ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl02c01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK101405.1| Oryza sativa (japonica cultivar-group) cDNA clon... 412 e-112
2dbj|AK101166.1| Oryza sativa (japonica cultivar-group) cDNA clon... 412 e-112
3ref|XM_471058.1| Oryza sativa (japonica cultivar-group), predic... 406 e-110
4ref|XM_465992.1| Oryza sativa (japonica cultivar-group), mRNA 375 e-100
5dbj|AK100313.1| Oryza sativa (japonica cultivar-group) cDNA clon... 375 e-100
6gb|AY103807.1| Zea mays PCO130571 mRNA sequence 367 2e-98
7dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 333 3e-88
8emb|AL606450.3|OSJN00001 Oryza sativa genomic DNA, chromosome 4,... 333 3e-88
9dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 319 5e-84
10dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic D... 319 5e-84
11ref|NM_191153.1| Oryza sativa (japonica cultivar-group), predic... 266 6e-68
12dbj|AK063421.1| Oryza sativa (japonica cultivar-group) cDNA clon... 266 6e-68
13dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 212 8e-52
14dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic D... 212 8e-52
15ref|NM_179487.1| Arabidopsis thaliana LOS1; GTP binding / transl... 123 6e-25
16gb|BT000722.1| Arabidopsis thaliana clone RAFL07-10-D07 (R10647)... 123 6e-25
17gb|BT000661.1| Arabidopsis thaliana clone RAFL08-12-J19 (R11046)... 123 6e-25
18gb|AF367331.1| Arabidopsis thaliana At1g56070/T6H22_13 mRNA, com... 123 6e-25
19gb|AY054461.1| Arabidopsis thaliana elongation factor EF-2 (At1g... 123 6e-25
20gb|BT002714.1| Arabidopsis thaliana At1g56070/T6H22_13 gene, com... 123 6e-25
21gb|BT012802.1| Lycopersicon esculentum clone 113818R, mRNA sequence 121 2e-24
22emb|Z97178.1|BVRNAEF2 Beta vulgaris cDNA for elongation factor 2 121 2e-24
23dbj|AB026645.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 111 2e-21
24gb|AC009894.2| Arabidopsis thaliana chromosome I BAC T6H22 genom... 92 2e-15
25gb|AC084640.1|CBRG45J08 Caenorhabditis briggsae cosmid G45J08, c... 92 2e-15
26gb|AY305522.1| Skogsbergia lerneri voucher Skle elongation facto... 80 8e-12
27gb|AY305512.1| Neogonodactylus oerstedii voucher Neo elongation ... 76 1e-10
28gb|AY305494.1| Ctenolepisma lineata voucher Cli elongation facto... 76 1e-10
29ref|XM_389750.1| Gibberella zeae PH-1 chromosome 4 EF2_NEUCR Elo... 74 5e-10
30ref|XM_691847.1| PREDICTED: Danio rerio similar to eukaryotic tr... 74 5e-10
31gb|AY010232.1| Bonnemaisonia hamifera elongation factor 2 (EF2) ... 74 5e-10
32emb|BX293565.25| Zebrafish DNA sequence from clone DKEY-268M13 i... 74 5e-10
33gb|AY078407.1| Spodoptera exigua translation elongation factor 2... 70 8e-09
34emb|CR719790.2|CNS0GIC4 Tetraodon nigroviridis full-length cDNA 70 8e-09
35emb|CR701440.1|CNS0G46K Tetraodon nigroviridis full-length cDNA 70 8e-09
36emb|CR694358.2|CNS0FYPU Tetraodon nigroviridis full-length cDNA 70 8e-09
37emb|CR694270.2|CNS0FYNE Tetraodon nigroviridis full-length cDNA 70 8e-09
38emb|CR656569.2|CNS0F5KV Tetraodon nigroviridis full-length cDNA 70 8e-09
39emb|CR651666.2|CNS0F1SO Tetraodon nigroviridis full-length cDNA 70 8e-09
40emb|CR651194.2|CNS0F1FK Tetraodon nigroviridis full-length cDNA 70 8e-09
41emb|CR649058.2|CNS0EZS8 Tetraodon nigroviridis full-length cDNA 70 8e-09
42emb|CR647101.2|CNS0EY9V Tetraodon nigroviridis full-length cDNA 70 8e-09
43emb|CR646461.2|CNS0EXS3 Tetraodon nigroviridis full-length cDNA 70 8e-09
44emb|CR644860.2|CNS0EWJM Tetraodon nigroviridis full-length cDNA 70 8e-09
45emb|CR644476.2|CNS0EW8Y Tetraodon nigroviridis full-length cDNA 70 8e-09
46emb|CR641154.2|CNS0ETOO Tetraodon nigroviridis full-length cDNA 70 8e-09
47emb|CR638920.2|CNS0ERYM Tetraodon nigroviridis full-length cDNA 70 8e-09
48gb|M68064.1|CHLEF2 Chlorella kessleri elongation factor 2 mRNA, ... 70 8e-09
49dbj|D21259.1|ENHEF2A E. histolytica elongation factor 2 gene, pa... 70 8e-09
50gb|AF240824.1| Nipponopsalis abei elongation factor-2 mRNA, part... 68 3e-08
51gb|AY310270.1| Nemasoma varicorne voucher Nva elongation factor ... 66 1e-07
52gb|AY310264.1| Ophyiulus pilosus voucher Jul elongation factor 2... 66 1e-07
53gb|AY310257.1| Glomeris marginata voucher Gma2 elongation factor... 66 1e-07
54gb|AY310252.1| Cylindroiulus punctatus voucher Cpu elongation fa... 66 1e-07
55ref|XM_792306.1| PREDICTED: Strongylocentrotus purpuratus simila... 66 1e-07
56ref|XM_692265.1| PREDICTED: Danio rerio similar to eukaryotic tr... 66 1e-07
57gb|DQ295234.1| Spironucleus barkhanus translation elongation fac... 66 1e-07
58emb|BX005203.7| Zebrafish DNA sequence from clone DKEY-110C1 in ... 66 1e-07
59ref|XM_645436.1| Entamoeba histolytica HM-1:IMSS elongation fact... 64 5e-07
60ref|XM_645917.1| Entamoeba histolytica HM-1:IMSS elongation fact... 64 5e-07
61gb|AY305531.1| Ooperipatellus nanus voucher Ona elongation facto... 64 5e-07
62gb|AY305525.1| Trachyiulus nordquisti voucher Tnor elongation fa... 64 5e-07
63gb|AY310280.1| Platydesmus sp. 'Pla' elongation factor 2 mRNA, p... 64 5e-07
64emb|AL122032.1|SPAC513 S.pombe chromosome I cosmid c513 64 5e-07
65emb|AL121859.1|SPCP31B10 S.pombe chromosome III p1 p31B10 64 5e-07
66ref|NM_001022856.1| Schizosaccharomyces pombe 972h- hypothetical... 64 5e-07
67ref|NM_001019401.1| Schizosaccharomyces pombe 972h- elongation f... 64 5e-07
68gb|L02417.1|ENHEF2 Entamoeba histolytica translation elongation ... 64 5e-07
69dbj|D83976.1| Schizosaccharomyces pombe DNA for elongation facto... 64 5e-07
70dbj|D83975.1| Schizosaccharomyces pombe DNA for elongation facto... 64 5e-07
71emb|CR645858.2|CNS0EXBC Tetraodon nigroviridis full-length cDNA 62 2e-06
72gb|AY305526.1| Streptocephalus seali voucher ufs elongation fact... 62 2e-06
73gb|AY305487.1| Acanthocyclops vernalis voucher A369 elongation f... 62 2e-06
74ref|NM_205368.1| Gallus gallus eukaryotic translation elongation... 62 2e-06
75gb|AY064104.1| Aedes aegypti clone EF2Mc2 elongation factor 2 (E... 62 2e-06
76gb|AY064103.1| Aedes aegypti clone EF2Rc2 elongation factor 2 (E... 62 2e-06
77gb|AY040342.1| Aedes aegypti elongation factor 2 (Ef-2) mRNA, co... 62 2e-06
78gb|AF331798.1|AF331798 Aedes aegypti elongation factor 2 (Ef-2) ... 62 2e-06
79gb|U46663.1|GGU46663 Gallus gallus elongation factor 2 mRNA, com... 62 2e-06
80emb|Z81068.1|CEF25H5 Caenorhabditis elegans Cosmid F25H5, comple... 60 7e-06
81gb|AY305488.1| Abacion magnum voucher Ama2 elongation factor-2 m... 60 7e-06
82gb|AF240823.1| Mastigoproctus giganteus elongation factor-2 mRNA... 60 7e-06
83ref|NM_060056.3| Caenorhabditis elegans Elongation FacTor family... 60 7e-06
84ref|XM_662910.1| Cryptosporidium hominis TU502 elongation factor... 58 3e-05
85gb|AY305517.1| Periplaneta americana voucher Pam elongation fact... 58 3e-05
86gb|AY305509.1| Lynceus sp. JCR-2003 elongation factor-2 mRNA, pa... 58 3e-05
87gb|AF240835.1| Peripatus sp. 'Per2' elongation factor-2 mRNA, pa... 58 3e-05
88ref|XM_627193.1| Cryptosporidium parvum Iowa II Eft2p GTpase; tr... 58 3e-05
89gb|U21667.1|CPU21667 Cryptosporidium parvum elongation factor-2 ... 58 3e-05
90gb|AY391422.1| Danio rerio eukaryotic translation elongation fac... 56 1e-04
91gb|AY737540.1| Toxoptera citricida putative translation elongati... 56 1e-04
92gb|BC045488.1| Danio rerio eukaryotic translation elongation fac... 56 1e-04
93gb|AC159225.4| Mus musculus chromosome 1, clone RP24-306F17, com... 56 1e-04
94ref|XR_002852.1| PREDICTED: Mus musculus similar to Elongation f... 56 1e-04
95ref|XR_003342.1| PREDICTED: Mus musculus similar to Elongation f... 56 1e-04
96gb|AC102568.8| Mus musculus chromosome 1, clone RP23-224O10, com... 56 1e-04
97gb|AY310292.1| Striaria columbiana voucher Str2 elongation facto... 56 1e-04
98gb|AY310268.1| Plesioproctus comans voucher Lop elongation facto... 56 1e-04
99ref|XM_970542.1| PREDICTED: Tribolium castaneum similar to Elong... 56 1e-04
100gb|AF240821.1| Limulus polyphemus elongation factor-2 mRNA, part... 56 1e-04
101gb|BC063965.1| Danio rerio eukaryotic translation elongation fac... 56 1e-04
102gb|BC103385.1| Bos taurus cDNA clone MGC:127305 IMAGE:7949634, c... 56 1e-04
103ref|XM_392691.2| PREDICTED: Apis mellifera similar to translatio... 56 1e-04
104ref|NM_200458.2| Danio rerio eukaryotic translation elongation f... 56 1e-04
105gb|AY144923.1| Saccharomyces castellii clone Contig2043 EFT gene... 56 1e-04
106emb|AL713978.9| Mouse DNA sequence from clone RP23-159H8 on chro... 56 1e-04
107gb|BT021869.1| Bos taurus N-acetylglucosamine-1-phosphotransfera... 56 1e-04
108gb|M86959.1|CELEFT2A Caenorhabditis elegans elongation factor (e... 56 1e-04
109ref|XM_529984.1| PREDICTED: Pan troglodytes LOC455595 (LOC455595... 54 5e-04
110gb|AY618058.1| Sterkiella histriomuscorum clone UGC1O0003_B13_R ... 54 5e-04
111gb|AY618055.1| Sterkiella histriomuscorum clone UGC1O0002_P11_R ... 54 5e-04
112gb|AY618036.1| Sterkiella histriomuscorum clone UGC1O0002_H14_R ... 54 5e-04
113gb|AY617227.1| Sterkiella histriomuscorum clone UGC1O0001_F19_R ... 54 5e-04
114ref|XM_750593.1| Aspergillus fumigatus Af293 translation elongat... 54 5e-04
115gb|AY305532.1| Richtersius coronifer voucher Rco elongation fact... 54 5e-04
116gb|AY305524.1| Triops longicaudatus voucher Tlo elongation facto... 54 5e-04
117gb|AY305506.1| Libinia emarginata voucher Lem elongation factor-... 54 5e-04
118gb|AY305496.1| Carcinoscorpius rotundicauda voucher Cro elongati... 54 5e-04
119gb|AY310291.1| Stemmiulus insulanus voucher Stem elongation fact... 54 5e-04
120gb|AF213662.1|AF213662 Gelidium canariensis elongation factor 2 ... 54 5e-04
121gb|AC150552.1| Drosophila melanogaster clone BACR12I17, complete... 52 0.002
122gb|AC146817.10| Medicago truncatula clone mth2-8c19, complete se... 52 0.002
123gb|AY305489.1| Anopsobius neozelandicus voucher Ane elongation f... 52 0.002
124gb|AY310285.1| Scutigera coleoptrata voucher Scol elongation fac... 52 0.002
125gb|AY310283.1| Rhysida nuda voucher Rnu elongation factor 2 mRNA... 52 0.002
126gb|AY310265.1| Phryssonotus sp. 'jump' elongation factor 2 mRNA,... 52 0.002
127emb|X15805.1|DMEF2 Drosophila DMEF2 gene for the translation elo... 52 0.002
128gb|AF240831.1| Tanystylum orbiculare elongation factor-2 mRNA, p... 52 0.002
129gb|AF240820.1| Hutchinsoniella macracantha elongation factor-2 m... 52 0.002
130ref|NM_165395.1| Drosophila melanogaster Elongation factor 2b CG... 52 0.002
131ref|NM_165394.1| Drosophila melanogaster Elongation factor 2b CG... 52 0.002
132ref|NM_080366.2| Drosophila melanogaster Elongation factor 2b CG... 52 0.002
133gb|AY075481.1| Drosophila melanogaster RE38659 full length cDNA 52 0.002
134gb|AC009254.8| Drosophila melanogaster, chromosome 2L, region 40... 52 0.002
135gb|AF107289.1|AF107289 Candida tropicalis elongation factor 2 (E... 52 0.002
136gb|AE003781.5| Drosophila melanogaster chromosome 2L, section 80... 52 0.002
137gb|AY613900.1| Mesenchytraeus solifugus clone A195 translation e... 50 0.007
138gb|AF534908.2| Tetrahymena thermophila elongation factor 2 gene,... 50 0.007
139gb|BC070807.1| Xenopus laevis hypothetical protein MGC83880, mRN... 50 0.007
140gb|AY219033.1| Pichia pastoris elongation factor 2 (EF-2) gene, ... 50 0.007
141gb|U28373.1|YSCD9481 Saccharomyces cerevisiae chromosome IV cosm... 50 0.007
142gb|AY305515.1| Orchesella imitari voucher OimA elongation factor... 50 0.007
143gb|AY305513.1| Nebalia hessleri voucher Nhe elongation factor-2 ... 50 0.007
144gb|AY310278.1| Polyzonium germanicum voucher Pge elongation fact... 50 0.007
145gb|AY310269.1| Narceus americanus voucher Nam elongation factor ... 50 0.007
146emb|X94335.1|SC130KBXV S.cerevisiae 130kb DNA fragment from chro... 50 0.007
147emb|X90518.1|SCXVORFS S.cerevisiae DNA of 51 Kb from chromosome ... 50 0.007
148gb|AF240830.1| Tomocerus sp. 'Tom' elongation factor-2 mRNA, par... 50 0.007
149gb|AF240816.1| Armadillidium vulgare elongation factor-2 mRNA, p... 50 0.007
150gb|AY144817.1| Saccharomyces bayanus EFT2 gene, partial cds 50 0.007
151gb|AF107290.1|AF107290 Candida lusitaniae elongation factor 2 (E... 50 0.007
152gb|AF213663.1|AF213663 Euglena gracilis elongation factor 2 (EF2... 50 0.007
153dbj|AK110168.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
154emb|Z75041.1|SCYOR133W S.cerevisiae chromosome XV reading frame ... 50 0.007
155gb|DQ332255.1| Synthetic construct Saccharomyces cerevisiae clon... 50 0.007
156gb|U32274.1|SCD9509 Saccharomyces cerevisiae chromosome IV cosmi... 50 0.007
157gb|M59370.1|YSCEFT2 S.cerevisiae translation elongation factor 2... 50 0.007
158gb|M59369.1|YSCEFT1 S.cerevisiae translation elongation factor 2... 50 0.007
159dbj|AB082376.1| Pisum sativum mRNA for elongation factor EF-2, p... 50 0.007
160gb|BC063919.1| Xenopus tropicalis eukaryotic translation elongat... 48 0.028
161gb|BC084061.1| Xenopus tropicalis eukaryotic translation elongat... 48 0.028
162gb|AY702202.1| Loligo pealei elongation factor 2-like mRNA, part... 48 0.028
163ref|NM_001961.3| Homo sapiens eukaryotic translation elongation ... 48 0.028
164gb|BC044327.1| Xenopus laevis eukaryotic translation elongation ... 48 0.028
165ref|XM_736543.1| Plasmodium chabaudi chabaudi elongation factor ... 48 0.028
166gb|BC006547.2| Homo sapiens eukaryotic translation elongation fa... 48 0.028
167gb|AY305523.1| Thereuonema sp. JCR-2003 elongation factor-2 mRNA... 48 0.028
168gb|AY305514.1| Nicoletia meinerti voucher Nme elongation factor-... 48 0.028
169gb|AY310297.1| Pseudopolydesmus serratus voucher Xys1 elongation... 48 0.028
170gb|AY310275.1| Uroblaniulus canadensis voucher Par2 elongation f... 48 0.028
171gb|AY310273.1| Orthoporus ornata voucher Oor3 elongation factor ... 48 0.028
172emb|Z11692.1|HSEF2MR H.sapiens mRNA for elongation factor 2 48 0.028
173emb|X51466.1|HSEF2 Human mRNA for elongation factor 2 48 0.028
174ref|NM_203924.1| Xenopus tropicalis eukaryotic translation elong... 48 0.028
175gb|AF240828.1| Scolopendra polymorpha elongation factor-2 mRNA, ... 48 0.028
176gb|AF240827.1| Scutigerella sp. 'Scu2' elongation factor-2 mRNA,... 48 0.028
177emb|CR859604.1| Pongo pygmaeus mRNA; cDNA DKFZp468K065 (from clo... 48 0.028
178emb|CR858745.1| Pongo pygmaeus mRNA; cDNA DKFZp468M076 (from clo... 48 0.028
179gb|AC011488.7| Homo sapiens chromosome 19 clone CTB-171N13, comp... 48 0.028
180emb|CR318632.9| Zebrafish DNA sequence from clone CH211-113N10 i... 48 0.028
181emb|CR598660.1| full-length cDNA clone CS0DK003YK05 of HeLa cell... 48 0.028
182emb|CR596005.1| full-length cDNA clone CS0DC029YB08 of Neuroblas... 48 0.028
183ref|XM_692874.1| PREDICTED: Danio rerio wu:fj53d02 (wu:fj53d02),... 48 0.028
184gb|AY144924.1| Saccharomyces castellii clone Contig1523 EFT gene... 48 0.028
185gb|AY942181.1| Homo sapiens elongation factor 2 mRNA, complete cds 48 0.028
186emb|CR848340.2| Xenopus tropicalis finished cDNA, clone TNeu054i17 48 0.028
187gb|AC016586.9| Homo sapiens chromosome 19 clone CTD-2622I13, com... 48 0.028
188ref|XM_454080.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E02926g ... 46 0.11
189gb|BC059523.1| Danio rerio wu:fj53d02, mRNA (cDNA clone IMAGE:42... 46 0.11
190ref|XM_811751.1| Trypanosoma cruzi strain CL Brener elongation f... 46 0.11
191gb|AY305501.1| Hanseniella sp. JCR-2003 elongation factor-2 mRNA... 46 0.11
192ref|XM_499612.1| Yarrowia lipolytica CLIB122, YALI0A00352g predi... 46 0.11
193emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 46 0.11
194emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 46 0.11
195gb|AF240819.1| Endeis laevis elongation factor-2 mRNA, partial cds 46 0.11
196emb|CR558303.7| Zebrafish DNA sequence from clone CH211-183C15 i... 46 0.11
197dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 46 0.11
198ref|XM_631629.1| Dictyostelium discoideum AX4 elongation factor ... 46 0.11
199gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete... 46 0.11
200gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 46 0.11
201gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, compl... 46 0.11
202gb|AY144999.1| Saccharomyces kluyveri clone Contig1706 EFT2 gene... 46 0.11
203dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 46 0.11
204dbj|AK187829.1| Mus musculus cDNA, clone:Y0G0143C24, strand:minu... 46 0.11
205dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic... 46 0.11
206emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA2... 46 0.11
207emb|AJ938182.1| Staphylococcus aureus RF122 complete genome 46 0.11
208emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 46 0.11
209gb|M26017.1|DDIEF2 D.discoideum elongation factor 2 mRNA, comple... 46 0.11
210dbj|D79219.1|BLAPEF2 Blastocystis hominis mRNA for peptide elong... 46 0.11
211ref|XM_631959.1| Dictyostelium discoideum elongation factor 2 (D... 44 0.44
212gb|DQ443396.1| Bombyx mori translation elongation factor 2 mRNA,... 44 0.44
213gb|AY310258.1| Glomeridesmus trinidadensis voucher Gtri elongati... 44 0.44
214gb|AF240818.1| Eumesocampa frigilis elongation factor-2 mRNA, pa... 44 0.44
215gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome 44 0.44
216gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 44 0.44
217ref|NM_211043.1| Eremothecium gossypii AFR142Cp (AFR142C), mRNA 44 0.44
218gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome 44 0.44
219gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome 44 0.44
220ref|XM_481784.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.7
221gb|AY020355.1| Oryza sativa microsatellite MRG2680 containing (G... 42 1.7
222gb|AY017820.1| Oryza sativa microsatellite MRG0145 containing (A... 42 1.7
223ref|XM_570549.1| Cryptococcus neoformans var. neoformans JEC21 t... 42 1.7
224ref|XM_720710.1| Plasmodium yoelii yoelii str. 17XNL elongation ... 42 1.7
225gb|AC123541.3| Oryctolagus cuniculus clone LB1-184A7, complete s... 42 1.7
226emb|CR656790.2|CNS0F5R0 Tetraodon nigroviridis full-length cDNA 42 1.7
227ref|XM_673005.1| Plasmodium berghei strain ANKA elongation facto... 42 1.7
228emb|CR655050.1|CNS0F4EO Tetraodon nigroviridis full-length cDNA 42 1.7
229gb|AY305492.1| Bothropolys multidentatus voucher Bmu elongation ... 42 1.7
230ref|XM_500274.1| Yarrowia lipolytica CLIB122, YALI0A20152g predi... 42 1.7
231emb|X71439.1|GMFUSA G.max gene fusA 42 1.7
232gb|AF240834.1| Nereis virens elongation factor-2 mRNA, partial cds 42 1.7
233gb|AF240829.1| Speleonectes tulumensis elongation factor-2 mRNA,... 42 1.7
234emb|AL590605.1|SPAPB1E7 S.pombe chromosome I BAC pB1E7 42 1.7
235emb|AL109734.1|SPAPYUK71 S.pombe chromosome I plasmid pYUK71 42 1.7
236gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete ... 42 1.7
237gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold 42 1.7
238dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticu... 42 1.7
239ref|NM_001019557.1| Schizosaccharomyces pombe 972h- hypothetical... 42 1.7
240dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
241gb|AF248644.1|AF248644 Filobasidiella neoformans var. neoformans... 42 1.7
242gb|AY010233.1| Botryocladia uvarioides elongation factor 2 (EF2)... 42 1.7
243gb|AF269681.1|AF269681 Staphylococcus epidermidis strain SR1 clo... 42 1.7
244gb|AF213661.1|AF213661 Chondrus crispus elongation factor 2 (EF2... 42 1.7
245dbj|AK183389.1| Mus musculus cDNA, clone:Y0G0125L11, strand:plus... 42 1.7
246dbj|AP006844.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
247dbj|AP005476.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
248gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome 42 1.7
249dbj|AP004645.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.7
250dbj|AK102586.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
251dbj|AK100312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
252dbj|AK073592.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
253dbj|AK067775.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
254dbj|AK065296.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.7
255gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome 42 1.7
256gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete g... 42 1.7
257emb|BX928742.15| Zebrafish DNA sequence from clone CH211-261F3 i... 42 1.7
258dbj|D78481.1| Trichomonas tenax gene for elongation factor 2, pa... 42 1.7
259gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 6.9
260gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome 40 6.9
261ref|NM_191821.1| Oryza sativa (japonica cultivar-group), predic... 40 6.9
262gb|AC135929.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
263gb|BC077595.1| Xenopus laevis translation elongation factor 2, m... 40 6.9
264gb|AC145325.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
265gb|AC146946.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9
266ref|XM_365847.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.9
267ref|XM_461796.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 6.9
268ref|XM_710236.1| Candida albicans SC5314 translation elongation ... 40 6.9
269ref|XM_710171.1| Candida albicans SC5314 translation elongation ... 40 6.9
270ref|XM_658842.1| Aspergillus nidulans FGSC A4 elongation factor ... 40 6.9
271gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118... 40 6.9
272ref|XM_444908.1| Candida glabrata CBS138 hypothetical protein (C... 40 6.9
273gb|AC121599.3| Mus musculus BAC clone RP23-300H21 from 14, compl... 40 6.9
274ref|XM_765828.1| Giardia lamblia ATCC 50803 elongation factor 2 ... 40 6.9
275gb|AY305507.1| Limnadia lenticularis voucher Lle elongation fact... 40 6.9
276gb|AY305490.1| Allopauropus proximus voucher Apr elongation fact... 40 6.9
277gb|AY310282.1| Ribautia sp. 'Rib' elongation factor 2 mRNA, part... 40 6.9
278gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl... 40 6.9
279gb|AE014824.1| Plasmodium falciparum 3D7 chromosome 14 section 9... 40 6.9
280emb|Y09664.1|CAEFT2 C.albicans EFT2 gene 40 6.9
281emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS... 40 6.9
282emb|CR380947.1| Candida glabrata strain CBS138 chromosome A comp... 40 6.9
283emb|AL161551.2|ATCHRIV51 Arabidopsis thaliana DNA chromosome 4, ... 40 6.9
284emb|AL021768.1|ATF24J7 Arabidopsis thaliana DNA chromosome 4, BA... 40 6.9
285dbj|AB226013.1| Aspergillus oryzae cDNA, contig sequence: AoEST2869 40 6.9
286gb|AC154268.2| Mus musculus BAC clone RP24-235B13 from chromosom... 40 6.9
287gb|AC090056.2|AC090056 Oryza sativa chromosome 9 clone PAC0663H0... 40 6.9
288dbj|AK054406.1| Mus musculus 2 days pregnant adult female ovary ... 40 6.9
289dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
290dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
291dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
292gb|AC154840.2| Mus musculus BAC clone RP23-61I7 from chromosome ... 40 6.9
293dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 6.9
294dbj|AP003229.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
295dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
296gb|AE004511.1| Pseudomonas aeruginosa PAO1, section 72 of 529 of... 40 6.9
297gb|AF107287.1|AF107287 Candida glabrata elongation factor 2 (EFT... 40 6.9
298gb|AF107286.1|AF107286 Candida albicans elongation factor 2 (EFT... 40 6.9
299dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete ge... 40 6.9
300dbj|AP006758.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
301dbj|AP005720.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.9
302dbj|AK120833.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.9
303dbj|AK073380.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.9
304gb|CP000020.1| Vibrio fischeri ES114 chromosome I, complete sequ... 40 6.9
305gb|AE017321.1| Wolbachia endosymbiont strain TRS of Brugia malay... 40 6.9
306gb|AF022779.1|AF022779 Methanococcoides methylutens ribosomal pr... 40 6.9
307gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 40 6.9
308gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.9

>dbj|AK101405.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037G17, full
           insert sequence
          Length = 3104

 Score =  412 bits (208), Expect = e-112
 Identities = 349/396 (88%)
 Strand = Plus / Plus

                                                                       
Query: 111 gtgatattcaaaggcagtcacgatggtgaagtttactgcagaggagctccgtggaattat 170
           ||||| ||||||||| | || |||||||||||| || |  || ||||| ||  | |||||
Sbjct: 294 gtgatcttcaaaggctgccaagatggtgaagttcacggttgaagagctgcgcaggattat 353

                                                                       
Query: 171 ggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           |||||| ||||| || || |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 354 ggacaagaagaataacattcgtaacatgtctgtcattgctcatgtcgaccatggcaagtc 413

                                                                       
Query: 231 tacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagctggtga 290
            |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 414 cacgcttacagattcccttgtggcagctgctgggattattgcccaggaagttgctggtga 473

                                                                       
Query: 291 tgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaatccac 350
           |||||||||||||||||| |||||||| || || || ||||||||||||||||| |||||
Sbjct: 474 tgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatcaagtccac 533

                                                                       
Query: 351 gggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaagggcgacag 410
            |||||||||||||||||  |||||| |  |||||||||| || | ||||||||||| ||
Sbjct: 534 tggcatctctcttttctacgagatgagtgatgaatcactcaagttatacaagggcgagag 593

                                                                       
Query: 411 ggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttctcttc 470
            || ||  |||||||||||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 594 agacggaaatgagtacctgatcaaccttattgattcacctgggcacgttgatttttcttc 653

                                               
Query: 471 ggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||| ||||| |||||||||||||| |||||||||||
Sbjct: 654 ggaggtcactgctgctcttcgtattactgatggtgc 689



to top

>dbj|AK101166.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028E07, full
           insert sequence
          Length = 3081

 Score =  412 bits (208), Expect = e-112
 Identities = 349/396 (88%)
 Strand = Plus / Plus

                                                                       
Query: 111 gtgatattcaaaggcagtcacgatggtgaagtttactgcagaggagctccgtggaattat 170
           ||||| ||||||||| | || |||||||||||| || |  || ||||| ||  | |||||
Sbjct: 294 gtgatcttcaaaggctgccaagatggtgaagttcacggttgaagagctgcgcaggattat 353

                                                                       
Query: 171 ggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           |||||| ||||| || || |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 354 ggacaagaagaataacattcgtaacatgtctgtcattgctcatgtcgaccatggcaagtc 413

                                                                       
Query: 231 tacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagctggtga 290
            |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 414 cacgcttacagattcccttgtggcagctgctgggattattgcccaggaagttgctggtga 473

                                                                       
Query: 291 tgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaatccac 350
           |||||||||||||||||| |||||||| || || || ||||||||||||||||| |||||
Sbjct: 474 tgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatcaagtccac 533

                                                                       
Query: 351 gggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaagggcgacag 410
            |||||||||||||||||  |||||| |  |||||||||| || | ||||||||||| ||
Sbjct: 534 tggcatctctcttttctacgagatgagtgatgaatcactcaagttatacaagggcgagag 593

                                                                       
Query: 411 ggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttctcttc 470
            || ||  |||||||||||||||||||||||||||||||||| |||||||| || |||||
Sbjct: 594 agacggaaatgagtacctgatcaaccttattgattcacctgggcacgttgatttttcttc 653

                                               
Query: 471 ggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||| ||||| |||||||||||||| |||||||||||
Sbjct: 654 ggaggtcactgctgctcttcgtattactgatggtgc 689



to top

>ref|XM_471058.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2532

 Score =  406 bits (205), Expect = e-110
 Identities = 307/341 (90%)
 Strand = Plus / Plus

                                                                       
Query: 166 attatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggc 225
           ||||||||||| ||||| || || |||||||||||||| |||||||||||||||||||||
Sbjct: 34  attatggacaagaagaataacattcgtaacatgtctgtcattgctcatgtcgaccatggc 93

                                                                       
Query: 226 aagtctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagct 285
           ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 94  aagtccacgcttacagattcccttgtggcagctgctgggattattgcccaggaagttgct 153

                                                                       
Query: 286 ggtgatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaa 345
           ||||||||||||||||||||||| |||||||| || || || ||||||||||||||||| 
Sbjct: 154 ggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatcaag 213

                                                                       
Query: 346 tccacgggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaagggc 405
           ||||| |||||||||||||||||  |||||| |  |||||||||| || | |||||||||
Sbjct: 214 tccactggcatctctcttttctacgagatgagtgatgaatcactcaagttatacaagggc 273

                                                                       
Query: 406 gacagggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttc 465
           || || || ||  |||||||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 274 gagagagacggaaatgagtacctgatcaaccttattgattcacctgggcacgttgatttt 333

                                                    
Query: 466 tcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           |||||||| ||||| |||||||||||||| |||||||||||
Sbjct: 334 tcttcggaggtcactgctgctcttcgtattactgatggtgc 374



to top

>ref|XM_465992.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2924

 Score =  375 bits (189), Expect = e-100
 Identities = 333/381 (87%)
 Strand = Plus / Plus

                                                                       
Query: 126 agtcacgatggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaa 185
           ||||| |||||||||||| || | ||| ||||||||  | || |||||||| ||||| ||
Sbjct: 153 agtcaagatggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataa 212

                                                                       
Query: 186 tatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
            |||||||| ||||| || ||||||||||| ||||| || |||||||| |||||||||||
Sbjct: 213 catccgtaatatgtccgtcattgctcatgtggaccacggaaagtctacacttacggattc 272

                                                                       
Query: 246 ccttgtggcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactga 305
            |||||||| |||||||| ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 273 tcttgtggcggctgctggtattattgcccaggaagttgcgggtgatgttcgcatgactga 332

                                                                       
Query: 306 tacgcgtgcagacgaggcagaacgtggtattacaatcaaatccacgggcatctctctttt 365
           ||| |||||||| || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 333 tacccgtgcagatgaagctgagcgtggtattacaatcaaatccactggtatctctctttt 392

                                                                       
Query: 366 ctatcagatgactcctgaatcactcgagatgtacaagggcgacagggatggtgatgagta 425
           |||| |||||| |  |||||||||| || |||||||||| || || |||||  |||||||
Sbjct: 393 ctatgagatgagtgatgaatcactcaagttgtacaagggtgagagagatggaaatgagta 452

                                                                       
Query: 426 cctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           ||||||||||||||||||||||||||| |||||||| || |||||||| ||||| |||||
Sbjct: 453 cctgatcaaccttattgattcacctgggcacgttgatttttcttcggaggtcactgctgc 512

                                
Query: 486 tcttcgtatcactgatggtgc 506
           ||||||||| |||||||||||
Sbjct: 513 tcttcgtattactgatggtgc 533



to top

>dbj|AK100313.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078M04, full
           insert sequence
          Length = 2923

 Score =  375 bits (189), Expect = e-100
 Identities = 333/381 (87%)
 Strand = Plus / Plus

                                                                       
Query: 126 agtcacgatggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaa 185
           ||||| |||||||||||| || | ||| ||||||||  | || |||||||| ||||| ||
Sbjct: 152 agtcaagatggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataa 211

                                                                       
Query: 186 tatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
            |||||||| ||||| || ||||||||||| ||||| || |||||||| |||||||||||
Sbjct: 212 catccgtaatatgtccgtcattgctcatgtggaccacggaaagtctacacttacggattc 271

                                                                       
Query: 246 ccttgtggcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactga 305
            |||||||| |||||||| ||||||||||||||||| || ||||||||||||||||||||
Sbjct: 272 tcttgtggcggctgctggtattattgcccaggaagttgcgggtgatgttcgcatgactga 331

                                                                       
Query: 306 tacgcgtgcagacgaggcagaacgtggtattacaatcaaatccacgggcatctctctttt 365
           ||| |||||||| || || || ||||||||||||||||||||||| || |||||||||||
Sbjct: 332 tacccgtgcagatgaagctgagcgtggtattacaatcaaatccactggtatctctctttt 391

                                                                       
Query: 366 ctatcagatgactcctgaatcactcgagatgtacaagggcgacagggatggtgatgagta 425
           |||| |||||| |  |||||||||| || |||||||||| || || |||||  |||||||
Sbjct: 392 ctatgagatgagtgatgaatcactcaagttgtacaagggtgagagagatggaaatgagta 451

                                                                       
Query: 426 cctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           ||||||||||||||||||||||||||| |||||||| || |||||||| ||||| |||||
Sbjct: 452 cctgatcaaccttattgattcacctgggcacgttgatttttcttcggaggtcactgctgc 511

                                
Query: 486 tcttcgtatcactgatggtgc 506
           ||||||||| |||||||||||
Sbjct: 512 tcttcgtattactgatggtgc 532



to top

>gb|AY103807.1| Zea mays PCO130571 mRNA sequence
          Length = 2964

 Score =  367 bits (185), Expect = 2e-98
 Identities = 332/381 (87%)
 Strand = Plus / Plus

                                                                       
Query: 126 agtcacgatggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaa 185
           ||||| |||||||||||| || || || |||||||| |  || |||||||||||||||||
Sbjct: 143 agtcaagatggtgaagttcacagctgaagagctccgcgctatcatggacaaaaagaacaa 202

                                                                       
Query: 186 tatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
            || |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 203 cattcgtaacatgtctgtcattgctcatgtggaccatggcaagtctacgcttacagattc 262

                                                                       
Query: 246 ccttgtggcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactga 305
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 263 ccttgtggcagctgctgggattattgcccaggaagttgctggtgatgttcgcatgactga 322

                                                                       
Query: 306 tacgcgtgcagacgaggcagaacgtggtattacaatcaaatccacgggcatctctctttt 365
           ||| || ||||| || ||||| ||||| |||||||||||||| || || |||||||||| 
Sbjct: 323 tactcgggcagatgaagcagagcgtggcattacaatcaaatctactggtatctctcttta 382

                                                                       
Query: 366 ctatcagatgactcctgaatcactcgagatgtacaagggcgacagggatggtgatgagta 425
           |||| ||||||||   || |||||  |||  |||||||| || || |||||| |  | ||
Sbjct: 383 ctatgagatgactgacgagtcactgaagaactacaagggtgagagagatggtaaccaata 442

                                                                       
Query: 426 cctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           | |||||||||||||||| || ||||| |||||||| || ||||||||||||||||||||
Sbjct: 443 cttgatcaaccttattgactcgcctggacacgttgatttttcttcggaagtcacagctgc 502

                                
Query: 486 tcttcgtatcactgatggtgc 506
           |||||| ||||| ||||||||
Sbjct: 503 tcttcgcatcaccgatggtgc 523



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score =  333 bits (168), Expect = 3e-88
 Identities = 255/284 (89%)
 Strand = Plus / Plus

                                                                           
Query: 223     ggcaagtctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagta 282
               |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1083036 ggcaagtccacgcttacagattcccttgtggcagctgctgggattattgcccaggaagtt 1083095

                                                                           
Query: 283     gctggtgatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatc 342
               |||||||||||||||||||||||||| |||||||| || || || |||||||||||||||
Sbjct: 1083096 gctggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatc 1083155

                                                                           
Query: 343     aaatccacgggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaag 402
               || ||||| |||||||||||||||||  |||||| |  |||||||||| || | ||||||
Sbjct: 1083156 aagtccactggcatctctcttttctacgagatgagtgatgaatcactcaagttatacaag 1083215

                                                                           
Query: 403     ggcgacagggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgac 462
               ||||| || || ||  |||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 1083216 ggcgagagagacggaaatgagtacctgatcaaccttattgattcacctgggcacgttgat 1083275

                                                           
Query: 463     ttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
               || |||||||| ||||| |||||||||||||| |||||||||||
Sbjct: 1083276 ttttcttcggaggtcactgctgctcttcgtattactgatggtgc 1083319



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 96/114 (84%)
 Strand = Plus / Plus

                                                                           
Query: 111     gtgatattcaaaggcagtcacgatggtgaagtttactgcagaggagctccgtggaattat 170
               ||||| ||||||||| | || |||||||||||| || |  || ||||| ||  | |||||
Sbjct: 1082055 gtgatcttcaaaggctgccaagatggtgaagttcacggttgaagagctgcgcaggattat 1082114

                                                                     
Query: 171     ggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
               |||||| ||||| || || |||||||||||||| ||||||||||||||||||||
Sbjct: 1082115 ggacaagaagaataacattcgtaacatgtctgtcattgctcatgtcgaccatgg 1082168



to top

>emb|AL606450.3|OSJN00001 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0020P07,
             complete sequence
          Length = 167895

 Score =  333 bits (168), Expect = 3e-88
 Identities = 255/284 (89%)
 Strand = Plus / Plus

                                                                         
Query: 223   ggcaagtctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagta 282
             |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 25405 ggcaagtccacgcttacagattcccttgtggcagctgctgggattattgcccaggaagtt 25464

                                                                         
Query: 283   gctggtgatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatc 342
             |||||||||||||||||||||||||| |||||||| || || || |||||||||||||||
Sbjct: 25465 gctggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatc 25524

                                                                         
Query: 343   aaatccacgggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaag 402
             || ||||| |||||||||||||||||  |||||| |  |||||||||| || | ||||||
Sbjct: 25525 aagtccactggcatctctcttttctacgagatgagtgatgaatcactcaagttatacaag 25584

                                                                         
Query: 403   ggcgacagggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgac 462
             ||||| || || ||  |||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 25585 ggcgagagagacggaaatgagtacctgatcaaccttattgattcacctgggcacgttgat 25644

                                                         
Query: 463   ttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
             || |||||||| ||||| |||||||||||||| |||||||||||
Sbjct: 25645 ttttcttcggaggtcactgctgctcttcgtattactgatggtgc 25688



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 96/114 (84%)
 Strand = Plus / Plus

                                                                         
Query: 111   gtgatattcaaaggcagtcacgatggtgaagtttactgcagaggagctccgtggaattat 170
             ||||| ||||||||| | || |||||||||||| || |  || ||||| ||  | |||||
Sbjct: 24424 gtgatcttcaaaggctgccaagatggtgaagttcacggttgaagagctgcgcaggattat 24483

                                                                   
Query: 171   ggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
             |||||| ||||| || || |||||||||||||| ||||||||||||||||||||
Sbjct: 24484 ggacaagaagaataacattcgtaacatgtctgtcattgctcatgtcgaccatgg 24537



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  319 bits (161), Expect = 5e-84
 Identities = 251/281 (89%)
 Strand = Plus / Plus

                                                                            
Query: 226      aagtctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagct 285
                |||||||| ||||||||||| |||||||| |||||||| ||||||||||||||||| || 
Sbjct: 18938507 aagtctacacttacggattctcttgtggcggctgctggtattattgcccaggaagttgcg 18938566

                                                                            
Query: 286      ggtgatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaa 345
                ||||||||||||||||||||||| |||||||| || || || ||||||||||||||||||
Sbjct: 18938567 ggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatcaaa 18938626

                                                                            
Query: 346      tccacgggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaagggc 405
                ||||| || ||||||||||||||| |||||| |  |||||||||| || |||||||||| 
Sbjct: 18938627 tccactggtatctctcttttctatgagatgagtgatgaatcactcaagttgtacaagggt 18938686

                                                                            
Query: 406      gacagggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttc 465
                || || |||||  |||||||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 18938687 gagagagatggaaatgagtacctgatcaaccttattgattcacctgggcacgttgatttt 18938746

                                                         
Query: 466      tcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
                |||||||| ||||| |||||||||||||| |||||||||||
Sbjct: 18938747 tcttcggaggtcactgctgctcttcgtattactgatggtgc 18938787



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                            
Query: 126      agtcacgatggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaa 185
                ||||| |||||||||||| || | ||| ||||||||  | || |||||||| ||||| ||
Sbjct: 18937767 agtcaagatggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataa 18937826

                                                    
Query: 186      tatccgtaacatgtctgttattgctcatgtcgacca 221
                 |||||||| ||||| || ||||||||||| |||||
Sbjct: 18937827 catccgtaatatgtccgtcattgctcatgtggacca 18937862



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 42       tcctcatctcatcctccccgc 62
                |||||||||||||||||||||
Sbjct: 12092276 tcctcatctcatcctccccgc 12092296



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 26      cttctccgccgccgcttcctc 46
               |||||||||||||||||||||
Sbjct: 8754924 cttctccgccgccgcttcctc 8754904



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 26      cttctccgccgccgcttcctc 46
               |||||||||||||||||||||
Sbjct: 8754833 cttctccgccgccgcttcctc 8754813



to top

>dbj|AP005845.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0461D06
          Length = 112895

 Score =  319 bits (161), Expect = 5e-84
 Identities = 251/281 (89%)
 Strand = Plus / Plus

                                                                          
Query: 226    aagtctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagct 285
              |||||||| ||||||||||| |||||||| |||||||| ||||||||||||||||| || 
Sbjct: 102040 aagtctacacttacggattctcttgtggcggctgctggtattattgcccaggaagttgcg 102099

                                                                          
Query: 286    ggtgatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaa 345
              ||||||||||||||||||||||| |||||||| || || || ||||||||||||||||||
Sbjct: 102100 ggtgatgttcgcatgactgatacccgtgcagatgaagctgagcgtggtattacaatcaaa 102159

                                                                          
Query: 346    tccacgggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaagggc 405
              ||||| || ||||||||||||||| |||||| |  |||||||||| || |||||||||| 
Sbjct: 102160 tccactggtatctctcttttctatgagatgagtgatgaatcactcaagttgtacaagggt 102219

                                                                          
Query: 406    gacagggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttc 465
              || || |||||  |||||||||||||||||||||||||||||||||| |||||||| || 
Sbjct: 102220 gagagagatggaaatgagtacctgatcaaccttattgattcacctgggcacgttgatttt 102279

                                                       
Query: 466    tcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
              |||||||| ||||| |||||||||||||| |||||||||||
Sbjct: 102280 tcttcggaggtcactgctgctcttcgtattactgatggtgc 102320



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                          
Query: 126    agtcacgatggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaa 185
              ||||| |||||||||||| || | ||| ||||||||  | || |||||||| ||||| ||
Sbjct: 101300 agtcaagatggtgaagttcacagtagaagagctccgccggatcatggacaagaagaataa 101359

                                                  
Query: 186    tatccgtaacatgtctgttattgctcatgtcgacca 221
               |||||||| ||||| || ||||||||||| |||||
Sbjct: 101360 catccgtaatatgtccgtcattgctcatgtggacca 101395



to top

>ref|NM_191153.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2388

 Score =  266 bits (134), Expect = 6e-68
 Identities = 287/338 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 attatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggc 225
           ||||||||||| ||| | || |||||||||||||||||| | |||||||| |||||||| 
Sbjct: 34  attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggaccatgga 93

                                                                       
Query: 226 aagtctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagct 285
           || ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| || |||
Sbjct: 94  aaatctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgct 153

                                                                       
Query: 286 ggtgatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaa 345
           ||||||||||| ||||||||||  ||| |||| || |||||||||||||||||||| |||
Sbjct: 154 ggtgatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaa 213

                                                                       
Query: 346 tccacgggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaagggc 405
           || || || |||||||||| |||| |||||| |  ||| |||||| | |  |||||||| 
Sbjct: 214 tctactggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggt 273

                                                                       
Query: 406 gacagggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttc 465
           ||||| |||||  |||| ||||| |||||||| ||||| |||||||| || || || || 
Sbjct: 274 gacagagatggaaatgaatacctaatcaacctcattgactcacctggacatgtcgatttt 333

                                                 
Query: 466 tcttcggaagtcacagctgctcttcgtatcactgatgg 503
           ||||||||||||||||| || |||||||| ||||||||
Sbjct: 334 tcttcggaagtcacagccgcacttcgtataactgatgg 371



to top

>dbj|AK063421.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-115-C05, full
           insert sequence
          Length = 2856

 Score =  266 bits (134), Expect = 6e-68
 Identities = 287/338 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 attatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggc 225
           ||||||||||| ||| | || |||||||||||||||||| | |||||||| |||||||| 
Sbjct: 185 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggaccatgga 244

                                                                       
Query: 226 aagtctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagct 285
           || ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| || |||
Sbjct: 245 aaatctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgct 304

                                                                       
Query: 286 ggtgatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaa 345
           ||||||||||| ||||||||||  ||| |||| || |||||||||||||||||||| |||
Sbjct: 305 ggtgatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaa 364

                                                                       
Query: 346 tccacgggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaagggc 405
           || || || |||||||||| |||| |||||| |  ||| |||||| | |  |||||||| 
Sbjct: 365 tctactggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggt 424

                                                                       
Query: 406 gacagggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttc 465
           ||||| |||||  |||| ||||| |||||||| ||||| |||||||| || || || || 
Sbjct: 425 gacagagatggaaatgaatacctaatcaacctcattgactcacctggacatgtcgatttt 484

                                                 
Query: 466 tcttcggaagtcacagctgctcttcgtatcactgatgg 503
           ||||||||||||||||| || |||||||| ||||||||
Sbjct: 485 tcttcggaagtcacagccgcacttcgtataactgatgg 522



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  212 bits (107), Expect = 8e-52
 Identities = 233/275 (84%)
 Strand = Plus / Plus

                                                                            
Query: 229      tctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagctggt 288
                ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| || ||||||
Sbjct: 30987830 tctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgctggt 30987889

                                                                            
Query: 289      gatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaatcc 348
                |||||||| ||||||||||  ||| |||| || |||||||||||||||||||| ||||| 
Sbjct: 30987890 gatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaatct 30987949

                                                                            
Query: 349      acgggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaagggcgac 408
                || || |||||||||| |||| |||||| |  ||| |||||| | |  |||||||| |||
Sbjct: 30987950 actggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggtgac 30988009

                                                                            
Query: 409      agggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttctct 468
                || |||||  |||| ||||| |||||||| ||||| |||||||| || || || || |||
Sbjct: 30988010 agagatggaaatgaatacctaatcaacctcattgactcacctggacatgtcgatttttct 30988069

                                                   
Query: 469      tcggaagtcacagctgctcttcgtatcactgatgg 503
                |||||||||||||| || |||||||| ||||||||
Sbjct: 30988070 tcggaagtcacagccgcacttcgtataactgatgg 30988104



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                           
Query: 166      attatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
                ||||||||||| ||| | || |||||||||||||||||| | |||||||| ||||||||
Sbjct: 30987220 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggaccatgg 30987278



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 59/72 (81%)
 Strand = Plus / Minus

                                                                            
Query: 132      gatggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccg 191
                |||||||| |||||| || ||||||||||| |  |  ||||| || ||| |||| |||||
Sbjct: 30139913 gatggtgaggtttacggcggaggagctccgcgcgagcatggataagaaggacaacatccg 30139854

                            
Query: 192      taacatgtctgt 203
                 |||||||||||
Sbjct: 30139853 gaacatgtctgt 30139842



to top

>dbj|AP003768.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0439E07
          Length = 176486

 Score =  212 bits (107), Expect = 8e-52
 Identities = 233/275 (84%)
 Strand = Plus / Plus

                                                                         
Query: 229   tctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagctggt 288
             ||||| ||||| ||||||||||||||||||||||| ||||| |||||||| || ||||||
Sbjct: 44809 tctacccttactgattcccttgtggcagctgctggaattatagcccaggatgttgctggt 44868

                                                                         
Query: 289   gatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaatcc 348
             |||||||| ||||||||||  ||| |||| || |||||||||||||||||||| ||||| 
Sbjct: 44869 gatgttcgaatgactgatagtcgttcagatgaagcagaacgtggtattacaataaaatct 44928

                                                                         
Query: 349   acgggcatctctcttttctatcagatgactcctgaatcactcgagatgtacaagggcgac 408
             || || |||||||||| |||| |||||| |  ||| |||||| | |  |||||||| |||
Sbjct: 44929 actggtatctctctttactatgagatgagtgatgagtcactcaaaagttacaagggtgac 44988

                                                                         
Query: 409   agggatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttctct 468
             || |||||  |||| ||||| |||||||| ||||| |||||||| || || || || |||
Sbjct: 44989 agagatggaaatgaatacctaatcaacctcattgactcacctggacatgtcgatttttct 45048

                                                
Query: 469   tcggaagtcacagctgctcttcgtatcactgatgg 503
             |||||||||||||| || |||||||| ||||||||
Sbjct: 45049 tcggaagtcacagccgcacttcgtataactgatgg 45083



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                        
Query: 166   attatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
             ||||||||||| ||| | || |||||||||||||||||| | |||||||| ||||||||
Sbjct: 44199 attatggacaagaagcataacatccgtaacatgtctgttgtcgctcatgtggaccatgg 44257



to top

>ref|NM_179487.1| Arabidopsis thaliana LOS1; GTP binding / translation elongation
           factor/ translation factor, nucleic acid binding
           AT1G56070 (LOS1) mRNA, complete cds
          Length = 2958

 Score =  123 bits (62), Expect = 6e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 133 atggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgt 192
           |||||||||||||| || || ||||| ||  | ||||||||| | ||  |||| ||||||
Sbjct: 112 atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 171

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           || |||||||||||||||||||||||||| || || || || ||||| |||||  | || 
Sbjct: 172 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 231

                                                                       
Query: 253 gcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactgatacgcgt 312
           || |||||||| || |||||||| || || |||||||||||||| |||||||||||  | 
Sbjct: 232 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 291

                                                 
Query: 313 gcagacgaggcagaacgtggtattacaatcaaatccac 350
           || || ||||| ||||||||||| || ||||| |||||
Sbjct: 292 gctgatgaggctgaacgtggtatcactatcaagtccac 329



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 421 gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcaca 480
           |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || || || 
Sbjct: 400 gagtacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttact 459

                                     
Query: 481 gctgctcttcgtatcactgatggtgc 506
           |||||||| ||||| |||||||||||
Sbjct: 460 gctgctctccgtattactgatggtgc 485



to top

>gb|BT000722.1| Arabidopsis thaliana clone RAFL07-10-D07 (R10647) putative
           elongation factor (At1g56075) mRNA, complete cds
          Length = 2858

 Score =  123 bits (62), Expect = 6e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 133 atggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgt 192
           |||||||||||||| || || ||||| ||  | ||||||||| | ||  |||| ||||||
Sbjct: 76  atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 135

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           || |||||||||||||||||||||||||| || || || || ||||| |||||  | || 
Sbjct: 136 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 195

                                                                       
Query: 253 gcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactgatacgcgt 312
           || |||||||| || |||||||| || || |||||||||||||| |||||||||||  | 
Sbjct: 196 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 255

                                                 
Query: 313 gcagacgaggcagaacgtggtattacaatcaaatccac 350
           || || ||||| ||||||||||| || ||||| |||||
Sbjct: 256 gctgatgaggctgaacgtggtatcactatcaagtccac 293



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 421 gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcaca 480
           |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || || || 
Sbjct: 364 gagtacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttact 423

                                     
Query: 481 gctgctcttcgtatcactgatggtgc 506
           |||||||| ||||| |||||||||||
Sbjct: 424 gctgctctccgtattactgatggtgc 449



to top

>gb|BT000661.1| Arabidopsis thaliana clone RAFL08-12-J19 (R11046) putative
           elongation factor (At1g56075) mRNA, complete cds
          Length = 2875

 Score =  123 bits (62), Expect = 6e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 133 atggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgt 192
           |||||||||||||| || || ||||| ||  | ||||||||| | ||  |||| ||||||
Sbjct: 112 atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 171

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           || |||||||||||||||||||||||||| || || || || ||||| |||||  | || 
Sbjct: 172 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 231

                                                                       
Query: 253 gcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactgatacgcgt 312
           || |||||||| || |||||||| || || |||||||||||||| |||||||||||  | 
Sbjct: 232 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 291

                                                 
Query: 313 gcagacgaggcagaacgtggtattacaatcaaatccac 350
           || || ||||| ||||||||||| || ||||| |||||
Sbjct: 292 gctgatgaggctgaacgtggtatcactatcaagtccac 329



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 421 gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcaca 480
           |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || || || 
Sbjct: 400 gagtacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttact 459

                                     
Query: 481 gctgctcttcgtatcactgatggtgc 506
           |||||||| ||||| |||||||||||
Sbjct: 460 gctgctctccgtattactgatggtgc 485



to top

>gb|AF367331.1| Arabidopsis thaliana At1g56070/T6H22_13 mRNA, complete cds
          Length = 2756

 Score =  123 bits (62), Expect = 6e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 133 atggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgt 192
           |||||||||||||| || || ||||| ||  | ||||||||| | ||  |||| ||||||
Sbjct: 76  atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 135

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           || |||||||||||||||||||||||||| || || || || ||||| |||||  | || 
Sbjct: 136 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 195

                                                                       
Query: 253 gcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactgatacgcgt 312
           || |||||||| || |||||||| || || |||||||||||||| |||||||||||  | 
Sbjct: 196 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 255

                                                 
Query: 313 gcagacgaggcagaacgtggtattacaatcaaatccac 350
           || || ||||| ||||||||||| || ||||| |||||
Sbjct: 256 gctgatgaggctgaacgtggtatcactatcaagtccac 293



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 421 gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcaca 480
           |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || || || 
Sbjct: 364 gagtacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttact 423

                                     
Query: 481 gctgctcttcgtatcactgatggtgc 506
           |||||||| ||||| |||||||||||
Sbjct: 424 gctgctctccgtattactgatggtgc 449



to top

>gb|AY054461.1| Arabidopsis thaliana elongation factor EF-2 (At1g56070; T6H22.13)
           mRNA, complete cds
          Length = 2719

 Score =  123 bits (62), Expect = 6e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 133 atggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgt 192
           |||||||||||||| || || ||||| ||  | ||||||||| | ||  |||| ||||||
Sbjct: 76  atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 135

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           || |||||||||||||||||||||||||| || || || || ||||| |||||  | || 
Sbjct: 136 aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 195

                                                                       
Query: 253 gcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactgatacgcgt 312
           || |||||||| || |||||||| || || |||||||||||||| |||||||||||  | 
Sbjct: 196 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 255

                                                 
Query: 313 gcagacgaggcagaacgtggtattacaatcaaatccac 350
           || || ||||| ||||||||||| || ||||| |||||
Sbjct: 256 gctgatgaggctgaacgtggtatcactatcaagtccac 293



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 421 gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcaca 480
           |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || || || 
Sbjct: 364 gagtacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttact 423

                                     
Query: 481 gctgctcttcgtatcactgatggtgc 506
           |||||||| ||||| |||||||||||
Sbjct: 424 gctgctctccgtattactgatggtgc 449



to top

>gb|BT002714.1| Arabidopsis thaliana At1g56070/T6H22_13 gene, complete cds
          Length = 2532

 Score =  123 bits (62), Expect = 6e-25
 Identities = 179/218 (82%)
 Strand = Plus / Plus

                                                                       
Query: 133 atggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgt 192
           |||||||||||||| || || ||||| ||  | ||||||||| | ||  |||| ||||||
Sbjct: 1   atggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgt 60

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           || |||||||||||||||||||||||||| || || || || ||||| |||||  | || 
Sbjct: 61  aatatgtctgttattgctcatgtcgaccacgggaaatccactcttactgattctttggtt 120

                                                                       
Query: 253 gcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactgatacgcgt 312
           || |||||||| || |||||||| || || |||||||||||||| |||||||||||  | 
Sbjct: 121 gctgctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccaga 180

                                                 
Query: 313 gcagacgaggcagaacgtggtattacaatcaaatccac 350
           || || ||||| ||||||||||| || ||||| |||||
Sbjct: 181 gctgatgaggctgaacgtggtatcactatcaagtccac 218



 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 421 gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcaca 480
           |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || || || 
Sbjct: 289 gagtacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttact 348

                                     
Query: 481 gctgctcttcgtatcactgatggtgc 506
           |||||||| ||||| |||||||||||
Sbjct: 349 gctgctctccgtattactgatggtgc 374



to top

>gb|BT012802.1| Lycopersicon esculentum clone 113818R, mRNA sequence
          Length = 2816

 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Plus

                                                                       
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattccctt 249
           ||||| |||||||||||||||||||| |||||||| || ||||| ||||| ||||| || 
Sbjct: 130 cgtaatatgtctgttattgctcatgtggaccatggaaaatctacccttactgattctctg 189

                                                                       
Query: 250 gtggcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactgatacg 309
           ||||| |||||||| || ||||| |||||||| || ||||||||  | ||||| ||||| 
Sbjct: 190 gtggcggctgctggtatcattgctcaggaagttgcaggtgatgtcagaatgacagataca 249

                                                    
Query: 310 cgtgcagacgaggcagaacgtggtattacaatcaaatccac 350
           |||||||| ||||| || |||||||| || ||||| |||||
Sbjct: 250 cgtgcagatgaggctgagcgtggtatcaccatcaagtccac 290



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                       
Query: 421 gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcaca 480
           |||||||| |||||||| || ||||||||||| |||||||||||||| || ||||| || 
Sbjct: 361 gagtacctcatcaacctcatcgattcacctgggcacgttgacttctcatctgaagtgact 420

                                     
Query: 481 gctgctcttcgtatcactgatggtgc 506
           |||||||||||||| |||||||||||
Sbjct: 421 gctgctcttcgtattactgatggtgc 446



to top

>emb|Z97178.1|BVRNAEF2 Beta vulgaris cDNA for elongation factor 2
          Length = 3001

 Score =  121 bits (61), Expect = 2e-24
 Identities = 199/245 (81%)
 Strand = Plus / Plus

                                                                       
Query: 133 atggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgt 192
           ||||||||||| || || || ||||||||||  || ||||||   ||| | || ||||||
Sbjct: 123 atggtgaagttcacagctgacgagctccgtgctatcatggactgcaagcataacatccgt 182

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           |||||||||||||| || ||||| || || || || || ||||| || |||||  | |||
Sbjct: 183 aacatgtctgttatagcccatgtggatcacgggaaatcaacgctcacagattctttggtg 242

                                                                       
Query: 253 gcagctgctgggattattgcccaggaagtagctggtgatgttcgcatgactgatacgcgt 312
           || |||||||| || ||||||||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 243 gctgctgctggtatcattgcccaggaggtggctggcgatgtacggatgactgatacccgt 302

                                                                       
Query: 313 gcagacgaggcagaacgtggtattacaatcaaatccacgggcatctctcttttctatcag 372
           || || || || |||||||||||||| ||||| ||||| || || ||||| | |||||||
Sbjct: 303 gccgatgaagctgaacgtggtattaccatcaagtccactggaatttctctctactatcag 362

                
Query: 373 atgac 377
           |||||
Sbjct: 363 atgac 367



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 68/74 (91%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           ||||||||||||||||| ||||| ||||||||||| || || || |||||||||||||||
Sbjct: 420 atcaaccttattgattcccctgggcacgttgacttttcatcagaggtcacagctgctctt 479

                         
Query: 490 cgtatcactgatgg 503
           ||||||||||||||
Sbjct: 480 cgtatcactgatgg 493



to top

>dbj|AB026645.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGH6
          Length = 81020

 Score =  111 bits (56), Expect = 2e-21
 Identities = 80/88 (90%)
 Strand = Plus / Plus

                                                                        
Query: 419  atgagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtca 478
            ||||||||||||||||||| ||||| || ||||| ||||||||||| ||||| || ||||
Sbjct: 3854 atgagtacctgatcaacctcattgactctcctggacacgttgacttttcttcagaggtca 3913

                                        
Query: 479  cagctgctcttcgtatcactgatggtgc 506
            |||||||||| |||||||||||||||||
Sbjct: 3914 cagctgctctccgtatcactgatggtgc 3941



 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 125/150 (83%)
 Strand = Plus / Plus

                                                                        
Query: 229  tctacgcttacggattcccttgtggcagctgctgggattattgcccaggaagtagctggt 288
            ||||| ||||||||||| ||||| || |||||||| || ||||| || |||   || |||
Sbjct: 3664 tctacacttacggattcacttgttgctgctgctggtatcattgctcaagaaactgcgggt 3723

                                                                        
Query: 289  gatgttcgcatgactgatacgcgtgcagacgaggcagaacgtggtattacaatcaaatcc 348
            ||||| || ||||||||||| ||||| || ||||||||||||||||| || ||||| |||
Sbjct: 3724 gatgtgcgtatgactgatactcgtgctgatgaggcagaacgtggtatcaccatcaagtcc 3783

                                          
Query: 349  acgggcatctctcttttctatcagatgact 378
            || || |||||||| | |||| ||||||||
Sbjct: 3784 actggtatctctctctactatgagatgact 3813



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                       
Query: 182  acaatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
            |||| ||||||||||||||||| || || |||||||| |||||
Sbjct: 3371 acaacatccgtaacatgtctgtcatcgcccatgtcgatcatgg 3413



to top

>gb|AC009894.2| Arabidopsis thaliana chromosome I BAC T6H22 genomic sequence, complete
             sequence
          Length = 96489

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                         
Query: 421   gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcaca 480
             |||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || || || 
Sbjct: 59287 gagtacctcatcaatcttattgattcacctgggcacgttgacttttcttctgaggttact 59346

                                       
Query: 481   gctgctcttcgtatcactgatggtgc 506
             |||||||| ||||| |||||||||||
Sbjct: 59347 gctgctctccgtattactgatggtgc 59372



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                         
Query: 256   gctgctgggattattgcccaggaagtagctggtgatgttcgcatgactgatacgcgtgca 315
             |||||||| || |||||||| || || |||||||||||||| |||||||||||  | || 
Sbjct: 59122 gctgctggtatcattgcccaagaggttgctggtgatgttcgtatgactgataccagagct 59181

                                                
Query: 316   gacgaggcagaacgtggtattacaatcaaatccac 350
             || ||||| ||||||||||| || ||||| |||||
Sbjct: 59182 gatgaggctgaacgtggtatcactatcaagtccac 59216



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                         
Query: 135   ggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgtaa 194
             |||||||||||| || || ||||| ||  | ||||||||| | ||  |||| ||||||||
Sbjct: 58780 ggtgaagtttacagctgatgagcttcgaaggattatggactacaaacacaacatccgtaa 58839

                                        
Query: 195   catgtctgttattgctcatgtcgacca 221
              ||||||||||||||||||||||||||
Sbjct: 58840 tatgtctgttattgctcatgtcgacca 58866



to top

>gb|AC084640.1|CBRG45J08 Caenorhabditis briggsae cosmid G45J08, complete sequence
          Length = 42710

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                        
Query: 430  atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
            |||||| | |||||||| |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 8749 atcaacttgattgattctcctggccacgttgacttctcctcggaagtcaccgctgctctt 8690

                          
Query: 490  cgtatcactgatgg 503
            ||  ||||||||||
Sbjct: 8689 cgagtcactgatgg 8676



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                        
Query: 187  atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
            ||||| ||||||||||| || ||||||||||| || || ||||| || || || ||||| 
Sbjct: 9070 atccgcaacatgtctgtcatcgctcatgtcgatcacggaaagtccaccctcaccgattct 9011

                 
Query: 247  cttgt 251
            |||||
Sbjct: 9010 cttgt 9006



to top

>gb|AY305522.1| Skogsbergia lerneri voucher Skle elongation factor-2 mRNA, partial
           cds
          Length = 2107

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| || ||||||||||| ||||||||||||||||| ||||||||||| || |
Sbjct: 216 tgatcaacctgatcgattcacctggtcacgttgacttctcttctgaagtcacagcagccc 275

               
Query: 488 ttcg 491
           ||||
Sbjct: 276 ttcg 279



to top

>gb|AY305512.1| Neogonodactylus oerstedii voucher Neo elongation factor-2 mRNA,
           partial cds
          Length = 2179

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||||||||| || ||||| ||||||||||| ||||||||||| || |||||||||
Sbjct: 17  atggacaaaaagaagaacatccgaaacatgtctgtgattgctcatgtagatcatggcaag 76

             
Query: 229 tc 230
           ||
Sbjct: 77  tc 78



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           |||||||| |||||||| || ||||||||||| |||||||| ||||| || |||||  | 
Sbjct: 290 atcaacctgattgattccccaggccacgttgatttctcttcagaagtaactgctgccttg 349

                            
Query: 490 cgtatcactgatggtgc 506
           ||| | |||||||||||
Sbjct: 350 cgtgtgactgatggtgc 366



to top

>gb|AY305494.1| Ctenolepisma lineata voucher Cli elongation factor-2 mRNA, partial
           cds
          Length = 2179

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           ||||||||||||   |||||||| |||||||| || ||||||||||||||||||||||||
Sbjct: 17  atggacaaaaagcggaatatccgcaacatgtccgtcattgctcatgtcgaccatggcaag 76

             
Query: 229 tc 230
           ||
Sbjct: 77  tc 78



to top

>ref|XM_389750.1| Gibberella zeae PH-1 chromosome 4 EF2_NEUCR Elongation factor 2
           (EF-2) (Colonial temperature-sensitive 3) (FG09574.1)
           partial mRNA
          Length = 2499

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           |||||||||||||| || || || |||||||| |||||||| ||||| || |||||||| 
Sbjct: 268 atcaaccttattgactctcccggtcacgttgatttctcttctgaagttactgctgctctc 327

                            
Query: 490 cgtatcactgatggtgc 506
           ||| |||||||||||||
Sbjct: 328 cgtgtcactgatggtgc 344



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 183 caatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctac 233
           |||| ||||||||||||| |||||||| || ||||| || |||||||||||
Sbjct: 15  caatgtccgtaacatgtccgttattgcccacgtcgatcacggcaagtctac 65



to top

>ref|XM_691847.1| PREDICTED: Danio rerio similar to eukaryotic translation elongation
           factor 2 (LOC568514), mRNA
          Length = 2568

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                       
Query: 431 tcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctcttc 490
           ||||||| ||||| || |||||||| |||||||||||||| ||||| |||||||| || |
Sbjct: 305 tcaacctgattgactcccctggccatgttgacttctcttcagaagttacagctgcactgc 364

                        
Query: 491 gtatcactgatgg 503
           ||||||| |||||
Sbjct: 365 gtatcacagatgg 377



to top

>gb|AY010232.1| Bonnemaisonia hamifera elongation factor 2 (EF2) gene, partial cds
          Length = 2319

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                       
Query: 426 cctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           ||||||||| || ||||| |||||||| ||||||||||| || || || ||||| |||||
Sbjct: 213 cctgatcaatctcattgactcacctggacacgttgacttttcgtccgaggtcactgctgc 272

                                
Query: 486 tcttcgtatcactgatggtgc 506
            |||||| |||||||||||||
Sbjct: 273 ccttcgtgtcactgatggtgc 293



to top

>emb|BX293565.25| Zebrafish DNA sequence from clone DKEY-268M13 in linkage group 22,
             complete sequence
          Length = 160930

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                         
Query: 431   tcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctcttc 490
             ||||||| ||||| || |||||||| |||||||||||||| ||||| |||||||| || |
Sbjct: 16588 tcaacctgattgactcccctggccatgttgacttctcttcagaagttacagctgcactgc 16647

                          
Query: 491   gtatcactgatgg 503
             ||||||| |||||
Sbjct: 16648 gtatcacagatgg 16660



to top

>gb|AY078407.1| Spodoptera exigua translation elongation factor 2 mRNA, complete
           cds
          Length = 2983

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||| |||||||| || |||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 430 tgattaaccttatcgactcacctgggcacgttgacttctcatctgaagtaactgctgctc 489

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 490 tccgtgtaactgatggtgc 508



to top

>emb|CR719790.2|CNS0GIC4 Tetraodon nigroviridis full-length cDNA
          Length = 769

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 1   tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 60

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 61  tccgtgttactgatggtgc 79



to top

>emb|CR701440.1|CNS0G46K Tetraodon nigroviridis full-length cDNA
          Length = 1133

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 372 tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 431

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 432 tccgtgttactgatggtgc 450



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 113 atggacaagaaggccaacatccgtaacatgtctgtgattgc 153



to top

>emb|CR694358.2|CNS0FYPU Tetraodon nigroviridis full-length cDNA
          Length = 1714

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 381 tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 440

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 441 tccgtgttactgatggtgc 459



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 122 atggacaagaaggccaacatccgtaacatgtctgtgattgc 162



to top

>emb|CR694270.2|CNS0FYNE Tetraodon nigroviridis full-length cDNA
          Length = 1129

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 367 tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 426

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 427 tccgtgttactgatggtgc 445



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 108 atggacaagaaggccaacatccgtaacatgtctgtgattgc 148



to top

>emb|CR656569.2|CNS0F5KV Tetraodon nigroviridis full-length cDNA
          Length = 1130

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 371 tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 430

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 431 tccgtgttactgatggtgc 449



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 112 atggacaagaaggccaacatccgtaacatgtctgtgattgc 152



to top

>emb|CR651666.2|CNS0F1SO Tetraodon nigroviridis full-length cDNA
          Length = 1110

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 373 tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 432

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 433 tccgtgttactgatggtgc 451



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 114 atggacaagaaggccaacatccgtaacatgtctgtgattgc 154



to top

>emb|CR651194.2|CNS0F1FK Tetraodon nigroviridis full-length cDNA
          Length = 835

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 78  tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 137

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 138 tccgtgttactgatggtgc 156



to top

>emb|CR649058.2|CNS0EZS8 Tetraodon nigroviridis full-length cDNA
          Length = 1118

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 368 tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 427

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 428 tccgtgttactgatggtgc 446



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 109 atggacaagaaggccaacatccgtaacatgtctgtgattgc 149



to top

>emb|CR647101.2|CNS0EY9V Tetraodon nigroviridis full-length cDNA
          Length = 829

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 78  tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 137

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 138 tccgtgttactgatggtgc 156



to top

>emb|CR646461.2|CNS0EXS3 Tetraodon nigroviridis full-length cDNA
          Length = 1134

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 381 tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 440

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 441 tccgtgttactgatggtgc 459



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 122 atggacaagaaggccaacatccgtaacatgtctgtgattgc 162



to top

>emb|CR644860.2|CNS0EWJM Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 78  tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 137

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 138 tccgtgttactgatggtgc 156



to top

>emb|CR644476.2|CNS0EW8Y Tetraodon nigroviridis full-length cDNA
          Length = 1133

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 373 tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 432

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 433 tccgtgttactgatggtgc 451



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 114 atggacaagaaggccaacatccgtaacatgtctgtgattgc 154



to top

>emb|CR641154.2|CNS0ETOO Tetraodon nigroviridis full-length cDNA
          Length = 838

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 78  tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 137

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 138 tccgtgttactgatggtgc 156



to top

>emb|CR638920.2|CNS0ERYM Tetraodon nigroviridis full-length cDNA
          Length = 810

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || |||||||||||||| || ||||| || |||||||
Sbjct: 78  tgatcaacctgattgactcaccaggacacgttgacttctcctctgaagtgactgctgctc 137

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 138 tccgtgttactgatggtgc 156



to top

>gb|M68064.1|CHLEF2 Chlorella kessleri elongation factor 2 mRNA, complete cds
          Length = 2931

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 179 agaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgctta 238
           ||||||| |||||||||||||| || ||||| ||||| ||||| ||||||||||| || |
Sbjct: 146 agaacaacatccgtaacatgtccgtgattgcccatgtggaccacggcaagtctaccctca 205

                                              
Query: 239 cggattcccttgtggcagctgctgggattattgcc 273
           | || ||||| ||||| || ||||| || ||||||
Sbjct: 206 ccgactccctggtggcggccgctggtatcattgcc 240



to top

>dbj|D21259.1|ENHEF2A E. histolytica elongation factor 2 gene, partial sequence
          Length = 2286

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 62/71 (87%)
 Strand = Plus / Plus

                                                                       
Query: 433 aaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgt 492
           ||||||||||||||||| |||||||| || ||||| || ||||||||||| || ||||||
Sbjct: 208 aaccttattgattcaccaggccacgtcgatttctcatcagaagtcacagcagcacttcgt 267

                      
Query: 493 atcactgatgg 503
            | ||||||||
Sbjct: 268 gttactgatgg 278



to top

>gb|AF240824.1| Nipponopsalis abei elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 175 aaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacg 234
           |||||||| || || ||||| |||||||||||||||||||| ||||| || |||||||||
Sbjct: 23  aaaaagaagaacattcgtaatatgtctgttattgctcatgtggaccacggaaagtctacg 82

             
Query: 235 ct 236
           ||
Sbjct: 83  ct 84



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                          
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           |||||||| |||||||||||||| ||||| || ||||| || |||||
Sbjct: 299 attgattctcctggccacgttgatttctcctctgaagttaccgctgc 345



to top

>gb|AY310270.1| Nemasoma varicorne voucher Nva elongation factor 2 mRNA, partial
           cds
          Length = 643

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 442 gattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgat 501
           ||||| || |||||||||||||||||||| ||||| || || ||||| ||| ||||||||
Sbjct: 302 gattctccaggccacgttgacttctcttctgaagttactgcggctctgcgtgtcactgat 361

                
Query: 502 ggtgc 506
           |||||
Sbjct: 362 ggtgc 366



to top

>gb|AY310264.1| Ophyiulus pilosus voucher Jul elongation factor 2 mRNA, partial cds
          Length = 2185

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           ||||||||||| |||||||| || ||||| || ||||| || |||||||||||| |||||
Sbjct: 299 attgattcaccaggccacgtagatttctcatctgaagtaactgctgctcttcgtgtcact 358

                
Query: 499 gatgg 503
           |||||
Sbjct: 359 gatgg 363



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| ||||| || |||||||||||||| || ||||| || || ||||| || || 
Sbjct: 17  atggacaagaagaagaacatccgtaacatgtccgtgattgcccacgtagaccacggtaaa 76

                             
Query: 229 tctacgcttacggattcc 246
           || || || |||||||||
Sbjct: 77  tcaacactgacggattcc 94



to top

>gb|AY310257.1| Glomeris marginata voucher Gma2 elongation factor 2 mRNA, partial
           cds
          Length = 2182

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 442 gattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgat 501
           ||||| ||||||||||||||||||||||| ||||| || ||||| || ||| |||| |||
Sbjct: 302 gattcccctggccacgttgacttctcttccgaagtaacggctgcactccgtgtcaccgat 361

                
Query: 502 ggtgc 506
           |||||
Sbjct: 362 ggtgc 366



to top

>gb|AY310252.1| Cylindroiulus punctatus voucher Cpu elongation factor 2 mRNA,
           partial cds
          Length = 2110

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           |||||||||||||||||||| || ||||| || ||||| |||||||| |||||| | |||
Sbjct: 224 attgattcacctggccacgtcgatttctcrtctgaagtaacagctgcgcttcgtgtaact 283

                
Query: 499 gatgg 503
           |||||
Sbjct: 284 gatgg 288



to top

>ref|XM_792306.1| PREDICTED: Strongylocentrotus purpuratus similar to eukaryotic
           translation elongation factor 2, like (LOC592801), mRNA
          Length = 3748

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Plus

                                                    
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctac 233
           ||||||||||| || ||||||||||||||||||||||||||
Sbjct: 190 aacatgtctgtcatcgctcatgtcgaccatggcaagtctac 230



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| || ||||| || ||||| |||||||| || || || || ||||||||||
Sbjct: 431 tgatcaacctcatcgattccccaggccatgttgacttttcgtctgaggtgacagctgctc 490

                           
Query: 488 ttcgtatcactgatgg 503
           | ||| | ||||||||
Sbjct: 491 tgcgtgtaactgatgg 506



to top

>ref|XM_692265.1| PREDICTED: Danio rerio similar to eukaryotic translation elongation
           factor 2 (LOC568904), mRNA
          Length = 2568

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 431 tcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctcttc 490
           ||||||| ||||| || ||||| || |||||||||||||| ||||| |||||||| || |
Sbjct: 305 tcaacctgattgactcccctgggcatgttgacttctcttcagaagttacagctgcactgc 364

                        
Query: 491 gtatcactgatgg 503
           ||||||| |||||
Sbjct: 365 gtatcacagatgg 377



to top

>gb|DQ295234.1| Spironucleus barkhanus translation elongation factor 2 (EF-2) mRNA,
           partial cds
          Length = 2529

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           ||||| ||||||||||| ||||| |||||||| ||||| || || || || |||||||| 
Sbjct: 257 atcaatcttattgattcccctgggcacgttgatttctcctctgaggttactgctgctctc 316

                            
Query: 490 cgtatcactgatggtgc 506
           |||||||| ||||||||
Sbjct: 317 cgtatcaccgatggtgc 333



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 atgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtggca 255
           |||||||||||||| ||||| || ||||| ||||| || ||||| ||||| ||| | || 
Sbjct: 38  atgtctgttattgcacatgtagatcatggtaagtcaactcttactgattctcttatcgcc 97

                         
Query: 256 gctgctgggattat 269
           |||||||| |||||
Sbjct: 98  gctgctggtattat 111



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 328 cgtggtattacaatcaaatccacgggcatctctcttttctat 369
           ||||||||||| ||||| ||||| ||| | ||||||||||||
Sbjct: 170 cgtggtattaccatcaagtccactggcgtttctcttttctat 211



to top

>emb|BX005203.7| Zebrafish DNA sequence from clone DKEY-110C1 in linkage group 22,
              complete sequence
          Length = 214843

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                          
Query: 431    tcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctcttc 490
              ||||||| ||||| || ||||| || |||||||||||||| ||||| |||||||| || |
Sbjct: 148660 tcaacctgattgactcccctgggcatgttgacttctcttcagaagttacagctgcactgc 148601

                           
Query: 491    gtatcactgatgg 503
              ||||||| |||||
Sbjct: 148600 gtatcacagatgg 148588



to top

>ref|XM_645436.1| Entamoeba histolytica HM-1:IMSS elongation factor 2 (214.t00016)
           partial mRNA
          Length = 2436

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 436 cttattgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatc 495
           |||||||||||||| |||||||| || ||||| || ||||||||||| || |||||| | 
Sbjct: 247 cttattgattcaccaggccacgtcgatttctcatcagaagtcacagcagcacttcgtgtt 306

                   
Query: 496 actgatgg 503
           ||||||||
Sbjct: 307 actgatgg 314



to top

>ref|XM_645917.1| Entamoeba histolytica HM-1:IMSS elongation factor 2 (187.t00004)
           partial mRNA
          Length = 2352

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 436 cttattgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatc 495
           |||||||||||||| |||||||| || ||||| || ||||||||||| || |||||| | 
Sbjct: 298 cttattgattcaccaggccacgtcgatttctcatcagaagtcacagcagcacttcgtgtt 357

                   
Query: 496 actgatgg 503
           ||||||||
Sbjct: 358 actgatgg 365



to top

>gb|AY305531.1| Ooperipatellus nanus voucher Ona elongation factor-2 mRNA, partial
           cds
          Length = 1978

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           ||||||| || |||||||| ||||||||||| || || ||||| ||||| || |||||||
Sbjct: 288 tgatcaatctcattgattctcctggccacgtagatttttcttcagaagttactgctgctc 347

                           
Query: 488 ttcgtatcactgatgg 503
           | ||| ||||||||||
Sbjct: 348 tccgtgtcactgatgg 363



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
           ||||||||||||   |||||||| ||||||||||| || || ||||| ||||||||
Sbjct: 17  atggacaaaaagcggaatatccgcaacatgtctgtgatagcgcatgtagaccatgg 72



to top

>gb|AY305525.1| Trachyiulus nordquisti voucher Tnor elongation factor-2 mRNA,
           partial cds
          Length = 2185

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| ||||| || |||||||||||||| || || || || ||||| || ||||||
Sbjct: 17  atggacaagaagaagaacatccgtaacatgtccgtgatagcccacgtcgatcacggcaag 76

                               
Query: 229 tctacgcttacggattccct 248
           || ||||| |||||||||||
Sbjct: 77  tccacgctgacggattccct 96



to top

>gb|AY310280.1| Platydesmus sp. 'Pla' elongation factor 2 mRNA, partial cds
          Length = 2185

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
           |||||||| ||||| || |||||||||||||| || |||||||||||||| |||||
Sbjct: 17  atggacaagaagaagaacatccgtaacatgtccgtcattgctcatgtcgatcatgg 72



to top

>emb|AL122032.1|SPAC513 S.pombe chromosome I cosmid c513
          Length = 13204

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 183 caatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacg 234
           |||| |||||||||||||||| |||||||| ||||| || ||||||||||||
Sbjct: 140 caatgtccgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 89



to top

>emb|AL121859.1|SPCP31B10 S.pombe chromosome III p1 p31B10
          Length = 21649

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                                 
Query: 183   caatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacg 234
             |||| |||||||||||||||| |||||||| ||||| || ||||||||||||
Sbjct: 12717 caatgtccgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 12768



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                  
Query: 454   cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
             ||||||||||| ||||| || || || || ||||||||| ||||||| |||||
Sbjct: 12988 cacgttgacttttcttctgaggttactgccgctcttcgtgtcactgacggtgc 13040



to top

>ref|NM_001022856.1| Schizosaccharomyces pombe 972h- hypothetical protein
           (SPCP31B10.07), partial mRNA
          Length = 2529

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 183 caatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacg 234
           |||| |||||||||||||||| |||||||| ||||| || ||||||||||||
Sbjct: 51  caatgtccgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 102



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 454 cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||||||||| ||||| || || || || ||||||||| ||||||| |||||
Sbjct: 322 cacgttgacttttcttctgaggttactgccgctcttcgtgtcactgacggtgc 374



to top

>ref|NM_001019401.1| Schizosaccharomyces pombe 972h- elongation factor 2 (SPAC513.01c),
           partial mRNA
          Length = 2529

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 183 caatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacg 234
           |||| |||||||||||||||| |||||||| ||||| || ||||||||||||
Sbjct: 51  caatgtccgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 102



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 454 cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||||||||| ||||| || || || || ||||||||| ||||||| |||||
Sbjct: 322 cacgttgacttttcttctgaggttactgccgctcttcgtgtcactgacggtgc 374



to top

>gb|L02417.1|ENHEF2 Entamoeba histolytica translation elongation factor-2 (EF-2) mRNA,
           complete cds
          Length = 2550

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 436 cttattgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatc 495
           |||||||||||||| |||||||| || ||||| || ||||||||||| || |||||| | 
Sbjct: 309 cttattgattcaccaggccacgtcgatttctcatcagaagtcacagcagcacttcgtgtt 368

                   
Query: 496 actgatgg 503
           ||||||||
Sbjct: 369 actgatgg 376



to top

>dbj|D83976.1| Schizosaccharomyces pombe DNA for elongation factor 2, complete cds
          Length = 3276

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 183 caatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacg 234
           |||| |||||||||||||||| |||||||| ||||| || ||||||||||||
Sbjct: 261 caatgtccgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 312



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 454 cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||||||||| ||||| || || || || ||||||||| ||||||| |||||
Sbjct: 532 cacgttgacttttcttctgaggttactgccgctcttcgtgtcactgacggtgc 584



to top

>dbj|D83975.1| Schizosaccharomyces pombe DNA for elongation factor 2, complete cds
          Length = 3222

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 47/52 (90%)
 Strand = Plus / Plus

                                                               
Query: 183 caatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacg 234
           |||| |||||||||||||||| |||||||| ||||| || ||||||||||||
Sbjct: 318 caatgtccgtaacatgtctgtgattgctcacgtcgatcacggcaagtctacg 369



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 454 cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||||||||| ||||| || || || || ||||||||| ||||||| |||||
Sbjct: 589 cacgttgacttttcttctgaggttactgccgctcttcgtgtcactgacggtgc 641



to top

>emb|CR645858.2|CNS0EXBC Tetraodon nigroviridis full-length cDNA
          Length = 1133

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| ||||| ||||| || ||||||||||||||  | ||||| || |||||||
Sbjct: 374 tgatcaacctgattgactcaccaggacacgttgacttctcccctgaagtgactgctgctc 433

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| | |||||||||||
Sbjct: 434 tccgtgttactgatggtgc 452



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 115 atggacaagaaggccaacatccgtaacatgtctgtgattgc 155



to top

>gb|AY305526.1| Streptocephalus seali voucher ufs elongation factor-2 mRNA, partial
           cds
          Length = 2179

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 65/79 (82%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||| | || ||||| || |||||||| |||||||| || ||||| || || || |
Sbjct: 288 tgatcaacttgatcgattctccaggccacgtcgacttctcrtcagaagtaacrgcygcyc 347

                              
Query: 488 ttcgtatcactgatggtgc 506
           ||||| |||| ||||||||
Sbjct: 348 ttcgtgtcacwgatggtgc 366



to top

>gb|AY305487.1| Acanthocyclops vernalis voucher A369 elongation factor-2 mRNA,
           partial cds
          Length = 2179

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 166 attatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggc 225
           || |||||||||||| |||| ||||| |||||||| || || ||||| ||||| || |||
Sbjct: 14  atyatggacaaaaagcacaacatccgsaacatgtcygtcatygctcacgtcgatcacggc 73

                
Query: 226 aagtc 230
           |||||
Sbjct: 74  aagtc 78



to top

>ref|NM_205368.1| Gallus gallus eukaryotic translation elongation factor 2 (EEF2),
           mRNA
          Length = 3144

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| || || || ||||| ||||| || |||||||| || ||||| |||||||
Sbjct: 326 tgatcaacctgatcgactctcctgggcacgtggatttctcttcagaggtcaccgctgctc 385

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| |||||||||||||
Sbjct: 386 tgcgtgtcactgatggtgc 404



to top

>gb|AY064104.1| Aedes aegypti clone EF2Mc2 elongation factor 2 (Ef-2) mRNA,
           complete cds
          Length = 2658

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
           |||||||||||||| || ||||| || |||||||| |||||||| ||||| ||||||||
Sbjct: 112 atccgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 170



to top

>gb|AY064103.1| Aedes aegypti clone EF2Rc2 elongation factor 2 (Ef-2) mRNA,
           complete cds
          Length = 2658

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
           |||||||||||||| || ||||| || |||||||| |||||||| ||||| ||||||||
Sbjct: 112 atccgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 170



to top

>gb|AY040342.1| Aedes aegypti elongation factor 2 (Ef-2) mRNA, complete cds
          Length = 2681

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
           |||||||||||||| || ||||| || |||||||| |||||||| ||||| ||||||||
Sbjct: 135 atccgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 193



to top

>gb|AF331798.1|AF331798 Aedes aegypti elongation factor 2 (Ef-2) mRNA, complete cds
          Length = 2681

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Plus

                                                                      
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
           |||||||||||||| || ||||| || |||||||| |||||||| ||||| ||||||||
Sbjct: 135 atccgtaacatgtccgtcattgcccacgtcgaccacggcaagtccacgctcacggattc 193



to top

>gb|U46663.1|GGU46663 Gallus gallus elongation factor 2 mRNA, complete cds
          Length = 3144

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||||| || || || ||||| ||||| || |||||||| || ||||| |||||||
Sbjct: 326 tgatcaacctgatcgactctcctgggcacgtggatttctcttcagaggtcaccgctgctc 385

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| |||||||||||||
Sbjct: 386 tgcgtgtcactgatggtgc 404



to top

>emb|Z81068.1|CEF25H5 Caenorhabditis elegans Cosmid F25H5, complete sequence
          Length = 38692

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                        
Query: 442  gattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgat 501
            |||||||| || |||||||||||||| || ||||| || |||||||||||| | ||||||
Sbjct: 9459 gattcacccggtcacgttgacttctcgtctgaagttactgctgctcttcgtgttactgat 9518

              
Query: 502  gg 503
            ||
Sbjct: 9519 gg 9520



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 190  cgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
            ||||||||||||||||||||||| ||||| || || || ||||| ||||| |||||
Sbjct: 9125 cgtaacatgtctgttattgctcacgtcgatcacggaaaatctacccttaccgattc 9180



to top

>gb|AY305488.1| Abacion magnum voucher Ama2 elongation factor-2 mRNA, partial cds
          Length = 2185

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 439 attgattcacctggccacgttgacttctcttcggaagt 476
           ||||||||||| |||||||| |||||||||||||||||
Sbjct: 299 attgattcaccaggccacgtcgacttctcttcggaagt 336



to top

>gb|AF240823.1| Mastigoproctus giganteus elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 184 aatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggat 243
           |||||||| ||||||||||| ||||| ||||| |||||||| ||||| || ||||| |||
Sbjct: 32  aatatccgcaacatgtctgtaattgcacatgtggaccatgggaagtcaacacttacagat 91

             
Query: 244 tc 245
           ||
Sbjct: 92  tc 93



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagc 482
           |||||| | ||||||||||| ||||| ||||| || ||||| ||||| |||||
Sbjct: 290 atcaacttaattgattcaccaggccatgttgatttttcttctgaagtgacagc 342



to top

>ref|NM_060056.3| Caenorhabditis elegans Elongation FacTor family member (eft-2)
           (eft-2) mRNA, complete cds
          Length = 2669

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 442 gattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgat 501
           |||||||| || |||||||||||||| || ||||| || |||||||||||| | ||||||
Sbjct: 427 gattcacccggtcacgttgacttctcgtctgaagttactgctgctcttcgtgttactgat 486

             
Query: 502 gg 503
           ||
Sbjct: 487 gg 488



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
           ||||||||||||||||||||||| ||||| || || || ||||| ||||| |||||
Sbjct: 139 cgtaacatgtctgttattgctcacgtcgatcacggaaaatctacccttaccgattc 194



to top

>ref|XM_662910.1| Cryptosporidium hominis TU502 elongation factor 2 (EF-2)
           (Chro.80341) partial mRNA
          Length = 2499

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaa 227
           |||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 55  atccgtaatatgtctgttattgctcacgtcgatcatggcaa 95



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           |||||| | ||||||||||| || ||||| ||||| ||||| ||||| || || ||||||
Sbjct: 280 atcaacttaattgattcaccggggcacgtagacttttcttcagaagttactgcagctctt 339

              
Query: 490 cgt 492
           |||
Sbjct: 340 cgt 342



to top

>gb|AY305517.1| Periplaneta americana voucher Pam elongation factor-2 mRNA, partial
           cds
          Length = 2179

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 158 tccgtggaattatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcg 217
           |||||| ||| ||||| |||||||  ||||||||||| |||||||| || || |||||||
Sbjct: 6   tccgtgtaatgatggataaaaagagaaatatccgtaatatgtctgtgatcgcccatgtcg 65

                        
Query: 218 accatggcaagtc 230
           | || ||||||||
Sbjct: 66  atcacggcaagtc 78



to top

>gb|AY305509.1| Lynceus sp. JCR-2003 elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           |||||||| ||||| ||||||||||| || || ||||| ||||| ||||| ||| |||||
Sbjct: 299 attgattctcctggacacgttgacttttcatctgaagtgacagcagctctccgtgtcact 358

                
Query: 499 gatgg 503
           |||||
Sbjct: 359 gatgg 363



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| ||||| || || ||||||||||| || ||||||||||| || ||||| || 
Sbjct: 17  atggacaagaagaagaacattcgtaacatgtccgtcattgctcatgtagatcatggtaaa 76

                      
Query: 229 tctacgcttac 239
           ||||| |||||
Sbjct: 77  tctactcttac 87



to top

>gb|AF240835.1| Peripatus sp. 'Per2' elongation factor-2 mRNA, partial cds
          Length = 2182

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcg 491
           |||||||||||||||||||| ||||| ||||| ||||| || || ||||||||
Sbjct: 299 attgattcacctggccacgtagacttttcttcagaagtaactgcagctcttcg 351



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 184 aatatccgtaacatgtctgttattgc 209
           |||||||||||||||||||| |||||
Sbjct: 32  aatatccgtaacatgtctgtgattgc 57



to top

>ref|XM_627193.1| Cryptosporidium parvum Iowa II Eft2p GTpase; translation elongation
           factor 2 (EF-2) (cgd8_2930), partial mRNA
          Length = 2511

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaa 227
           |||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 67  atccgtaatatgtctgttattgctcacgtcgatcatggcaa 107



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           |||||| | ||||||||||| || ||||| ||||| ||||| ||||| || || ||||||
Sbjct: 292 atcaacttaattgattcaccgggacacgtagacttttcttcagaagttactgcagctctt 351

              
Query: 490 cgt 492
           |||
Sbjct: 352 cgt 354



to top

>gb|U21667.1|CPU21667 Cryptosporidium parvum elongation factor-2 (EF-2) gene, complete
           cds
          Length = 2723

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                    
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaa 227
           |||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 145 atccgtaatatgtctgttattgctcacgtcgatcatggcaa 185



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           |||||| | ||||||||||| || ||||| ||||| ||||| ||||| || || ||||||
Sbjct: 370 atcaacttaattgattcaccgggacacgtagacttttcttcagaagttactgcagctctt 429

              
Query: 490 cgt 492
           |||
Sbjct: 430 cgt 432



to top

>gb|AY391422.1| Danio rerio eukaryotic translation elongation factor 2 (EEF2) mRNA,
           complete cds
          Length = 2826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 448 cctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatgg 503
           ||||||||||| ||||| || || || |||||||||||||| ||| ||||||||||
Sbjct: 370 cctggccacgtggacttttcctccgaggtcacagctgctctgcgtgtcactgatgg 425



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           ||||||||||||  ||| ||||||||||||||||| |||||
Sbjct: 91  atggacaaaaagtccaacatccgtaacatgtctgtgattgc 131



to top

>gb|AY737540.1| Toxoptera citricida putative translation elongation factor 2 mRNA,
           complete cds
          Length = 2535

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
           |||||||| ||||| ||||| |||||||||||||| || |||||||| || |||||
Sbjct: 37  atggacaagaagaagaatattcgtaacatgtctgtcatcgctcatgtggatcatgg 92



to top

>gb|BC045488.1| Danio rerio eukaryotic translation elongation factor 2, like, mRNA
           (cDNA clone MGC:55904 IMAGE:3818891), complete cds
          Length = 2855

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 448 cctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatgg 503
           ||||||||||| ||||| || || || |||||||||||||| ||| ||||||||||
Sbjct: 401 cctggccacgtggacttttcctccgaggtcacagctgctctgcgtgtcactgatgg 456



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 122 atggacaagaagtccaacatccgtaacatgtctgtgattgc 162



to top

>gb|AC159225.4| Mus musculus chromosome 1, clone RP24-306F17, complete sequence
          Length = 168805

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 193   aacatgtctgttattgctcatgtcgaccatggcaagtcta 232
             |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 82970 aacatgtcagtcattgctcatgtggaccatggcaagtcta 83009



to top

>ref|XR_002852.1| PREDICTED: Mus musculus similar to Elongation factor 2 (EF-2)
           (LOC634054), mRNA
          Length = 506

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           |||||||| || || |||||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 61  aacatgtcagtcatggctcatgtggaccatggcaagtccacgctgaccgactcccttgtg 120



to top

>ref|XR_003342.1| PREDICTED: Mus musculus similar to Elongation factor 2 (EF-2)
           (LOC435640), mRNA
          Length = 2545

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtcta 232
           |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 173 aacatgtcagtcattgctcatgtggaccatggcaagtcta 212



to top

>gb|AC102568.8| Mus musculus chromosome 1, clone RP23-224O10, complete sequence
          Length = 239053

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 193   aacatgtctgttattgctcatgtcgaccatggcaagtcta 232
             |||||||| || ||||||||||| ||||||||||||||||
Sbjct: 21935 aacatgtcagtcattgctcatgtggaccatggcaagtcta 21896



to top

>gb|AY310292.1| Striaria columbiana voucher Str2 elongation factor 2 mRNA, partial
           cds
          Length = 2185

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| ||||| || ||||||||||||||||| || || || || |||||||| |||
Sbjct: 17  atggacaagaagaagaacatccgtaacatgtctgtcatcgcccacgtggaccatggaaag 76

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 77  tccacgct 84



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttc 470
           |||||||||| || || || || ||||||||||||||||||||
Sbjct: 288 tgatcaacctgatcgactctcccggccacgttgacttctcttc 330



to top

>gb|AY310268.1| Plesioproctus comans voucher Lop elongation factor 2 mRNA, partial
           cds
          Length = 2185

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||||||||| || |||||||||||||| || || || || || ||||| || |||
Sbjct: 17  atggacaaaaagaagaacatccgtaacatgtccgtcatagcccacgtggaccacggaaag 76

                               
Query: 229 tctacgcttacggattccct 248
           || || || |||||||||||
Sbjct: 77  tccaccctcacggattccct 96



to top

>ref|XM_970542.1| PREDICTED: Tribolium castaneum similar to Elongation factor 2
           (EF-2) (LOC664546), mRNA
          Length = 2927

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           ||||||| || ||||| || || || ||||| |||||||| || ||||||||||| ||||
Sbjct: 376 tgatcaatctgattgactctcccggacacgtcgacttctcatcagaagtcacagccgctc 435

                           
Query: 488 ttcgtatcactgatgg 503
           ||||  ||||||||||
Sbjct: 436 ttcgcgtcactgatgg 451



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 58/69 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 aatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggat 243
           ||||||||||||||||| || |||||||| || ||||| ||||| || || || || || 
Sbjct: 120 aatatccgtaacatgtccgtcattgctcacgtggaccacggcaaatcaactctgaccgac 179

                    
Query: 244 tcccttgtg 252
           |||||||||
Sbjct: 180 tcccttgtg 188



to top

>gb|AF240821.1| Limulus polyphemus elongation factor-2 mRNA, partial cds
          Length = 1975

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           ||||||||||||||||||||||| ||||| ||||| || |||||
Sbjct: 35  atccgtaacatgtctgttattgcccatgtagaccacggaaagtc 78



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 40/47 (85%)
 Strand = Plus / Plus

                                                          
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           |||||||| || ||||| || ||||| ||||| ||||| ||||||||
Sbjct: 299 attgattctccgggccatgtagacttytcttcagaagttacagctgc 345



to top

>gb|BC063965.1| Danio rerio eukaryotic translation elongation factor 2, like, mRNA
           (cDNA clone MGC:77674 IMAGE:6997283), complete cds
          Length = 2850

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 448 cctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatgg 503
           ||||||||||| ||||| || || || |||||||||||||| ||| ||||||||||
Sbjct: 381 cctggccacgtggacttttcctccgaggtcacagctgctctgcgtgtcactgatgg 436



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 102 atggacaagaagtccaacatccgtaacatgtctgtgattgc 142



to top

>gb|BC103385.1| Bos taurus cDNA clone MGC:127305 IMAGE:7949634, complete cds
          Length = 3198

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| ||||| || || ||||||||||| 
Sbjct: 119 atggacaagaaggccaacatccggaacatgtctgtcattgcccacgtggaccatggcaaa 178

                                   
Query: 229 tctacgcttacggattcccttgtg 252
           || || || ||||| |||||||||
Sbjct: 179 tccactctgacggactcccttgtg 202



to top

>ref|XM_392691.2| PREDICTED: Apis mellifera similar to translation elongation factor
           2 (LOC409167), mRNA
          Length = 3274

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||| |||||||||||||||||||| || || || ||||||   ||||| || |||||||
Sbjct: 527 tgattaaccttattgattcacctggtcatgtcgatttctctagtgaagtaactgctgctc 586

                           
Query: 488 ttcgtatcactgatgg 503
           ||||| | ||||||||
Sbjct: 587 ttcgtgtaactgatgg 602



 Score = 48.1 bits (24), Expect = 0.028
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||||||||| |||||  | || |||||||| ||||| ||||| || ||||| |||
Sbjct: 256 atggacaaaaagaaaaatattagaaatatgtctgtcattgcgcatgttgatcatggaaag 315

                                   
Query: 229 tctacgcttacggattcccttgtg 252
           || || || || || |||||||||
Sbjct: 316 tcaactctgactgactcccttgtg 339



to top

>ref|NM_200458.2| Danio rerio eukaryotic translation elongation factor 2, like
           (eef2l), mRNA
          Length = 2826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 448 cctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatgg 503
           ||||||||||| ||||| || || || |||||||||||||| ||| ||||||||||
Sbjct: 370 cctggccacgtggacttttcctccgaggtcacagctgctctgcgtgtcactgatgg 425



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           ||||||||||||  ||| ||||||||||||||||| |||||
Sbjct: 91  atggacaaaaagtccaacatccgtaacatgtctgtgattgc 131



to top

>gb|AY144923.1| Saccharomyces castellii clone Contig2043 EFT gene, complete cds
          Length = 2529

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtctac 233
           ||||||||||| ||||||||||| ||||| ||||| ||||||||
Sbjct: 58  cgtaacatgtccgttattgctcacgtcgatcatggtaagtctac 101



to top

>emb|AL713978.9| Mouse DNA sequence from clone RP23-159H8 on chromosome X, complete
             sequence
          Length = 183455

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 193   aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
             |||||||| || || |||||||| |||||||||||||| ||||| || || |||||||||
Sbjct: 66760 aacatgtcagtcatggctcatgtggaccatggcaagtccacgctgaccgactcccttgtg 66701



to top

>gb|BT021869.1| Bos taurus N-acetylglucosamine-1-phosphotransferase, gamma subunit
           (GNPTG), mRNA, complete cds
          Length = 1529

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| ||||| || || ||||||||||| 
Sbjct: 103 atggacaagaaggccaacatccggaacatgtctgtcattgcccacgtggaccatggcaaa 162

                                   
Query: 229 tctacgcttacggattcccttgtg 252
           || || || ||||| |||||||||
Sbjct: 163 tccactctgacggactcccttgtg 186



to top

>gb|M86959.1|CELEFT2A Caenorhabditis elegans elongation factor (eft-2) mRNA, complete cds
          Length = 2701

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
           ||||||||||||||||||||||| ||||| || || || ||||| ||||| |||||
Sbjct: 88  cgtaacatgtctgttattgctcacgtcgatcacggaaaatctacccttaccgattc 143



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 442 gattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgat 501
           |||||||| || |||||||||||||| || ||||| || ||||||||| || | ||||||
Sbjct: 376 gattcacccggtcacgttgacttctcgtctgaagttactgctgctcttggtgttactgat 435

             
Query: 502 gg 503
           ||
Sbjct: 436 gg 437



to top

>ref|XM_529984.1| PREDICTED: Pan troglodytes LOC455595 (LOC455595), mRNA
          Length = 399

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 166 attatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggc 225
           ||||||||||| |||  ||| ||||| ||||||||||| || || || || |||||||||
Sbjct: 275 attatggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggc 216

                      
Query: 226 aagtctacgct 236
           ||||| |||||
Sbjct: 215 aagtccacgct 205



to top

>gb|AY618058.1| Sterkiella histriomuscorum clone UGC1O0003_B13_R genomic sequence
          Length = 561

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttac 239
           |||||||| |||||||| || ||||||||||| |||||||| |||||
Sbjct: 261 aacatgtcagttattgcccacgtcgaccatggaaagtctactcttac 307



to top

>gb|AY618055.1| Sterkiella histriomuscorum clone UGC1O0002_P11_R genomic sequence
          Length = 682

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttac 239
           |||||||| |||||||| || ||||||||||| |||||||| |||||
Sbjct: 260 aacatgtcagttattgcccacgtcgaccatggaaagtctactcttac 306



to top

>gb|AY618036.1| Sterkiella histriomuscorum clone UGC1O0002_H14_R genomic sequence
          Length = 681

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttac 239
           |||||||| |||||||| || ||||||||||| |||||||| |||||
Sbjct: 260 aacatgtcagttattgcccacgtcgaccatggaaagtctactcttac 306



to top

>gb|AY617227.1| Sterkiella histriomuscorum clone UGC1O0001_F19_R genomic sequence
          Length = 494

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttac 239
           |||||||| |||||||| || ||||||||||| |||||||| |||||
Sbjct: 252 aacatgtcagttattgcccacgtcgaccatggaaagtctactcttac 298



to top

>ref|XM_750593.1| Aspergillus fumigatus Af293 translation elongation factor EF-2
           subunit (Afu2g13530) partial mRNA
          Length = 2520

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                       
Query: 412 gatggtgatgagtacctgatcaaccttattgattcacctggccacgttgacttctcttcg 471
           ||||||| ||||| | || ||||||| || ||||| || || |||||||||||||| || 
Sbjct: 283 gatggtgctgagttcttggtcaacctgatcgattcccccggtcacgttgacttctcctct 342

                                              
Query: 472 gaagtcacagctgctcttcgtatcactgatggtgc 506
           || ||||| || ||||| ||| ||||||| |||||
Sbjct: 343 gaggtcactgccgctctccgtgtcactgacggtgc 377



to top

>gb|AY305532.1| Richtersius coronifer voucher Rco elongation factor-2 mRNA, partial
           cds
          Length = 2185

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 426 cctgatcaaccttattgattcacctggccacgttgactt 464
           ||||||||||||||||||||| || || |||||||||||
Sbjct: 289 cctgatcaaccttattgattcgcccggtcacgttgactt 327



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaa 227
           |||||||| ||||  || ||||| |||||||| ||||||||||| || ||||| |||||
Sbjct: 17  atggacaagaagactaacatccgaaacatgtccgttattgctcacgtggaccacggcaa 75



to top

>gb|AY305524.1| Triops longicaudatus voucher Tlo elongation factor-2 mRNA, partial
           cds
          Length = 2107

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 66/79 (83%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||| | || ||||| || || ||||| ||||||||||| |||||||| || ||||
Sbjct: 216 tgatcaacttgatcgattcccccggacacgtcgacttctcttccgaagtcacggccgctc 275

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||| ||||||| |||||
Sbjct: 276 tccgtgtcactgacggtgc 294



to top

>gb|AY305506.1| Libinia emarginata voucher Lem elongation factor-2 mRNA, partial
           cds
          Length = 2179

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaa 227
           |||||||| ||||| || ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 17  atggacaagaagaaaaacatccggaatatgtccgtcattgcccatgtcgaccatggcaa 75



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           ||||| ||||| || || || |||||||||||||||||||| || || || ||||| || 
Sbjct: 290 atcaatcttatcgactctcccggccacgttgacttctcttctgaggtgacggctgccctg 349

                         
Query: 490 cgtatcactgatgg 503
           ||| ||||||||||
Sbjct: 350 cgtgtcactgatgg 363



to top

>gb|AY305496.1| Carcinoscorpius rotundicauda voucher Cro elongation factor-2 mRNA,
           partial cds
          Length = 1975

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 184 aatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           |||||||||||||||||||| ||||| ||||| ||||| || |||||
Sbjct: 32  aatatccgtaacatgtctgtcattgcccatgtagaccacggaaagtc 78



to top

>gb|AY310291.1| Stemmiulus insulanus voucher Stem elongation factor 2 mRNA, partial
           cds
          Length = 2185

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgct 486
           |||||||| | |||||||| || ||||||||||| || ||||| ||||| |||||||||
Sbjct: 288 tgatcaacttgattgattcgccgggccacgttgatttttcttcagaagtaacagctgct 346



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 325 gaacgtggtattacaatcaaatccacgggcatctct 360
           |||||| | |||||||||||||| |||| |||||||
Sbjct: 173 gaacgttgcattacaatcaaatcaacggccatctct 208



to top

>gb|AF213662.1|AF213662 Gelidium canariensis elongation factor 2 (EF2) gene, partial cds
          Length = 2295

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 436 cttattgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatc 495
           ||||||||||||||||| |||||||| ||  | || ||||| || || ||||||||| | 
Sbjct: 211 cttattgattcacctggtcacgttgattttacatctgaagttactgccgctcttcgtgtt 270

                      
Query: 496 actgatggtgc 506
           |||||||||||
Sbjct: 271 actgatggtgc 281



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 241 gattcccttgtggcagctgctgggattattgc 272
           ||||||||||| || |||||||| ||||||||
Sbjct: 22  gattcccttgtcgcggctgctggtattattgc 53



to top

>gb|AC150552.1| Drosophila melanogaster clone BACR12I17, complete sequence
          Length = 174573

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                          
Query: 187    atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
              ||||| ||||||||||| ||||| || || ||||| |||||||| || || || ||||||
Sbjct: 117644 atccgcaacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcc 117585

                    
Query: 247    cttgtg 252
              ||||||
Sbjct: 117584 cttgtg 117579



to top

>gb|AC146817.10| Medicago truncatula clone mth2-8c19, complete sequence
          Length = 114343

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 196   atgtctgttattgctcatgtcgacca 221
             ||||||||||||||||||||||||||
Sbjct: 62514 atgtctgttattgctcatgtcgacca 62539



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Plus

                                                                         
Query: 241   gattcccttgtggcagctgctgggattattgcccaggaagtagctggtgatgttcgcatg 300
             ||||||||||| || || ||||| ||||| || || || || ||||| |||||  | |||
Sbjct: 57757 gattcccttgttgctgccgctggaattatagcacaagaggttgctggagatgtcagaatg 57816

                                                                         
Query: 301   actgatacgcgtgcagacgaggcagaacgtggtattacaatcaaatccacgggcatctct 360
             || ||||| ||||| || || || ||||||||||| || ||||| ||||| || ||||||
Sbjct: 57817 acagatacccgtgctgatgaagctgaacgtggtatcactatcaagtccactggtatctct 57876

               
Query: 361   ct 362
             ||
Sbjct: 57877 ct 57878



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                         
Query: 135   ggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgtaa 194
             |||||||||||| || || ||| | ||| | ||||||||| | ||  |||| || |||||
Sbjct: 56682 ggtgaagtttacagctgatgagttacgtcggattatggactacaaacacaacattcgtaa 56741

                                           
Query: 195   catgtctgttattgctcatgtcgaccatgg 224
              |||||||||||||||||||| || |||||
Sbjct: 56742 tatgtctgttattgctcatgttgatcatgg 56771



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 70/85 (82%)
 Strand = Plus / Plus

                                                                         
Query: 419   atgagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtca 478
             ||||||| || || || ||||||||||| ||||| ||||| |||||||| || || || |
Sbjct: 57935 atgagtatctcattaatcttattgattcccctgggcacgtcgacttctcatccgaggtta 57994

                                      
Query: 479   cagctgctcttcgtatcactgatgg 503
             | ||||| ||||| || ||||||||
Sbjct: 57995 ctgctgcacttcgaattactgatgg 58019



to top

>gb|AY305489.1| Anopsobius neozelandicus voucher Ane elongation factor-2 mRNA,
           partial cds
          Length = 2185

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 448 cctggccacgttgacttctcttcggaagtcacagctgc 485
           ||||||||||||||||||||||| ||||| || |||||
Sbjct: 308 cctggccacgttgacttctcttccgaagtgacggctgc 345



to top

>gb|AY310285.1| Scutigera coleoptrata voucher Scol elongation factor 2 mRNA,
           partial cds
          Length = 1981

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 184 aatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctac 233
           ||||||||||| ||||| |||||||||||||| || ||||| || |||||
Sbjct: 32  aatatccgtaatatgtccgttattgctcatgtagatcatggtaaatctac 81



to top

>gb|AY310283.1| Rhysida nuda voucher Rnu elongation factor 2 mRNA, partial cds
          Length = 2110

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 436 cttattgattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           |||||||||||||| || |||||||||||||| || ||||| || |||||
Sbjct: 221 cttattgattcaccaggacacgttgacttctcctctgaagtaactgctgc 270



to top

>gb|AY310265.1| Phryssonotus sp. 'jump' elongation factor 2 mRNA, partial cds
          Length = 2185

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                     
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           |||||||||| || ||||| ||||||||||||||||| || || || || ||||||||
Sbjct: 288 tgatcaacctgatcgattcccctggccacgttgacttttcatctgaggtgacagctgc 345



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                       
Query: 167 ttatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggca 226
           |||||||||||||||| || ||||| ||||||||||| || || || || || ||||| |
Sbjct: 15  ttatggacaaaaagaaaaacatccgaaacatgtctgtgatagcccacgtggatcatggga 74

                     
Query: 227 agtctacgct 236
           | ||||||||
Sbjct: 75  aatctacgct 84



to top

>emb|X15805.1|DMEF2 Drosophila DMEF2 gene for the translation elongation factor 2
          Length = 2821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
           ||||| ||||||||||| ||||| || || ||||| |||||||| || || || ||||||
Sbjct: 127 atccgcaacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcc 186

                 
Query: 247 cttgtg 252
           ||||||
Sbjct: 187 cttgtg 192



to top

>gb|AF240831.1| Tanystylum orbiculare elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                     
Query: 167 ttatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
           |||||||||||||    |||||||||||||||||||| ||||| ||||| || |||||
Sbjct: 15  ttatggacaaaaaacggaatatccgtaacatgtctgtgattgcccatgttgatcatgg 72



to top

>gb|AF240820.1| Hutchinsoniella macracantha elongation factor-2 mRNA, partial cds
          Length = 1975

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| ||||  || |||||||||||||| || || ||||| || || |||||||||
Sbjct: 17  atggacaagaagaggaacatccgtaacatgtccgtcatcgctcacgtggatcatggcaag 76

                         
Query: 229 tctacgcttacgga 242
           || ||||| |||||
Sbjct: 77  tcaacgctcacgga 90



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctc 467
           ||||||||||||| |||||||| || ||||| || |||||
Sbjct: 288 tgatcaaccttatcgattcacccggtcacgtagatttctc 327



to top

>ref|NM_165395.1| Drosophila melanogaster Elongation factor 2b CG2238-RC, transcript
           variant C (Ef2b), mRNA
          Length = 2768

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
           ||||| ||||||||||| ||||| || || ||||| |||||||| || || || ||||||
Sbjct: 74  atccgcaacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcc 133

                 
Query: 247 cttgtg 252
           ||||||
Sbjct: 134 cttgtg 139



to top

>ref|NM_165394.1| Drosophila melanogaster Elongation factor 2b CG2238-RB, transcript
           variant B (Ef2b), mRNA
          Length = 2794

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
           ||||| ||||||||||| ||||| || || ||||| |||||||| || || || ||||||
Sbjct: 100 atccgcaacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcc 159

                 
Query: 247 cttgtg 252
           ||||||
Sbjct: 160 cttgtg 165



to top

>ref|NM_080366.2| Drosophila melanogaster Elongation factor 2b CG2238-RA, transcript
           variant A (Ef2b), mRNA
          Length = 2858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
           ||||| ||||||||||| ||||| || || ||||| |||||||| || || || ||||||
Sbjct: 164 atccgcaacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcc 223

                 
Query: 247 cttgtg 252
           ||||||
Sbjct: 224 cttgtg 229



to top

>gb|AY075481.1| Drosophila melanogaster RE38659 full length cDNA
          Length = 2823

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
           ||||| ||||||||||| ||||| || || ||||| |||||||| || || || ||||||
Sbjct: 166 atccgcaacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcc 225

                 
Query: 247 cttgtg 252
           ||||||
Sbjct: 226 cttgtg 231



to top

>gb|AC009254.8| Drosophila melanogaster, chromosome 2L, region 40A-40C, BAC clone
             BACR42E05, complete sequence
          Length = 175179

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                         
Query: 187   atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
             ||||| ||||||||||| ||||| || || ||||| |||||||| || || || ||||||
Sbjct: 67137 atccgcaacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcc 67078

                   
Query: 247   cttgtg 252
             ||||||
Sbjct: 67077 cttgtg 67072



to top

>gb|AF107289.1|AF107289 Candida tropicalis elongation factor 2 (EFT2) gene, partial cds
          Length = 2441

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 183 caatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
           |||| |||||||||||||||| |||||||| ||||| |||||
Sbjct: 5   caatgtccgtaacatgtctgtcattgctcacgtcgatcatgg 46



to top

>gb|AE003781.5| Drosophila melanogaster chromosome 2L, section 80 of 83 of the complete
              sequence
          Length = 323775

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                          
Query: 187    atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
              ||||| ||||||||||| ||||| || || ||||| |||||||| || || || ||||||
Sbjct: 138584 atccgcaacatgtctgtgattgcccacgtagaccacggcaagtccactctgaccgattcc 138525

                    
Query: 247    cttgtg 252
              ||||||
Sbjct: 138524 cttgtg 138519



to top

>gb|AY613900.1| Mesenchytraeus solifugus clone A195 translation elongation factor
           2-like mRNA, partial sequence
          Length = 935

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           |||||||| || || || || ||||||||||||||||| || ||||||| |||||| || 
Sbjct: 367 atcaacctcatcgactcccccggccacgttgacttctcatctgaagtcatagctgcactc 426

                            
Query: 490 cgtatcactgatggtgc 506
           ||| |||| || |||||
Sbjct: 427 cgtgtcacggacggtgc 443



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           |||||||||| ||| || |||||||||||||| || |||||
Sbjct: 119 cgtaacatgtgtgtcatcgctcatgtcgaccacggaaagtc 159



to top

>gb|AF534908.2| Tetrahymena thermophila elongation factor 2 gene, complete cds
          Length = 2609

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 182 acaatatccgtaacatgtctgttattgctcatgtcga 218
           ||||||||||||| ||||| ||||||||||| |||||
Sbjct: 50  acaatatccgtaatatgtcagttattgctcacgtcga 86



to top

>gb|BC070807.1| Xenopus laevis hypothetical protein MGC83880, mRNA (cDNA clone
           MGC:83880 IMAGE:6857103), complete cds
          Length = 1319

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttc 470
           |||||||| ||||| |||||||| || ||||||||||||||
Sbjct: 304 atcaacctcattgactcacctggacatgttgacttctcttc 344



to top

>gb|AY219033.1| Pichia pastoris elongation factor 2 (EF-2) gene, complete cds
          Length = 2735

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 454 cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||||||||||||||| || ||||| |||||||| ||| | ||||| |||||
Sbjct: 456 cacgttgacttctcttctgaggtcactgctgctctgcgtgttactgacggtgc 508



to top

>gb|U28373.1|YSCD9481 Saccharomyces cerevisiae chromosome IV cosmid 9481
          Length = 42133

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 190   cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
             ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 40645 cgtaacatgtccgttattgctcacgtcgatcatggtaagtc 40685



to top

>gb|AY305515.1| Orchesella imitari voucher OimA elongation factor-2 mRNA, partial
           cds
          Length = 640

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 478 acagctgctcttcgtatcactgatggtgc 506
           ||||||||||||||| |||||||||||||
Sbjct: 335 acagctgctcttcgtgtcactgatggtgc 363



to top

>gb|AY305513.1| Nebalia hessleri voucher Nhe elongation factor-2 mRNA, partial cds
          Length = 2176

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 184 aatatccgtaacatgtctgttattgctcatgtcgaccatgg 224
           |||||||||||||||||||| ||||| || || ||||||||
Sbjct: 32  aatatccgtaacatgtctgtgattgcccacgttgaccatgg 72



to top

>gb|AY310278.1| Polyzonium germanicum voucher Pge elongation factor 2 mRNA, partial
           cds
          Length = 1042

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                       
Query: 427 ctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgct 486
           |||||||| || || ||||| || |||||||| ||||||||||| ||||| || || |||
Sbjct: 212 ctgatcaatctgatcgattctccaggccacgtcgacttctcttccgaagtgactgccgct 271

                            
Query: 487 cttcgtatcactgatgg 503
           || ||  ||||||||||
Sbjct: 272 ctgcgcgtcactgatgg 288



to top

>gb|AY310269.1| Narceus americanus voucher Nam elongation factor 2 mRNA, partial
           cds
          Length = 2185

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcac 479
           ||||||||||| || |||||||||||||| ||||| |||||
Sbjct: 299 attgattcaccaggtcacgttgacttctcctcggaggtcac 339



to top

>emb|X94335.1|SC130KBXV S.cerevisiae 130kb DNA fragment from chromosome XV
          Length = 129528

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 190   cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
             ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 98679 cgtaacatgtccgttattgctcacgtcgatcatggtaagtc 98719



to top

>emb|X90518.1|SCXVORFS S.cerevisiae DNA of 51 Kb from chromosome XV right arm
          Length = 50984

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 190   cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
             ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 45552 cgtaacatgtccgttattgctcacgtcgatcatggtaagtc 45592



to top

>gb|AF240830.1| Tomocerus sp. 'Tom' elongation factor-2 mRNA, partial cds
          Length = 1975

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 158 tccgtggaattatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcg 217
           ||||||| || ||||||||||||   ||||||||||| ||||| || |||||||| ||||
Sbjct: 6   tccgtggcatgatggacaaaaagcggaatatccgtaatatgtccgtcattgctcacgtcg 65

            
Query: 218 a 218
           |
Sbjct: 66  a 66



to top

>gb|AF240816.1| Armadillidium vulgare elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgacca 221
           |||||||||||||  ||||| ||||| ||||| || ||||||||||| |||||
Sbjct: 17  atggacaaaaagaggaatattcgtaatatgtccgtcattgctcatgtagacca 69



to top

>gb|AY144817.1| Saccharomyces bayanus EFT2 gene, partial cds
          Length = 1249

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 58  cgtaacatgtccgttattgctcacgtcgatcatggtaagtc 98



to top

>gb|AF107290.1|AF107290 Candida lusitaniae elongation factor 2 (EFT2) gene, partial cds
          Length = 2441

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 454 cacgttgacttctcttcggaagtcacagctgct 486
           ||||||||||||||||| |||||||| ||||||
Sbjct: 276 cacgttgacttctcttctgaagtcactgctgct 308



to top

>gb|AF213663.1|AF213663 Euglena gracilis elongation factor 2 (EF2) gene, partial cds
          Length = 2367

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 454 cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||||||||||||||| || ||||| || || |||||  |||||||||||||
Sbjct: 223 cacgttgacttctcttctgaggtcactgcagcacttcgagtcactgatggtgc 275



to top

>dbj|AK110168.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-G01, full
           insert sequence
          Length = 2997

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 184 aatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggat 243
           ||||||||||||||||  ||||||||||| ||||| || || ||||| || ||||| || 
Sbjct: 211 aatatccgtaacatgttcgttattgctcacgtcgatcacggaaagtccacccttaccgac 270

                
Query: 244 tccct 248
           |||||
Sbjct: 271 tccct 275



to top

>emb|Z75041.1|SCYOR133W S.cerevisiae chromosome XV reading frame ORF YOR133w
          Length = 3733

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 325 cgtaacatgtccgttattgctcacgtcgatcatggtaagtc 365



to top

>gb|DQ332255.1| Synthetic construct Saccharomyces cerevisiae clone FLH202724.01X
           EFT1 gene, complete sequence
          Length = 2529

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 58  cgtaacatgtccgttattgctcacgtcgatcatggtaagtc 98



to top

>gb|U32274.1|SCD9509 Saccharomyces cerevisiae chromosome IV cosmids 9481, 9509, 9926,
            9461, and lambda 3641
          Length = 55359

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 190  cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
            ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 6027 cgtaacatgtccgttattgctcacgtcgatcatggtaagtc 6067



to top

>gb|M59370.1|YSCEFT2 S.cerevisiae translation elongation factor 2 (EFT2) gene, complete
           cds
          Length = 2932

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 458 cgtaacatgtccgttattgctcacgtcgatcatggtaagtc 498



to top

>gb|M59369.1|YSCEFT1 S.cerevisiae translation elongation factor 2 (EFT1) gene, complete
           cds
          Length = 2932

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           ||||||||||| ||||||||||| ||||| ||||| |||||
Sbjct: 458 cgtaacatgtccgttattgctcacgtcgatcatggtaagtc 498



to top

>dbj|AB082376.1| Pisum sativum mRNA for elongation factor EF-2, partial cds
          Length = 1480

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           |||||||| ||||| ||||||||||| || ||||| || || ||||| || ||||| |||
Sbjct: 107 attgattcccctgggcacgttgacttttcatcggaggttactgctgcactccgtattact 166

                
Query: 499 gatgg 503
           |||||
Sbjct: 167 gatgg 171



to top

>gb|BC063919.1| Xenopus tropicalis eukaryotic translation elongation factor 2, mRNA
           (cDNA clone MGC:76191 IMAGE:5335874), complete cds
          Length = 3021

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           ||||| || |||||||| || ||||| || || ||||| || |||||||||||| |||| 
Sbjct: 438 attgactcccctggccatgtagacttttcctctgaagtaactgctgctcttcgtgtcaca 497

                   
Query: 499 gatggtgc 506
           ||||||||
Sbjct: 498 gatggtgc 505



to top

>gb|BC084061.1| Xenopus tropicalis eukaryotic translation elongation factor 2, mRNA
           (cDNA clone MGC:79628 IMAGE:6979948), complete cds
          Length = 2966

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           ||||| || |||||||| || ||||| || || ||||| || |||||||||||| |||| 
Sbjct: 378 attgactcccctggccatgtagacttttcctctgaagtaactgctgctcttcgtgtcaca 437

                   
Query: 499 gatggtgc 506
           ||||||||
Sbjct: 438 gatggtgc 445



to top

>gb|AY702202.1| Loligo pealei elongation factor 2-like mRNA, partial sequence
          Length = 1015

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 451 ggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||||||||| ||||| || || || |||||||| |||||| | |||||||||||
Sbjct: 192 ggccacgttgatttctcctctgaggtgacagctgcccttcgtgttactgatggtgc 247



to top

>ref|NM_001961.3| Homo sapiens eukaryotic translation elongation factor 2 (EEF2),
           mRNA
          Length = 3163

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 120 atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 179

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 180 tccacgct 187



to top

>gb|BC044327.1| Xenopus laevis eukaryotic translation elongation factor 2, mRNA
           (cDNA clone MGC:53560 IMAGE:4681560), complete cds
          Length = 2946

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           ||||| || |||||||| || ||||| || || ||||| || |||||||||||| |||| 
Sbjct: 369 attgactcccctggccatgtggacttttcctctgaagtgactgctgctcttcgtgtcaca 428

                   
Query: 499 gatggtgc 506
           ||||||||
Sbjct: 429 gatggtgc 436



to top

>ref|XM_736543.1| Plasmodium chabaudi chabaudi elongation factor 2 (PC000371.03.0)
           partial mRNA
          Length = 1116

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           |||||| | ||||||||||| || ||||||||||| || || ||||| ||||||||
Sbjct: 280 atcaacttaattgattcaccaggacacgttgacttttcatcagaagttacagctgc 335



to top

>gb|BC006547.2| Homo sapiens eukaryotic translation elongation factor 2, mRNA (cDNA
           clone IMAGE:2963048), partial cds
          Length = 1818

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 105 atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 164

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 165 tccacgct 172



to top

>gb|AY305523.1| Thereuonema sp. JCR-2003 elongation factor-2 mRNA, partial cds
          Length = 2110

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           |||||||| || || ||||| || || ||||| ||||| ||||||||||| ||| | |||
Sbjct: 224 attgattctccaggacacgtggatttttcttcagaagtgacagctgctctccgtgttact 283

                   
Query: 499 gatggtgc 506
           ||||||||
Sbjct: 284 gatggtgc 291



to top

>gb|AY305514.1| Nicoletia meinerti voucher Nme elongation factor-2 mRNA, partial
           cds
          Length = 2179

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                   
Query: 184 aatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttac 239
           |||||||| ||||||||||| || || ||||| || ||||||||||| || |||||
Sbjct: 32  aatatccgcaacatgtctgtcatcgcccatgtggatcatggcaagtcaacacttac 87



to top

>gb|AY310297.1| Pseudopolydesmus serratus voucher Xys1 elongation factor 2 mRNA,
           partial cds
          Length = 316

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagc 482
           ||||||||||| || ||||| || |||||||| |||||||||||
Sbjct: 224 attgattcacccggtcacgtggatttctcttctgaagtcacagc 267



to top

>gb|AY310275.1| Uroblaniulus canadensis voucher Par2 elongation factor 2 mRNA,
           partial cds
          Length = 2185

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 451 ggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||||||||| || || || || || |||||||| |||||| | |||||||||||
Sbjct: 311 ggccacgttgatttttcatctgaggttacagctgcycttcgtgtsactgatggtgc 366



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| ||||| || |||||||||||||| || |||||
Sbjct: 17  atggacaagaagaagaacatccgtaacatgtccgtgattgc 57



to top

>gb|AY310273.1| Orthoporus ornata voucher Oor3 elongation factor 2 mRNA, partial
           cds
          Length = 316

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 442 gattcacctggccacgttgacttctcttcggaagtcacagctgc 485
           |||||||| ||||||||||||||||| || ||||| || |||||
Sbjct: 227 gattcaccaggccacgttgacttctcatcagaagtgactgctgc 270



to top

>emb|Z11692.1|HSEF2MR H.sapiens mRNA for elongation factor 2
          Length = 3080

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 37  atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 96

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 97  tccacgct 104



to top

>emb|X51466.1|HSEF2 Human mRNA for elongation factor 2
          Length = 3075

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 37  atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 96

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 97  tccacgct 104



to top

>ref|NM_203924.1| Xenopus tropicalis eukaryotic translation elongation factor 2
           (eef2), mRNA
          Length = 3021

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           ||||| || |||||||| || ||||| || || ||||| || |||||||||||| |||| 
Sbjct: 438 attgactcccctggccatgtagacttttcctctgaagtaactgctgctcttcgtgtcaca 497

                   
Query: 499 gatggtgc 506
           ||||||||
Sbjct: 498 gatggtgc 505



to top

>gb|AF240828.1| Scolopendra polymorpha elongation factor-2 mRNA, partial cds
          Length = 2185

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 42/48 (87%)
 Strand = Plus / Plus

                                                           
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgct 486
           |||||||||||||| || || || |||||||||||||| || ||||||
Sbjct: 299 attgattcacctggacatgtagatttctcttcggaagttaccgctgct 346



to top

>gb|AF240827.1| Scutigerella sp. 'Scu2' elongation factor-2 mRNA, partial cds
          Length = 2182

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 72/88 (81%)
 Strand = Plus / Plus

                                                                       
Query: 158 tccgtggaattatggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcg 217
           ||||||| || |||||||||  | | || ||||| |||||||| || ||||| || || |
Sbjct: 6   tccgtgggatgatggacaaacggcagaacatccgcaacatgtccgtcattgcccacgtag 65

                                       
Query: 218 accatggcaagtctacgcttacggattc 245
           | ||||||||||||||||| || |||||
Sbjct: 66  atcatggcaagtctacgctgacagattc 93



to top

>emb|CR859604.1| Pongo pygmaeus mRNA; cDNA DKFZp468K065 (from clone DKFZp468K065)
          Length = 3165

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 122 atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 181

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 182 tccacgct 189



to top

>emb|CR858745.1| Pongo pygmaeus mRNA; cDNA DKFZp468M076 (from clone DKFZp468M076)
          Length = 3177

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 120 atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 179

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 180 tccacgct 187



to top

>gb|AC011488.7| Homo sapiens chromosome 19 clone CTB-171N13, complete sequence
          Length = 134308

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                          
Query: 169    atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
              |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 133888 atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 133829

                      
Query: 229    tctacgct 236
              || |||||
Sbjct: 133828 tccacgct 133821



to top

>emb|CR318632.9| Zebrafish DNA sequence from clone CH211-113N10 in linkage group 5,
              complete sequence
          Length = 143278

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                          
Query: 169    atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
              ||||||||||||  ||| ||| | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 107551 atggacaaaaagtccaacatcaggaacatgtctgtgattgcccatgtggaccacggcaaa 107492

                                  
Query: 229    tctacgcttacggattccct 248
              || || || || ||||||||
Sbjct: 107491 tccactctcaccgattccct 107472



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 430    atcaaccttattgattcacctggccacgttgacttctc 467
              |||||||| ||||| ||||| || ||||||||||||||
Sbjct: 106812 atcaacctgattgactcaccgggacacgttgacttctc 106775



to top

>emb|CR598660.1| full-length cDNA clone CS0DK003YK05 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1002

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 106 atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 165

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 166 tccacgct 173



to top

>emb|CR596005.1| full-length cDNA clone CS0DC029YB08 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1142

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 28  atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 87

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 88  tccacgct 95



to top

>ref|XM_692874.1| PREDICTED: Danio rerio wu:fj53d02 (wu:fj53d02), mRNA
          Length = 3323

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           ||||||||||||  ||| ||| | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 131 atggacaaaaagtccaacatcaggaacatgtctgtgattgcccatgtggaccacggcaaa 190

                               
Query: 229 tctacgcttacggattccct 248
           || || || || ||||||||
Sbjct: 191 tccactctcaccgattccct 210



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 430 atcaaccttattgattcacctggccacgttgacttctc 467
           |||||||| ||||| ||||| || ||||||||||||||
Sbjct: 392 atcaacctgattgactcaccgggacacgttgacttctc 429



to top

>gb|AY144924.1| Saccharomyces castellii clone Contig1523 EFT gene, complete cds
          Length = 1368

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtctac 233
           ||||||||||| ||||||||||| ||||| ||||| || |||||
Sbjct: 58  cgtaacatgtccgttattgctcacgtcgatcatggtaaatctac 101



to top

>gb|AY942181.1| Homo sapiens elongation factor 2 mRNA, complete cds
          Length = 2582

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 37  atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 96

                   
Query: 229 tctacgct 236
           || |||||
Sbjct: 97  tccacgct 104



to top

>emb|CR848340.2| Xenopus tropicalis finished cDNA, clone TNeu054i17
          Length = 2890

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 439 attgattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcact 498
           ||||| || |||||||| || ||||| || || ||||| || |||||||||||| |||| 
Sbjct: 312 attgactcccctggccatgtagacttttcctctgaagtaactgctgctcttcgtgtcaca 371

                   
Query: 499 gatggtgc 506
           ||||||||
Sbjct: 372 gatggtgc 379



to top

>gb|AC016586.9| Homo sapiens chromosome 19 clone CTD-2622I13, complete sequence
          Length = 205642

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 169  atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
            |||||||| |||  ||| ||||| ||||||||||| || || || || ||||||||||||
Sbjct: 9354 atggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaag 9295

                    
Query: 229  tctacgct 236
            || |||||
Sbjct: 9294 tccacgct 9287



to top

>ref|XM_454080.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E02926g predicted mRNA
          Length = 2529

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                              
Query: 183 caatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctac 233
           |||| ||||||||||||| |||||||| || ||||| || || ||||||||
Sbjct: 51  caatgtccgtaacatgtccgttattgcccacgtcgatcacggtaagtctac 101



to top

>gb|BC059523.1| Danio rerio wu:fj53d02, mRNA (cDNA clone IMAGE:4200691), partial
           cds
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctct 488
           |||||||| ||||| ||||| || |||||||||||||| || || || ||||| |||||
Sbjct: 358 atcaacctgattgactcaccgggacacgttgacttctcctctgaggtgacagcagctct 416



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                       
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
           ||||||||||||  ||| ||| | ||||||||||| || || ||||| ||||| ||||| 
Sbjct: 97  atggacaaaaagtccaacatcaggaacatgtctgtgatcgcccatgtggaccacggcaaa 156

                               
Query: 229 tctacgcttacggattccct 248
           || || || || ||||||||
Sbjct: 157 tccactctcactgattccct 176



to top

>ref|XM_811751.1| Trypanosoma cruzi strain CL Brener elongation factor
           (Tc00.1047053504109.150) partial mRNA
          Length = 1938

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 205 attgctcatgtcgaccatggcaa 227
           |||||||||||||||||||||||
Sbjct: 106 attgctcatgtcgaccatggcaa 128



to top

>gb|AY305501.1| Hanseniella sp. JCR-2003 elongation factor-2 mRNA, partial cds
          Length = 2107

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 61/79 (77%)
 Strand = Plus / Plus

                                                                       
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctc 487
           |||||||| | ||||| || || || || ||||| ||||| || || || || |||||||
Sbjct: 213 tgatcaacttrattgaytctccaggycaygttgatttctcmtctgaggtgacrgctgctc 272

                              
Query: 488 ttcgtatcactgatggtgc 506
           | ||  | |||||||| ||
Sbjct: 273 tycgwgtsactgatggwgc 291



to top

>ref|XM_499612.1| Yarrowia lipolytica CLIB122, YALI0A00352g predicted mRNA
          Length = 2529

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 421 gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcac 479
           |||| |||| ||||||| ||||| || || || ||||||||||||||||| || |||||
Sbjct: 289 gagttcctggtcaacctgattgactcccccggtcacgttgacttctcttccgaggtcac 347



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2234072

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 183    caatatccgtaacatgtctgttattgctcatgtcgaccatggcaagtctac 233
              |||| ||||||||||||| |||||||| || ||||| || || ||||||||
Sbjct: 274145 caatgtccgtaacatgtccgttattgcccacgtcgatcacggtaagtctac 274195



to top

>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 324     agaacgtggtattacaatcaaat 346
               |||||||||||||||||||||||
Sbjct: 1645797 agaacgtggtattacaatcaaat 1645775



to top

>gb|AF240819.1| Endeis laevis elongation factor-2 mRNA, partial cds
          Length = 2107

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 472 gaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||| ||||||||||||||| | |||||||||||
Sbjct: 257 gaagtaacagctgctcttcgtgtgactgatggtgc 291



to top

>emb|CR558303.7| Zebrafish DNA sequence from clone CH211-183C15 in linkage group 13,
              complete sequence
          Length = 155098

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                         
Query: 430    atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctct 488
              |||||||| ||||| ||||| || |||||||||||||| || || || ||||| |||||
Sbjct: 132533 atcaacctgattgactcaccgggacacgttgacttctcctctgaggtgacagcagctct 132475



 Score = 40.1 bits (20), Expect = 6.9
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                          
Query: 169    atggacaaaaagaacaatatccgtaacatgtctgttattgctcatgtcgaccatggcaag 228
              ||||||||||||  ||| ||| | ||||||||||| || || ||||| ||||| ||||| 
Sbjct: 133270 atggacaaaaagtccaacatcaggaacatgtctgtgatcgcccatgtggaccacggcaaa 133211

                                  
Query: 229    tctacgcttacggattccct 248
              || || || || ||||||||
Sbjct: 133210 tccactctcactgattccct 133191



to top

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 324     agaacgtggtattacaatcaaat 346
               |||||||||||||||||||||||
Sbjct: 1696905 agaacgtggtattacaatcaaat 1696883



to top

>ref|XM_631629.1| Dictyostelium discoideum AX4 elongation factor 2 (DDB0191363),
           partial mRNA
          Length = 2520

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 196 atgtctgttattgctcatgtcga 218
           |||||||||||||||||||||||
Sbjct: 64  atgtctgttattgctcatgtcga 86



to top

>gb|CP000046.1| Staphylococcus aureus subsp. aureus COL, complete genome
          Length = 2809422

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 324     agaacgtggtattacaatcaaat 346
               |||||||||||||||||||||||
Sbjct: 1673550 agaacgtggtattacaatcaaat 1673528



to top

>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 324     agaacgtggtattacaatcaaat 346
               |||||||||||||||||||||||
Sbjct: 1599590 agaacgtggtattacaatcaaat 1599568



to top

>gb|CP000255.1| Staphylococcus aureus subsp. aureus USA300, complete genome
          Length = 2872769

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 324     agaacgtggtattacaatcaaat 346
               |||||||||||||||||||||||
Sbjct: 1696387 agaacgtggtattacaatcaaat 1696365



to top

>gb|AY144999.1| Saccharomyces kluyveri clone Contig1706 EFT2 gene, complete cds
          Length = 2529

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 428 tgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgct 486
           |||||||| | || ||||| || || ||||||||||||||||| ||||| || ||||||
Sbjct: 296 tgatcaacttgatcgattctccaggtcacgttgacttctcttctgaagttactgctgct 354



to top

>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 324     agaacgtggtattacaatcaaat 346
               |||||||||||||||||||||||
Sbjct: 1666145 agaacgtggtattacaatcaaat 1666123



to top

>dbj|AK187829.1| Mus musculus cDNA, clone:Y0G0143C24, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 163

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           |||||||| || || || ||||| ||||| |||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcccatgtggaccacggcaagtccacgctgaccgactcccttgtg 63

              
Query: 253 gca 255
           |||
Sbjct: 64  gca 66



to top

>dbj|BA000018.3| Staphylococcus aureus subsp. aureus N315 genomic DNA, complete genome
          Length = 2814816

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 324     agaacgtggtattacaatcaaat 346
               |||||||||||||||||||||||
Sbjct: 1620494 agaacgtggtattacaatcaaat 1620472



to top

>emb|BX571856.1| Staphylococcus aureus subsp. aureus strain MRSA252, complete genome
          Length = 2902619

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 324     agaacgtggtattacaatcaaat 346
               |||||||||||||||||||||||
Sbjct: 1731184 agaacgtggtattacaatcaaat 1731162



to top

>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 324     agaacgtggtattacaatcaaat 346
               |||||||||||||||||||||||
Sbjct: 1575646 agaacgtggtattacaatcaaat 1575624



to top

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia
             lipolytica
          Length = 2303261

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                        
Query: 421   gagtacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcac 479
             |||| |||| ||||||| ||||| || || || ||||||||||||||||| || |||||
Sbjct: 38009 gagttcctggtcaacctgattgactcccccggtcacgttgacttctcttccgaggtcac 38067



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 190     cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
               ||||| |||||||||||||| || || || |||||||||||
Sbjct: 2170100 cgtaatatgtctgttattgcgcacgttgatcatggcaagtc 2170060



to top

>gb|M26017.1|DDIEF2 D.discoideum elongation factor 2 mRNA, complete cds
          Length = 2755

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 196 atgtctgttattgctcatgtcga 218
           |||||||||||||||||||||||
Sbjct: 292 atgtctgttattgctcatgtcga 314



to top

>dbj|D79219.1|BLAPEF2 Blastocystis hominis mRNA for peptide elongation factor 2, complete
           cds
          Length = 2631

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 424 tacctgatcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagct 483
           |||||||||||||| || ||||| || || ||||| |||||||| || || ||||| |||
Sbjct: 345 tacctgatcaacctgatcgattctccgggacacgtcgacttctcgtctgaggtcacggct 404

                                  
Query: 484 gctcttcgtatcactgatggtgc 506
              |||||| | |||||||||||
Sbjct: 405 agccttcgtgtgactgatggtgc 427



to top

>ref|XM_631959.1| Dictyostelium discoideum elongation factor 2 (DDB0216236), partial
           mRNA
          Length = 2562

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 196 atgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattc 245
           |||||||||||||||||||| || ||||| ||  |||| ||||| |||||
Sbjct: 64  atgtctgttattgctcatgttgatcatggtaaaactactcttactgattc 113



to top

>gb|DQ443396.1| Bombyx mori translation elongation factor 2 mRNA, complete cds
          Length = 3060

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 79/98 (80%)
 Strand = Plus / Plus

                                                                       
Query: 133 atggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccgt 192
           |||||||| || || | ||| ||| ||||||| || |||||||| |||   |||||||| 
Sbjct: 104 atggtgaatttcacggtagacgagatccgtgggatgatggacaagaagcggaatatccgc 163

                                                 
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtc 230
           ||||||||||| || || || ||||| || ||||||||
Sbjct: 164 aacatgtctgtgatcgcccacgtcgatcacggcaagtc 201



to top

>gb|AY310258.1| Glomeridesmus trinidadensis voucher Gtri elongation factor 2 mRNA,
           partial cds
          Length = 2185

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 428 tgatcaaccttattgattcacctggccacgttga 461
           ||||||| ||||||||||| |||||||| |||||
Sbjct: 288 tgatcaatcttattgattcccctggccatgttga 321



to top

>gb|AF240818.1| Eumesocampa frigilis elongation factor-2 mRNA, partial cds
          Length = 2179

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 196 atgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtggca 255
           |||||||| ||||||||||| || |||||||| || || || || || ||||| ||| ||
Sbjct: 44  atgtctgtcattgctcatgttgatcatggcaaatccactctcacagactccctggtgtca 103

                             
Query: 256 gctgctgggattattgcc 273
              |||||||||||||||
Sbjct: 104 aaagctgggattattgcc 121



to top

>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome
          Length = 2679306

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 205     attgctcatgtcgaccatggcaagtc 230
               ||||| ||||||||||||||||||||
Sbjct: 2133359 attgcccatgtcgaccatggcaagtc 2133384



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
              complete sequence
          Length = 1813164

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                                
Query: 190    cgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttac 239
              ||||||||||| || ||||| || |||||||| || ||||| ||||||||
Sbjct: 697928 cgtaacatgtccgtgattgcgcacgtcgaccacggtaagtcgacgcttac 697879



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 454    cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
              ||||||||||||||||| || || || || ||||| ||| ||||||| |||||
Sbjct: 697664 cacgttgacttctcttctgaggttaccgccgctctacgtgtcactgacggtgc 697612



to top

>ref|NM_211043.1| Eremothecium gossypii AFR142Cp (AFR142C), mRNA
          Length = 2529

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttac 239
           ||||||||||| || ||||| || |||||||| || ||||| ||||||||
Sbjct: 58  cgtaacatgtccgtgattgcgcacgtcgaccacggtaagtcgacgcttac 107



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 454 cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           ||||||||||||||||| || || || || ||||| ||| ||||||| |||||
Sbjct: 322 cacgttgacttctcttctgaggttaccgccgctctacgtgtcactgacggtgc 374



to top

>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                         
Query: 424     tacctgatcaaccttattgattcacctggccacgttgacttc 465
               ||||||||||||||||| ||  |||| || ||||||||||||
Sbjct: 2692621 tacctgatcaaccttatagacacaccgggtcacgttgacttc 2692580



to top

>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome
          Length = 2519802

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 205     attgctcatgtcgaccatggcaagtc 230
               ||||| ||||||||||||||||||||
Sbjct: 1505247 attgcccatgtcgaccatggcaagtc 1505272



to top

>ref|XM_481784.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2043

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 54 cctccccgccggatcgggacg 74
          |||||||||||||||||||||
Sbjct: 94 cctccccgccggatcgggacg 74



to top

>gb|AY020355.1| Oryza sativa microsatellite MRG2680 containing (GA)X14, genomic
          sequence
          Length = 228

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 26 cttctccgccgccgcttcctc 46
          |||||||||||||||||||||
Sbjct: 78 cttctccgccgccgcttcctc 58



to top

>gb|AY017820.1| Oryza sativa microsatellite MRG0145 containing (AG)X12, genomic
           sequence
          Length = 224

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 26  cttctccgccgccgcttcctc 46
           |||||||||||||||||||||
Sbjct: 166 cttctccgccgccgcttcctc 146



to top

>ref|XM_570549.1| Cryptococcus neoformans var. neoformans JEC21 translation
           elongation factor 2 (CND06220) partial mRNA
          Length = 2726

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 454 cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           |||||||||||||| || ||||| || || ||||| ||| ||||||| |||||
Sbjct: 477 cacgttgacttctcctctgaagttaccgccgctctccgtgtcactgacggtgc 529



to top

>ref|XM_720710.1| Plasmodium yoelii yoelii str. 17XNL elongation factor 2 (PY05356)
           partial mRNA
          Length = 2499

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagc 482
           |||||| | ||||||||||| || ||||||||||| || || ||||| |||||
Sbjct: 280 atcaacttaattgattcaccaggacacgttgacttttcatcagaagttacagc 332



to top

>gb|AC123541.3| Oryctolagus cuniculus clone LB1-184A7, complete sequence
          Length = 190901

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 243   ttcccttgtggcagctgctgg 263
             |||||||||||||||||||||
Sbjct: 53190 ttcccttgtggcagctgctgg 53170



to top

>emb|CR656790.2|CNS0F5R0 Tetraodon nigroviridis full-length cDNA
          Length = 216

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 35  atggacaagaaggccaacatccgtaacatgtctgtgattgc 75



to top

>ref|XM_673005.1| Plasmodium berghei strain ANKA elongation factor 2 (PB000800.00.0)
           partial mRNA
          Length = 2499

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagc 482
           |||||| | ||||||||||| || ||||||||||| || || ||||| |||||
Sbjct: 280 atcaacttaattgattcaccagggcacgttgacttttcatcagaagttacagc 332



to top

>emb|CR655050.1|CNS0F4EO Tetraodon nigroviridis full-length cDNA
          Length = 1146

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 169 atggacaaaaagaacaatatccgtaacatgtctgttattgc 209
           |||||||| |||  ||| ||||||||||||||||| |||||
Sbjct: 121 atggacaagaaggccaacatccgtaacatgtctgtgattgc 161



to top

>gb|AY305492.1| Bothropolys multidentatus voucher Bmu elongation factor-2 mRNA,
           partial cds
          Length = 2185

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 324 agaacgtggtattacaatcaaatccacgg 352
           ||||||| |||||||||||||||| ||||
Sbjct: 172 agaacgttgtattacaatcaaatcaacgg 200



to top

>ref|XM_500274.1| Yarrowia lipolytica CLIB122, YALI0A20152g predicted mRNA
          Length = 2529

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 190 cgtaacatgtctgttattgctcatgtcgaccatggcaagtc 230
           ||||| |||||||||||||| || || || |||||||||||
Sbjct: 58  cgtaatatgtctgttattgcgcacgttgatcatggcaagtc 98



to top

>emb|X71439.1|GMFUSA G.max gene fusA
          Length = 3809

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 429  gatcaaccttattgattcacctggccacgttgacttc 465
            ||||||| |||||||| | ||||| ||||||||||||
Sbjct: 984  gatcaacattattgatacccctggtcacgttgacttc 1020



to top

>gb|AF240834.1| Nereis virens elongation factor-2 mRNA, partial cds
          Length = 1969

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 187 atccgtaacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcc 246
           ||||||||||||||||| || ||||| || || || ||||| ||||| || || || |||
Sbjct: 35  atccgtaacatgtctgtgatcgctcacgttgatcacggcaaatctacactgactgactcc 94

                
Query: 247 cttgt 251
           |||||
Sbjct: 95  cttgt 99



to top

>gb|AF240829.1| Speleonectes tulumensis elongation factor-2 mRNA, partial cds
          Length = 1912

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 439 attgattcacctggccacgttgacttctc 467
           |||||||| ||||| ||||||||||||||
Sbjct: 236 attgattctcctggtcacgttgacttctc 264



to top

>emb|AL590605.1|SPAPB1E7 S.pombe chromosome I BAC pB1E7
          Length = 41788

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 148   gcagaggagctccgtggaattatgg 172
             ||||| |||||||||||||||||||
Sbjct: 25275 gcagaagagctccgtggaattatgg 25299



to top

>emb|AL109734.1|SPAPYUK71 S.pombe chromosome I plasmid pYUK71
          Length = 8821

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 454  cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
            ||||||||||| ||||| || || || || ||||||||| ||||||| |||||
Sbjct: 8588 cacgttgacttttcttctgaggttactgccgctcttcgtgtcactgacggtgc 8536



to top

>gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete genome
          Length = 859006

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 437    ttattgattcacctggccacgttga 461
              |||||||| ||||||||||||||||
Sbjct: 608425 ttattgatacacctggccacgttga 608401



to top

>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold
          Length = 1889755

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 243     ttcccttgtggcagctgctgg 263
               |||||||||||||||||||||
Sbjct: 1752044 ttcccttgtggcagctgctgg 1752024



to top

>dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA, complete
               genome
          Length = 2516575

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 324     agaacgtggtattacaatcaa 344
               |||||||||||||||||||||
Sbjct: 2266113 agaacgtggtattacaatcaa 2266093



to top

>ref|NM_001019557.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPAPB1E7.07),
            partial mRNA
          Length = 6336

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 148  gcagaggagctccgtggaattatgg 172
            ||||| |||||||||||||||||||
Sbjct: 3697 gcagaagagctccgtggaattatgg 3721



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 54       cctccccgccggatcgggacg 74
                |||||||||||||||||||||
Sbjct: 15487138 cctccccgccggatcgggacg 15487118



to top

>gb|AF248644.1|AF248644 Filobasidiella neoformans var. neoformans translation elongation
           factor 2 mRNA, complete cds
          Length = 2729

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 454 cacgttgacttctcttcggaagtcacagctgctcttcgtatcactgatggtgc 506
           |||||||||||||| || ||||| || || ||||| ||| ||||||| |||||
Sbjct: 463 cacgttgacttctcctctgaagttaccgccgctctccgtgtcactgacggtgc 515



to top

>gb|AY010233.1| Botryocladia uvarioides elongation factor 2 (EF2) gene, partial cds
          Length = 2319

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 442 gattcacctggccacgttgacttctcttcggaagtcacagctgctcttcgtatcactgat 501
           |||||||| || || || |||||||| || || || || || ||||||||| ||||||||
Sbjct: 229 gattcaccaggacatgtcgacttctcgtcagaggttactgccgctcttcgtgtcactgat 288

                
Query: 502 ggtgc 506
           |||||
Sbjct: 289 ggtgc 293



to top

>gb|AF269681.1|AF269681 Staphylococcus epidermidis strain SR1 clone step.1017a11 genomic
           sequence
          Length = 2997

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 324 agaacgtggtattacaatcaa 344
           |||||||||||||||||||||
Sbjct: 759 agaacgtggtattacaatcaa 739



to top

>gb|AF213661.1|AF213661 Chondrus crispus elongation factor 2 (EF2) gene, partial cds
          Length = 2295

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 63/77 (81%)
 Strand = Plus / Plus

                                                                       
Query: 430 atcaaccttattgattcacctggccacgttgacttctcttcggaagtcacagctgctctt 489
           |||||||| || ||||| || |||||||||||||| || || || ||||| || || |||
Sbjct: 202 atcaacctaatcgattcgccgggccacgttgacttttcctccgaggtcaccgcagcactt 261

                            
Query: 490 cgtatcactgatggtgc 506
           ||  ||| |||||||||
Sbjct: 262 cgcgtcattgatggtgc 278



to top

>dbj|AK183389.1| Mus musculus cDNA, clone:Y0G0125L11, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000047864, based on BLAT search
          Length = 418

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 50/60 (83%)
 Strand = Plus / Plus

                                                                       
Query: 193 aacatgtctgttattgctcatgtcgaccatggcaagtctacgcttacggattcccttgtg 252
           |||||||| || || || ||||| ||||| |||||||| ||||| || || |||||||||
Sbjct: 4   aacatgtcagtcatcgcacatgtggaccanggcaagtccacgctgaccgactcccttgtg 63



to top

>dbj|AP006844.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0052K15
          Length = 156250

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 26    cttctccgccgccgcttcctc 46
             |||||||||||||||||||||
Sbjct: 54003 cttctccgccgccgcttcctc 53983



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 26    cttctccgccgccgcttcctc 46
             |||||||||||||||||||||
Sbjct: 53912 cttctccgccgccgcttcctc 53892



to top

>dbj|AP005476.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0026D20
          Length = 130634

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 42    tcctcatctcatcctccccgc 62
             |||||||||||||||||||||
Sbjct: 40581 tcctcatctcatcctccccgc 40601



to top

>gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome
          Length = 2616530

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 324    agaacgtggtattacaatcaa 344
              |||||||||||||||||||||
Sbjct: 197458 agaacgtggtattacaatcaa 197478



to top

>dbj|AP004645.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1119_B10
          Length = 148508

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 54    cctccccgccggatcgggacg 74
             |||||||||||||||||||||
Sbjct: 34896 cctccccgccggatcgggacg 34876



to top

>dbj|AK102586.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033098E24, full
           insert sequence
          Length = 2849

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 84/105 (80%)
 Strand = Plus / Plus

                                                                       
Query: 132 gatggtgaagtttactgcagaggagctccgtggaattatggacaaaaagaacaatatccg 191
           |||||||| |||||| || ||||||||||| |  |  ||||| || ||| |||| |||||
Sbjct: 68  gatggtgaggtttacggcggaggagctccgcgcgagcatggataagaaggacaacatccg 127

                                                        
Query: 192 taacatgtctgttattgctcatgtcgaccatggcaagtctacgct 236
            ||||||||||| || || || || || ||||| ||||| |||||
Sbjct: 128 gaacatgtctgtgatcgcgcacgttgatcatgggaagtcgacgct 172


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,064,591
Number of Sequences: 3902068
Number of extensions: 5064591
Number of successful extensions: 76858
Number of sequences better than 10.0: 308
Number of HSP's better than 10.0 without gapping: 306
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 75683
Number of HSP's gapped (non-prelim): 1163
length of query: 506
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 484
effective length of database: 17,147,199,772
effective search space: 8299244689648
effective search space used: 8299244689648
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top