>dbj|AK073262.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033026H23, full
           insert sequence
          Length = 1655

 Score =  224 bits (113), Expect = 2e-55
 Identities = 239/281 (85%)
 Strand = Plus / Plus

                                                                       
Query: 213 ggaggggatggcctgtacagggagattctcagggacgagacggtcctccggctcaaccaa 272
           ||||| ||||| || ||||||||||| |||||||| |||||||| ||| |||||||  ||
Sbjct: 167 ggaggagatgggctctacagggagatcctcagggatgagacggtgctcaggctcaaagaa 226

                                                                       
Query: 273 ctcggcaagatatctgatggcgaagggttcctcgaaaggacgttcctgagtcctgcttcc 332
           || ||||||||||||||||| ||||| | ||| || ||||| ||  |||||||||| || 
Sbjct: 227 cttggcaagatatctgatggggaaggttaccttgagaggacatttttgagtcctgcctca 286

                                                                       
Query: 333 ttcagagccactgatgtcattatcggctggatgaaagatgccggacttacgacgtgggtt 392
            |||||||| ||| |||||||||| ||||||||||||||||||||||||| |||||| ||
Sbjct: 287 atcagagcctctgctgtcattatcagctggatgaaagatgccggacttaccacgtggatt 346

                                                                       
Query: 393 gatcaaatgggtaacattcatggccgatttgaaccgtccaattcgacagagaaggcttta 452
           ||||||||||| || |||||||| |||||||||||| |||| || ||  || |||| || 
Sbjct: 347 gatcaaatggggaatattcatggtcgatttgaaccgaccaactcaaccaaggaggccttg 406

                                                    
Query: 453 ttgattggatcccatatggatactgtcattgatgctggcat 493
           ||||| ||||| || ||||| ||||| ||||||||||||||
Sbjct: 407 ttgatcggatctcacatggacactgttattgatgctggcat 447

>gb|AY104710.1| Zea mays PCO117022 mRNA sequence
          Length = 1699

 Score =  157 bits (79), Expect = 4e-35
 Identities = 222/267 (83%), Gaps = 2/267 (0%)
 Strand = Plus / Plus

                                                                       
Query: 225 ctgtacagggagattctcagggacgagacggtcctccggctcaaccaactcggcaagata 284
           |||||| |||||||||||||||||||||| || |   |||||||  | || |||||||||
Sbjct: 194 ctgtaccgggagattctcagggacgagaccgtgcagaggctcaaggagctgggcaagata 253

                                                                       
Query: 285 tctgatggcgaagggttcctcgaaaggacgttcctgagtcctgcttccttcagagccact 344
           |||||||| || || | ||| ||||||||||| |||||||| || ||  |||||||||||
Sbjct: 254 tctgatggggatggctaccttgaaaggacgtttctgagtccggcctctatcagagccact 313

                                                                       
Query: 345 gatgtcattatcggctggatgaaagatgccggacttacgacgtgggttgatcaaatgggt 404
           | ||||||  || ||||||||||||| || || |||||||||||||| ||||| ||||| 
Sbjct: 314 ggtgtcatcgtcagctggatgaaagacgctgggcttacgacgtgggtcgatcagatgggg 373

                                                                       
Query: 405 aacattcatggccgatttgaaccgtccaattcga-cagagaaggctttattgattggatc 463
           || |||||||| |||| ||| ||| | ||||| | ||||| | || || |||||||||||
Sbjct: 374 aatattcatggtcgatatgagccggcaaattctaccagag-atgccttgttgattggatc 432

                                      
Query: 464 ccatatggatactgtcattgatgctgg 490
            |||||||| |||||| ||||||||||
Sbjct: 433 tcatatggacactgtcgttgatgctgg 459

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                            
Query: 280      agatatctgatggcgaagggttcctcgaaaggacgttcctgagtcctgcttccttcagag 339
                ||||||||||||| ||||| | ||| || ||||| ||  |||||||||| ||  ||||||
Sbjct: 27114798 agatatctgatggggaaggttaccttgagaggacatttttgagtcctgcctcaatcagag 27114739

                                                                
Query: 340      ccactgatgtcattatcggctggatgaaagatgccggacttacgacgt 387
                || ||| |||||||||| ||||||||||||||||||||||||| ||||
Sbjct: 27114738 cctctgctgtcattatcagctggatgaaagatgccggacttaccacgt 27114691



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                            
Query: 213      ggaggggatggcctgtacagggagattctcagggacgagacggtcctccggctcaaccaa 272
                ||||| ||||| || ||||||||||| |||||||| |||||||| ||| |||||||  ||
Sbjct: 27115598 ggaggagatgggctctacagggagatcctcagggatgagacggtgctcaggctcaaagaa 27115539

                         
Query: 273      ctcggcaag 281
                || ||||||
Sbjct: 27115538 cttggcaag 27115530



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                                
Query: 386      gtgggttgatcaaatgggtaacattcatggccgatttgaaccgtccaa 433
                |||| ||||||||||||| || |||||||| |||||||||||| ||||
Sbjct: 27114610 gtggattgatcaaatggggaatattcatggtcgatttgaaccgaccaa 27114563

>dbj|AP003628.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0473H04
          Length = 155204

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 93/108 (86%)
 Strand = Plus / Minus

                                                                         
Query: 280   agatatctgatggcgaagggttcctcgaaaggacgttcctgagtcctgcttccttcagag 339
             ||||||||||||| ||||| | ||| || ||||| ||  |||||||||| ||  ||||||
Sbjct: 83608 agatatctgatggggaaggttaccttgagaggacatttttgagtcctgcctcaatcagag 83549

                                                             
Query: 340   ccactgatgtcattatcggctggatgaaagatgccggacttacgacgt 387
             || ||| |||||||||| ||||||||||||||||||||||||| ||||
Sbjct: 83548 cctctgctgtcattatcagctggatgaaagatgccggacttaccacgt 83501



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                         
Query: 213   ggaggggatggcctgtacagggagattctcagggacgagacggtcctccggctcaaccaa 272
             ||||| ||||| || ||||||||||| |||||||| |||||||| ||| |||||||  ||
Sbjct: 84408 ggaggagatgggctctacagggagatcctcagggatgagacggtgctcaggctcaaagaa 84349

                      
Query: 273   ctcggcaag 281
             || ||||||
Sbjct: 84348 cttggcaag 84340



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                             
Query: 386   gtgggttgatcaaatgggtaacattcatggccgatttgaaccgtccaa 433
             |||| ||||||||||||| || |||||||| |||||||||||| ||||
Sbjct: 83420 gtggattgatcaaatggggaatattcatggtcgatttgaaccgaccaa 83373

>ref|NM_118126.2| Arabidopsis thaliana metallopeptidase AT4G20070 mRNA, complete cds
          Length = 1837

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 456 attggatcccatatggatactgtcattgatgctgg 490
           ||||| ||||||||||| ||||| |||||||||||
Sbjct: 583 attggttcccatatggacactgtgattgatgctgg 617

>gb|BT025334.1| Arabidopsis thaliana At4g20070 mRNA, complete cds
          Length = 1578

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 456 attggatcccatatggatactgtcattgatgctgg 490
           ||||| ||||||||||| ||||| |||||||||||
Sbjct: 490 attggttcccatatggacactgtgattgatgctgg 524

>emb|BX828231.1|CNS0A335 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH66ZB01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1771

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 456 attggatcccatatggatactgtcattgatgctgg 490
           ||||| ||||||||||| ||||| |||||||||||
Sbjct: 563 attggttcccatatggacactgtgattgatgctgg 597

>gb|AC067950.5| Homo sapiens BAC clone RP11-375B23 from 2, complete sequence
          Length = 101721

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 44     caccccagcccccaacccaacc 65
              ||||||||||||||||||||||
Sbjct: 100529 caccccagcccccaacccaacc 100550

>gb|AY596304.1| Chlamydomonas reinhardtii unknown (mtA4) mRNA, complete cds
          Length = 3077

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 65   ccacagaggccacacacggcggctc 89
            |||||||||||||||| ||||||||
Sbjct: 1004 ccacagaggccacacagggcggctc 1028

>gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, complete sequence
          Length = 174746

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 323   tcctgcttccttcagagcca 342
             ||||||||||||||||||||
Sbjct: 17178 tcctgcttccttcagagcca 17197

>gb|AC110512.13| Mus musculus chromosome 15, clone RP24-134E9, complete sequence
          Length = 163319

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 326    tgcttccttcagagccactg 345
              ||||||||||||||||||||
Sbjct: 135923 tgcttccttcagagccactg 135942

>gb|AY605475.1| Amphisbaena schmidti voucher MVZ 232754 mitochondrion, complete
            genome
          Length = 17423

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 38   ccaagccaccccagcccccaacccaacccaca 69
            ||||||||||| ||||||||||| || |||||
Sbjct: 8035 ccaagccacccaagcccccaaccaaaaccaca 8066

>gb|BC073057.1| Xenopus laevis hypothetical protein LOC443615, mRNA (cDNA clone
            IMAGE:5074177), partial cds
          Length = 2360

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 325  ctgcttccttcagagccactgatg 348
            ||||||| ||||||||||||||||
Sbjct: 1147 ctgcttctttcagagccactgatg 1124

>gb|AC091807.4| Homo sapiens chromosome X clone RP6-186E3 map p11.4, complete sequence
          Length = 172150

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 327    gcttccttcagagccactga 346
              ||||||||||||||||||||
Sbjct: 134521 gcttccttcagagccactga 134540

>gb|AC149790.1| Pan troglodytes chromosome X clone PTB-089K20, complete sequence
          Length = 47909

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 46    ccccagcccccaacccaacccaca 69
             ||||| ||||||||||||||||||
Sbjct: 44978 ccccaacccccaacccaacccaca 45001

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 348     gtcattatcggctggatgaa 367
               ||||||||||||||||||||
Sbjct: 4497810 gtcattatcggctggatgaa 4497829

>gb|AC123791.4| Mus musculus BAC clone RP24-304L14 from chromosome 15, complete
             sequence
          Length = 149316

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 326   tgcttccttcagagccactg 345
             ||||||||||||||||||||
Sbjct: 12579 tgcttccttcagagccactg 12598

>emb|AL451069.34| Human DNA sequence from clone RP11-432J24 on chromosome 10 Contains the
             3' end of gene LOC170394, four novel genes, gene
             LOC170393, the 5' end of the INPP5A gene for inositol
             polyphosphate-5-phosphatase 40kDa and five CpG islands,
             complete sequence
          Length = 149579

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 43    ccaccccagcccccaaccca 62
             ||||||||||||||||||||
Sbjct: 40204 ccaccccagcccccaaccca 40223



 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 43    ccaccccagcccccaacccaaccc 66
             ||||||||||||||| ||||||||
Sbjct: 32845 ccaccccagcccccaccccaaccc 32868

>gb|AC012018.24| Homo sapiens 12 BAC RP11-691B3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 60163

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 209   aggaggaggggatggcctgt 228
             ||||||||||||||||||||
Sbjct: 50939 aggaggaggggatggcctgt 50920

>gb|AC171497.3| Pan troglodytes chromosome X clone PTB-121G07 map human ortholog p11.4,
              complete sequence
          Length = 227065

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 327    gcttccttcagagccactga 346
              ||||||||||||||||||||
Sbjct: 177248 gcttccttcagagccactga 177267

>emb|BX321857.1| Nitrosomonas europaea ATCC 19718, complete genome; segment 2/10
          Length = 313050

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 28     gagcctgccgccaagccaccccag 51
              |||||||||||||| |||||||||
Sbjct: 276155 gagcctgccgccaatccaccccag 276132

>gb|AC100789.2| Homo sapiens chromosome X, clone RP11-907I17, complete sequence
          Length = 183453

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 327   gcttccttcagagccactga 346
             ||||||||||||||||||||
Sbjct: 35214 gcttccttcagagccactga 35233

>dbj|AK127676.1| Homo sapiens cDNA FLJ45774 fis, clone NETRP2003539
          Length = 2158

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 209  aggaggaggggatggcctgt 228
            ||||||||||||||||||||
Sbjct: 1631 aggaggaggggatggcctgt 1612

>gb|AF055737.1| Rubus trifidus internal transcribed spacer 1, 5.8S ribosomal RNA
          gene; and internal transcribed spacer 2, complete
          sequence
          Length = 628

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 13 gaggaaagggacgaggagcc 32
          ||||||||||||||||||||
Sbjct: 84 gaggaaagggacgaggagcc 65

>gb|AC069362.12| Homo sapiens, clone RP11-745J24, complete sequence
          Length = 176295

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 327   gcttccttcagagccactga 346
             ||||||||||||||||||||
Sbjct: 30193 gcttccttcagagccactga 30174

>gb|AC115899.12| Mus musculus chromosome 5, clone RP24-445G9, complete sequence
          Length = 136140

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 1      ctgtccctgtgggaggaaag 20
              ||||||||||||||||||||
Sbjct: 112545 ctgtccctgtgggaggaaag 112526

>gb|AC068874.21| Homo sapiens chromosome 17, clone RP11-399J11, complete sequence
          Length = 174914

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 195   ccggagcagcagccaggagg 214
             ||||||||||||||||||||
Sbjct: 50011 ccggagcagcagccaggagg 49992

>gb|AC087651.19| Homo sapiens chromosome 17, clone RP11-309N17, complete sequence
          Length = 197148

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 195   ccggagcagcagccaggagg 214
             ||||||||||||||||||||
Sbjct: 30114 ccggagcagcagccaggagg 30133

>gb|AY530214.1| Cryptococcus neoformans var. grubii UDP-glucose dehydrogenase gene,
           complete cds
          Length = 4991

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  gggaggaaagggacgaggag 30
           ||||||||||||||||||||
Sbjct: 530 gggaggaaagggacgaggag 549

>dbj|AB038461.1| Rubus trifidus gene for ITS1, 5.8S rRNA, ITS2, partial and
          complete sequences
          Length = 627

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 13 gaggaaagggacgaggagcc 32
          ||||||||||||||||||||
Sbjct: 84 gaggaaagggacgaggagcc 65


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,402,084
Number of Sequences: 3902068
Number of extensions: 3402084
Number of successful extensions: 72956
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72858
Number of HSP's gapped (non-prelim): 96
length of query: 493
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 471
effective length of database: 17,147,199,772
effective search space: 8076331092612
effective search space used: 8076331092612
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)