>emb|AJ289794.1|DSU289794 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            243RIB/Ast
          Length = 5434

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            ||||||||||||||||||||||||
Sbjct: 5356 gctccggctccgtctccgttttcg 5333

>emb|AJ289788.1|DSU289788 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            219RIB/Ast
          Length = 5435

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            ||||||||||||||||||||||||
Sbjct: 5363 gctccggctccgtctccgttttcg 5340

>emb|AJ289807.1|DSU289807 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            205RIB/A2
          Length = 5453

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 134  ctccggctccgtctccgttttcg 156
            |||||||||||||||||||||||
Sbjct: 5374 ctccggctccgtctccgttttcg 5352

>emb|AJ289787.1|DSU289787 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            206RIB/Ast
          Length = 5443

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 134  ctccggctccgtctccgttttcg 156
            |||||||||||||||||||||||
Sbjct: 5364 ctccggctccgtctccgttttcg 5342

>gb|AC132580.2| Mus musculus BAC clone RP24-388H18 from chromosome 9, complete sequence
          Length = 127200

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 298   gagccctgcatgtctgaaggcttcca 323
             ||||||||||| ||||||||||||||
Sbjct: 14420 gagccctgcatttctgaaggcttcca 14395

>gb|AC166078.2| Mus musculus BAC clone RP23-13G1 from chromosome 9, complete sequence
          Length = 225128

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 298    gagccctgcatgtctgaaggcttcca 323
              ||||||||||| ||||||||||||||
Sbjct: 132730 gagccctgcatttctgaaggcttcca 132705

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 404     cgtgcggcgacgccgtccagc 424
               |||||||||||||||||||||
Sbjct: 2472869 cgtgcggcgacgccgtccagc 2472889

>emb|BX572596.1| Rhodopseudomonas palustris CGA009 complete genome; segment 4/16
          Length = 348942

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 407   gcggcgacgccgtccagcgca 427
             |||||||||||||||||||||
Sbjct: 21997 gcggcgacgccgtccagcgca 21977

>emb|AJ544892.1|TNI544892 Tetraodon nigroviridis crfb1 gene, crfb2 gene, crfb3 gene, crfb4 gene,
             crfb5 gene, crfb6 gene and ORF1 DNA
          Length = 30094

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 155   cggccctgactccggccccagctcc 179
             |||||||||| ||||||||||||||
Sbjct: 14423 cggccctgaccccggccccagctcc 14447

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 407     gcggcgacgccgtccagcgca 427
               |||||||||||||||||||||
Sbjct: 3078474 gcggcgacgccgtccagcgca 3078494

>emb|V01555.2|EBV Epstein-Barr virus (EBV) genome, strain B95-8
          Length = 172281

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 150    gttttcggccctgactccggcccca 174
              ||||||||||||| |||||||||||
Sbjct: 107270 gttttcggccctgcctccggcccca 107294

>emb|AJ507799.2|HHV507799 Human herpesvirus 4 complete wild type genome
          Length = 171823

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 150   gttttcggccctgactccggcccca 174
             ||||||||||||| |||||||||||
Sbjct: 94982 gttttcggccctgcctccggcccca 95006

>gb|M80517.1|HS4B958RAJ Epstein-Barr virus, artifactual joining of B95-8 complete genome and the
              sequences from Raji of the large deletion found in B95-8
          Length = 184113

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 150    gttttcggccctgactccggcccca 174
              ||||||||||||| |||||||||||
Sbjct: 107270 gttttcggccctgcctccggcccca 107294

>emb|AJ289812.1|DMA289812 Drosophila madeirensis y gene for Yellow protein, exons 1-2, strain
            Am1
          Length = 5522

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 133  gctccggctccgtctccgttt 153
            |||||||||||||||||||||
Sbjct: 5444 gctccggctccgtctccgttt 5424

>gb|AC008228.5| Drosophila melanogaster clone BACR23E23, complete sequence
          Length = 162949

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 133   gctccggctccgtctccgttttcg 156
             ||||||||||||||||||| ||||
Sbjct: 25822 gctccggctccgtctccgtcttcg 25799

>gb|AC092222.2| Drosophila melanogaster clone BACR16I01, complete sequence
          Length = 165697

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            ||||||||||||||||||| ||||
Sbjct: 8194 gctccggctccgtctccgtcttcg 8217

>ref|XM_428059.1| PREDICTED: Gallus gallus similar to 5330417C22Rik protein
           (LOC430504), partial mRNA
          Length = 1019

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 407 gcggcgacgccgtccagcgc 426
           ||||||||||||||||||||
Sbjct: 389 gcggcgacgccgtccagcgc 370

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 363     ctgcggtggccaatgcgact 382
               ||||||||||||||||||||
Sbjct: 1030839 ctgcggtggccaatgcgact 1030820

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 326     cctgcacggccagctgcaac 345
               ||||||||||||||||||||
Sbjct: 1296017 cctgcacggccagctgcaac 1295998

>emb|CT030256.13| Mouse DNA sequence from clone RP23-346K5 on chromosome 13, complete
              sequence
          Length = 197972

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     aatctcttagctccagcaat 38
              ||||||||||||||||||||
Sbjct: 174667 aatctcttagctccagcaat 174648

>gb|AE003587.4| Drosophila melanogaster chromosome 2L, section 4 of 83 of the complete
             sequence
          Length = 314549

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 133   gctccggctccgtctccgttttcg 156
             ||||||||||||||||||| ||||
Sbjct: 38177 gctccggctccgtctccgtcttcg 38154

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 78      cgccgccgtcttggccatgctggt 101
               |||||||||| |||||||||||||
Sbjct: 3654083 cgccgccgtcatggccatgctggt 3654106

>gb|AC164877.2| Mus musculus BAC clone RP24-340N21 from chromosome 13, complete sequence
          Length = 179184

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 19     aatctcttagctccagcaat 38
              ||||||||||||||||||||
Sbjct: 174659 aatctcttagctccagcaat 174640

>emb|AJ289811.1|DSU289811 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            212RIB/A2
          Length = 5454

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            |||||| |||||||||||||||||
Sbjct: 5376 gctccgtctccgtctccgttttcg 5353

>emb|AJ289808.1|DSU289808 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            209RIB/A2
          Length = 5454

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            |||||| |||||||||||||||||
Sbjct: 5376 gctccgtctccgtctccgttttcg 5353

>emb|AJ289796.1|DSU289796 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            290RIB/Ast
          Length = 5467

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            |||||| |||||||||||||||||
Sbjct: 5389 gctccgtctccgtctccgttttcg 5366

>emb|AJ289792.1|DSU289792 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            240RIB/Ast
          Length = 5469

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            |||||| |||||||||||||||||
Sbjct: 5391 gctccgtctccgtctccgttttcg 5368

>emb|AJ289790.1|DSU289790 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            238RIB/Ast
          Length = 5411

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            |||||| |||||||||||||||||
Sbjct: 5333 gctccgtctccgtctccgttttcg 5310

>emb|AJ289789.1|DSU289789 Drosophila subobscura y gene for Yellow protein, exons 1-2, strain
            229RIB/Ast
          Length = 5462

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            |||||| |||||||||||||||||
Sbjct: 5384 gctccgtctccgtctccgttttcg 5361

>emb|Y13909.1|DSY13909 Drosophila subobscura yellow gene, exon 1 and exon 2
          Length = 7357

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 133  gctccggctccgtctccgttttcg 156
            |||||| |||||||||||||||||
Sbjct: 6970 gctccgtctccgtctccgttttcg 6947


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,408,789
Number of Sequences: 3902068
Number of extensions: 2408789
Number of successful extensions: 52784
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52451
Number of HSP's gapped (non-prelim): 333
length of query: 434
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 412
effective length of database: 17,147,199,772
effective search space: 7064646306064
effective search space used: 7064646306064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)