 gene for HLA-B associated transcript 8, a novel
transcript DAQB-331I12.5, the ZBTB12 gene (previously
C6orf46) for zinc finger and BTB domain containing 12, the
C2 gene for complement component 2, the Bf gene for
B-factor, properdin, the RDBP gene for RD RNA binding
protein, the SKIV2L gene for superkiller viralicidic
activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3
homolog Z (C. elegans), the STK19 gene for
serine/threonine kinase 19, the 5' end of the C4A gene for
complement component 4A and 8 CpG isalnds, complete
sequence
Length = 153464
Score = 42.1 bits (21), Expect = 1.7
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 72 ggaagatgagcatcagcagca 92
|||||||||||||||||||||
Sbjct: 24775 ggaagatgagcatcagcagca 24795
>emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on chromosome 6 contains the
5' end of the VARS2 gene for valyl-tRNA synthetase 2, the
gene for chromosome 6 open reading frame 28, the HSPA1L
gene for heat shock 70kDa protein 1-like, the HSPA1A gene
for heat shock 70kDa protein 1A, the HSPA1B gene for heat
shock 70kDa protein 1B, the gene for chromosome 6 open
reading frame 48, the NEU1 gene for sialidase 1 (lysosomal
sialidase), the gene forchromosome 6 open reading frame
29, the gene for HLA-B associated transcript 8, the gene
for chromosome 6 open reading frame 46 and eight CpG
islands, complete sequence
Length = 113582
Score = 42.1 bits (21), Expect = 1.7
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 72 ggaagatgagcatcagcagca 92
|||||||||||||||||||||
Sbjct: 78500 ggaagatgagcatcagcagca 78520
>emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chromosome 6 contains the
MSH5 gene for mutS homolog 5 (e. coli), the gene for NG23
protein, the gene for chromosome 6 open reading frame 27,
the VARS2 gene for valyl-tRNA synthetase 2, the gene for
chromosome 6 open reading frame 28, the HSPA1L gene for
heat shock 70kDa protein 1-like, the HSPA1A gene for heat
shock 70kDa protein 1A, the HSPA1B gene for heat shock
70kDa protein 1B, the gene for chromosome 6 open reading
frame 48, the NEU1 gene for sialidase 1 (lysosomal
sialidase), the gene for chromosome 6 open reading frame
29, the BAT8 gene for HLA-B associated transcript 8, the
gene for chromosome 6 open reading frame 46 and nine CpG
islands, complete sequence
Length = 179894
Score = 42.1 bits (21), Expect = 1.7
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 72 ggaagatgagcatcagcagca 92
|||||||||||||||||||||
Sbjct: 134711 ggaagatgagcatcagcagca 134731
>emb|AL138795.21| Human DNA sequence from clone RP4-790G17 on chromosome 1q21.1-21.3
Contains the ANP32E gene for acidic (leucine-rich) nuclear
phosphoprotein 32 family, member E, the CA14 gene for
carbonic anhydrase XIV, the gene for a likely ortholog of
C. elegans anterior pharynx defective 1A (APH-1A), the gene
for a novel protein (FLJ23221), a novel gene and the MRPS21
gene for mitochondrial ribosomal protein S21, complete
sequence
Length = 132823
Score = 40.1 bits (20), Expect = 6.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 73 gaagatgagcatcagcagca 92
||||||||||||||||||||
Sbjct: 101147 gaagatgagcatcagcagca 101128
>gb|AC145948.5| Gallus gallus BAC clone CH261-24O17 from chromosome unknown, complete
sequence
Length = 242530
Score = 40.1 bits (20), Expect = 6.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 86 agcagcacgggcagaggagc 105
||||||||||||||||||||
Sbjct: 79076 agcagcacgggcagaggagc 79057
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,578,510
Number of Sequences: 3902068
Number of extensions: 3578510
Number of successful extensions: 73619
Number of sequences better than 10.0: 34
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 73562
Number of HSP's gapped (non-prelim): 54
length of query: 492
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 470
effective length of database: 17,147,199,772
effective search space: 8059183892840
effective search space used: 8059183892840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)