Clone Name | bastl01c11 |
---|---|
Clone Library Name | barley_pub |
>ref|NM_183904.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2478 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 383 cgacatcgaggactggatcga 403 ||||||||||||||||||||| Sbjct: 228 cgacatcgaggactggatcga 248
>gb|BC016250.1| Mus musculus CDC42 effector protein (Rho GTPase binding) 1, mRNA (cDNA clone MGC:28884 IMAGE:4910994), complete cds Length = 2548 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 ccttctcagccccttcctctc 90 ||||||||||||||||||||| Sbjct: 255 ccttctcagccccttcctctc 235
>gb|BC083130.1| Mus musculus CDC42 effector protein (Rho GTPase binding) 1, mRNA (cDNA clone MGC:103067 IMAGE:6441478), complete cds Length = 2547 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 ccttctcagccccttcctctc 90 ||||||||||||||||||||| Sbjct: 260 ccttctcagccccttcctctc 240
>gb|AE009116.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 142 of 256 of the complete sequence Length = 11559 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 402 gatcagatgccggtgatgcca 422 ||||||||||||||||||||| Sbjct: 8878 gatcagatgccggtgatgcca 8898
>ref|NM_027219.1| Mus musculus CDC42 effector protein (Rho GTPase binding) 1 (Cdc42ep1), mRNA Length = 2543 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 ccttctcagccccttcctctc 90 ||||||||||||||||||||| Sbjct: 268 ccttctcagccccttcctctc 248
>emb|AL139140.11| Human DNA sequence from clone RP5-1071P19 on chromosome 1p34.1-34.3 Contains part of the CSMD2 gene for CUB and Sushi multiple domains 2, complete sequence Length = 78229 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 74 ctcagccccttcctctcgtct 94 ||||||||||||||||||||| Sbjct: 57909 ctcagccccttcctctcgtct 57929
>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome Length = 2841581 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 402 gatcagatgccggtgatgcca 422 ||||||||||||||||||||| Sbjct: 1575382 gatcagatgccggtgatgcca 1575402
>dbj|AK007896.1| Mus musculus 10 day old male pancreas cDNA, RIKEN full-length enriched library, clone:1810058K22 product:similar to SERUM CONSTITUENT PROTEIN [Homo sapiens], full insert sequence Length = 2543 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 70 ccttctcagccccttcctctc 90 ||||||||||||||||||||| Sbjct: 268 ccttctcagccccttcctctc 248
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 383 cgacatcgaggactggatcga 403 ||||||||||||||||||||| Sbjct: 13127437 cgacatcgaggactggatcga 13127417
>dbj|AP003208.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1158F07 Length = 139491 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 383 cgacatcgaggactggatcga 403 ||||||||||||||||||||| Sbjct: 103158 cgacatcgaggactggatcga 103138
>dbj|AK068195.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013146B15, full insert sequence Length = 2761 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 383 cgacatcgaggactggatcga 403 ||||||||||||||||||||| Sbjct: 385 cgacatcgaggactggatcga 405
>emb|AL592169.14| Mouse DNA sequence from clone RP23-305P10 on chromosome 15, complete sequence Length = 161985 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 70 ccttctcagccccttcctctc 90 ||||||||||||||||||||| Sbjct: 77704 ccttctcagccccttcctctc 77724
>gb|AC153386.3| Mus musculus 6 BAC RP23-198D7 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 170561 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 445 atttagaagaggaagtgaaa 464 |||||||||||||||||||| Sbjct: 158323 atttagaagaggaagtgaaa 158342
>gb|L21703.1| Paralabrax nebulifer complement regulatory plasma protein mRNA, complete cds Length = 3377 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 392 ggactggatcgatcagatgc 411 |||||||||||||||||||| Sbjct: 3020 ggactggatcgatcagatgc 3039
>ref|XM_359530.1| Magnaporthe grisea 70-15 hypothetical protein (MG05247.4) partial mRNA Length = 3138 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 377 ggtcttcgacatcgaggact 396 |||||||||||||||||||| Sbjct: 765 ggtcttcgacatcgaggact 784
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 400 tcgatcagatgccggtgatgccaa 423 ||||||||||| |||||||||||| Sbjct: 3503543 tcgatcagatggcggtgatgccaa 3503520
>gb|AC124689.5| Mus musculus BAC clone RP24-147N6 from chromosome 6, complete sequence Length = 187752 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 445 atttagaagaggaagtgaaa 464 |||||||||||||||||||| Sbjct: 134991 atttagaagaggaagtgaaa 134972
>ref|XM_761403.1| Theileria parva strain Muguga chromosome 1 DNA-directed RNA polymerase (TP01_0975) partial mRNA Length = 3678 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 439 cactggatttagaagaggaa 458 |||||||||||||||||||| Sbjct: 974 cactggatttagaagaggaa 993
>emb|AL035420.15|HS550H1 Human DNA sequence from clone RP4-550H1 on chromosome 20q11.1-11.22 Contains a high mobility group protein pseudogene, three novel genes, the 5' end of the EPB41L1 gene for Erythrocyte membrane protein band 4.1-like 1 protein and three CpG islands, complete sequence Length = 108803 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 438 acactggatttagaagagga 457 |||||||||||||||||||| Sbjct: 74476 acactggatttagaagagga 74495
>emb|X94349.1|CSPBT Colpoda sp. gene encoding for beta-tubulin, partial Length = 1172 Score = 40.1 bits (20), Expect = 6.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 383 cgacatcgaggactggatcgatca 406 ||||||||||||||| |||||||| Sbjct: 301 cgacatcgaggactgaatcgatca 278
>emb|AL627362.2|CNS07TIX DNA centromeric region sequence from BAC DP15B03, DP38F06 of chromosome 5 of Podospora anserina Length = 156244 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 350 agtgtggatgaagatggtga 369 |||||||||||||||||||| Sbjct: 96814 agtgtggatgaagatggtga 96795
>emb|AJ620355.1| Rubus idaeus partial pgip1 gene for putative polygalacturonase-inhibiting protein, exons 1-2 Length = 990 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 358 tgaagatggtgagggagttg 377 |||||||||||||||||||| Sbjct: 103 tgaagatggtgagggagttg 84
>emb|AJ620336.1| Rubus idaeus mRNA for putative polygalacturonase-inhibiting protein (pgip1 gene) Length = 1254 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 358 tgaagatggtgagggagttg 377 |||||||||||||||||||| Sbjct: 260 tgaagatggtgagggagttg 241
>gb|AC126778.9| Medicago truncatula clone mth2-32j21, complete sequence Length = 110448 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 244 aggattgctccattgtaact 263 |||||||||||||||||||| Sbjct: 87626 aggattgctccattgtaact 87645
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 376 tggtcttcgacatcgaggac 395 |||||||||||||||||||| Sbjct: 3506316 tggtcttcgacatcgaggac 3506297
>emb|AL844221.6| Mouse DNA sequence from clone RP23-445C3 on chromosome X, complete sequence Length = 188627 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 449 agaagaggaagtgaaaatat 468 |||||||||||||||||||| Sbjct: 21962 agaagaggaagtgaaaatat 21943
>emb|AL714007.10| Mouse DNA sequence from clone RP23-295M3 on chromosome X, complete sequence Length = 146552 Score = 40.1 bits (20), Expect = 6.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 445 atttagaagaggaagtgaaa 464 |||||||||||||||||||| Sbjct: 71105 atttagaagaggaagtgaaa 71124 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,520,947 Number of Sequences: 3902068 Number of extensions: 3520947 Number of successful extensions: 70021 Number of sequences better than 10.0: 27 Number of HSP's better than 10.0 without gapping: 27 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 69899 Number of HSP's gapped (non-prelim): 122 length of query: 468 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 446 effective length of database: 17,147,199,772 effective search space: 7647651098312 effective search space used: 7647651098312 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)