ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bastl01c11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_183904.1| Oryza sativa (japonica cultivar-group), predic... 42 1.6
2gb|BC016250.1| Mus musculus CDC42 effector protein (Rho GTPase b... 42 1.6
3gb|BC083130.1| Mus musculus CDC42 effector protein (Rho GTPase b... 42 1.6
4gb|AE009116.1| Agrobacterium tumefaciens str. C58 circular chrom... 42 1.6
5ref|NM_027219.1| Mus musculus CDC42 effector protein (Rho GTPase... 42 1.6
6emb|AL139140.11| Human DNA sequence from clone RP5-1071P19 on ch... 42 1.6
7gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome 42 1.6
8dbj|AK007896.1| Mus musculus 10 day old male pancreas cDNA, RIKE... 42 1.6
9dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
10dbj|AP003208.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
11dbj|AK068195.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
12emb|AL592169.14| Mouse DNA sequence from clone RP23-305P10 on ch... 42 1.6
13gb|AC153386.3| Mus musculus 6 BAC RP23-198D7 (Roswell Park Cance... 40 6.3
14gb|L21703.1| Paralabrax nebulifer complement regulatory plasma p... 40 6.3
15ref|XM_359530.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.3
16emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 6.3
17gb|AC124689.5| Mus musculus BAC clone RP24-147N6 from chromosome... 40 6.3
18ref|XM_761403.1| Theileria parva strain Muguga chromosome 1 DNA-... 40 6.3
19emb|AL035420.15|HS550H1 Human DNA sequence from clone RP4-550H1 ... 40 6.3
20emb|X94349.1|CSPBT Colpoda sp. gene encoding for beta-tubulin, p... 40 6.3
21emb|AL627362.2|CNS07TIX DNA centromeric region sequence from BAC... 40 6.3
22emb|AJ620355.1| Rubus idaeus partial pgip1 gene for putative pol... 40 6.3
23emb|AJ620336.1| Rubus idaeus mRNA for putative polygalacturonase... 40 6.3
24gb|AC126778.9| Medicago truncatula clone mth2-32j21, complete se... 40 6.3
25gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 6.3
26emb|AL844221.6| Mouse DNA sequence from clone RP23-445C3 on chro... 40 6.3
27emb|AL714007.10| Mouse DNA sequence from clone RP23-295M3 on chr... 40 6.3

>ref|NM_183904.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2478

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 383 cgacatcgaggactggatcga 403
           |||||||||||||||||||||
Sbjct: 228 cgacatcgaggactggatcga 248



to top

>gb|BC016250.1| Mus musculus CDC42 effector protein (Rho GTPase binding) 1, mRNA
           (cDNA clone MGC:28884 IMAGE:4910994), complete cds
          Length = 2548

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 70  ccttctcagccccttcctctc 90
           |||||||||||||||||||||
Sbjct: 255 ccttctcagccccttcctctc 235



to top

>gb|BC083130.1| Mus musculus CDC42 effector protein (Rho GTPase binding) 1, mRNA
           (cDNA clone MGC:103067 IMAGE:6441478), complete cds
          Length = 2547

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 70  ccttctcagccccttcctctc 90
           |||||||||||||||||||||
Sbjct: 260 ccttctcagccccttcctctc 240



to top

>gb|AE009116.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 142
            of 256 of the complete sequence
          Length = 11559

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 402  gatcagatgccggtgatgcca 422
            |||||||||||||||||||||
Sbjct: 8878 gatcagatgccggtgatgcca 8898



to top

>ref|NM_027219.1| Mus musculus CDC42 effector protein (Rho GTPase binding) 1
           (Cdc42ep1), mRNA
          Length = 2543

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 70  ccttctcagccccttcctctc 90
           |||||||||||||||||||||
Sbjct: 268 ccttctcagccccttcctctc 248



to top

>emb|AL139140.11| Human DNA sequence from clone RP5-1071P19 on chromosome 1p34.1-34.3
             Contains part of the CSMD2 gene for CUB and Sushi multiple
             domains 2, complete sequence
          Length = 78229

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 74    ctcagccccttcctctcgtct 94
             |||||||||||||||||||||
Sbjct: 57909 ctcagccccttcctctcgtct 57929



to top

>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome
          Length = 2841581

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 402     gatcagatgccggtgatgcca 422
               |||||||||||||||||||||
Sbjct: 1575382 gatcagatgccggtgatgcca 1575402



to top

>dbj|AK007896.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length
           enriched library, clone:1810058K22 product:similar to
           SERUM CONSTITUENT PROTEIN [Homo sapiens], full insert
           sequence
          Length = 2543

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 70  ccttctcagccccttcctctc 90
           |||||||||||||||||||||
Sbjct: 268 ccttctcagccccttcctctc 248



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 383      cgacatcgaggactggatcga 403
                |||||||||||||||||||||
Sbjct: 13127437 cgacatcgaggactggatcga 13127417



to top

>dbj|AP003208.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1158F07
          Length = 139491

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 383    cgacatcgaggactggatcga 403
              |||||||||||||||||||||
Sbjct: 103158 cgacatcgaggactggatcga 103138



to top

>dbj|AK068195.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013146B15, full
           insert sequence
          Length = 2761

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 383 cgacatcgaggactggatcga 403
           |||||||||||||||||||||
Sbjct: 385 cgacatcgaggactggatcga 405



to top

>emb|AL592169.14| Mouse DNA sequence from clone RP23-305P10 on chromosome 15, complete
             sequence
          Length = 161985

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    ccttctcagccccttcctctc 90
             |||||||||||||||||||||
Sbjct: 77704 ccttctcagccccttcctctc 77724



to top

>gb|AC153386.3| Mus musculus 6 BAC RP23-198D7 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 170561

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 445    atttagaagaggaagtgaaa 464
              ||||||||||||||||||||
Sbjct: 158323 atttagaagaggaagtgaaa 158342



to top

>gb|L21703.1| Paralabrax nebulifer complement regulatory plasma protein mRNA,
            complete cds
          Length = 3377

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 392  ggactggatcgatcagatgc 411
            ||||||||||||||||||||
Sbjct: 3020 ggactggatcgatcagatgc 3039



to top

>ref|XM_359530.1| Magnaporthe grisea 70-15 hypothetical protein (MG05247.4) partial
           mRNA
          Length = 3138

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 377 ggtcttcgacatcgaggact 396
           ||||||||||||||||||||
Sbjct: 765 ggtcttcgacatcgaggact 784



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 400     tcgatcagatgccggtgatgccaa 423
               ||||||||||| ||||||||||||
Sbjct: 3503543 tcgatcagatggcggtgatgccaa 3503520



to top

>gb|AC124689.5| Mus musculus BAC clone RP24-147N6 from chromosome 6, complete sequence
          Length = 187752

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 445    atttagaagaggaagtgaaa 464
              ||||||||||||||||||||
Sbjct: 134991 atttagaagaggaagtgaaa 134972



to top

>ref|XM_761403.1| Theileria parva strain Muguga chromosome 1 DNA-directed RNA
           polymerase (TP01_0975) partial mRNA
          Length = 3678

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 439 cactggatttagaagaggaa 458
           ||||||||||||||||||||
Sbjct: 974 cactggatttagaagaggaa 993



to top

>emb|AL035420.15|HS550H1 Human DNA sequence from clone RP4-550H1 on chromosome 20q11.1-11.22
             Contains a high mobility group protein pseudogene, three
             novel genes, the 5' end of the EPB41L1 gene for
             Erythrocyte membrane protein band 4.1-like 1 protein and
             three CpG islands, complete sequence
          Length = 108803

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 438   acactggatttagaagagga 457
             ||||||||||||||||||||
Sbjct: 74476 acactggatttagaagagga 74495



to top

>emb|X94349.1|CSPBT Colpoda sp. gene encoding for beta-tubulin, partial
          Length = 1172

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 383 cgacatcgaggactggatcgatca 406
           ||||||||||||||| ||||||||
Sbjct: 301 cgacatcgaggactgaatcgatca 278



to top

>emb|AL627362.2|CNS07TIX DNA centromeric region sequence from BAC DP15B03, DP38F06 of chromosome
             5 of Podospora anserina
          Length = 156244

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 350   agtgtggatgaagatggtga 369
             ||||||||||||||||||||
Sbjct: 96814 agtgtggatgaagatggtga 96795



to top

>emb|AJ620355.1| Rubus idaeus partial pgip1 gene for putative
           polygalacturonase-inhibiting protein, exons 1-2
          Length = 990

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 tgaagatggtgagggagttg 377
           ||||||||||||||||||||
Sbjct: 103 tgaagatggtgagggagttg 84



to top

>emb|AJ620336.1| Rubus idaeus mRNA for putative polygalacturonase-inhibiting protein
           (pgip1 gene)
          Length = 1254

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 tgaagatggtgagggagttg 377
           ||||||||||||||||||||
Sbjct: 260 tgaagatggtgagggagttg 241



to top

>gb|AC126778.9| Medicago truncatula clone mth2-32j21, complete sequence
          Length = 110448

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   aggattgctccattgtaact 263
             ||||||||||||||||||||
Sbjct: 87626 aggattgctccattgtaact 87645



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 376     tggtcttcgacatcgaggac 395
               ||||||||||||||||||||
Sbjct: 3506316 tggtcttcgacatcgaggac 3506297



to top

>emb|AL844221.6| Mouse DNA sequence from clone RP23-445C3 on chromosome X, complete
             sequence
          Length = 188627

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 449   agaagaggaagtgaaaatat 468
             ||||||||||||||||||||
Sbjct: 21962 agaagaggaagtgaaaatat 21943



to top

>emb|AL714007.10| Mouse DNA sequence from clone RP23-295M3 on chromosome X, complete
             sequence
          Length = 146552

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 445   atttagaagaggaagtgaaa 464
             ||||||||||||||||||||
Sbjct: 71105 atttagaagaggaagtgaaa 71124


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,520,947
Number of Sequences: 3902068
Number of extensions: 3520947
Number of successful extensions: 70021
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69899
Number of HSP's gapped (non-prelim): 122
length of query: 468
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 446
effective length of database: 17,147,199,772
effective search space: 7647651098312
effective search space used: 7647651098312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top