ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart60f08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_479931.1| Oryza sativa (japonica cultivar-group), mRNA 347 2e-92
2dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK7... 347 2e-92
3dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clon... 347 2e-92
4dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 297 2e-77
5dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic D... 297 2e-77
6gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, ... 278 1e-71
7dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 278 1e-71
8gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 278 1e-71
9dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 270 3e-69
10gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 270 3e-69
11emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575... 270 3e-69
12emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa... 270 3e-69
13gb|BT016531.1| Zea mays clone Contig364 mRNA sequence 194 2e-46
14emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0 174 2e-40
15emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein 56 1e-04
16gb|AY880417.1| Gekko japonicus GekBS186P mRNA, complete cds 52 0.001
17dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acid... 52 0.001
18emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ri... 50 0.006
19gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, co... 50 0.006
20dbj|AB113109.1| Aotus trivirgatus Aotr-B1 gene for MHC class I a... 50 0.006
21ref|XM_787003.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.023
22emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-... 48 0.023
23emb|BX019003.1|CNS08MTR Single read from an extremity of a full-... 48 0.023
24emb|BX018793.1|CNS08MNX Single read from an extremity of a full-... 48 0.023
25emb|BX013777.1|CNS08ISL Single read from an extremity of a full-... 48 0.023
26emb|BX006032.1|CNS08CTG Single read from an extremity of a full-... 48 0.023
27emb|BX005998.1|CNS08CSI Single read from an extremity of a full-... 48 0.023
28ref|XM_789716.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.023
29gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA... 48 0.023
30emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-... 46 0.092
31emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-... 46 0.092
32emb|BX072146.1|CNS09RTY Single read from an extremity of a full-... 46 0.092
33emb|BX072055.1|CNS09RRF Single read from an extremity of a full-... 46 0.092
34emb|BX072031.1|CNS09RQR Single read from an extremity of a full-... 46 0.092
35emb|BX071993.1|CNS09RPP Single read from an extremity of a full-... 46 0.092
36emb|BX071847.1|CNS09RLN Single read from an extremity of a full-... 46 0.092
37emb|BX071747.1|CNS09RIV Single read from an extremity of a full-... 46 0.092
38emb|BX071518.1|CNS09RCI Single read from an extremity of a full-... 46 0.092
39emb|BX071226.1|CNS09R4E Single read from an extremity of a full-... 46 0.092
40emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-... 46 0.092
41emb|BX071445.1|CNS09RAH Single read from an extremity of a full-... 46 0.092
42emb|BX071386.1|CNS09R8U Single read from an extremity of a full-... 46 0.092
43emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-... 46 0.092
44emb|BX071251.1|CNS09R53 Single read from an extremity of a full-... 46 0.092
45emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-... 46 0.092
46emb|BX070973.1|CNS09QXD Single read from an extremity of a full-... 46 0.092
47emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-... 46 0.092
48emb|BX070900.1|CNS09QVC Single read from an extremity of a full-... 46 0.092
49emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-... 46 0.092
50emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-... 46 0.092
51emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-... 46 0.092
52emb|BX070622.1|CNS09QNM Single read from an extremity of a full-... 46 0.092
53emb|BX070589.1|CNS09QMP Single read from an extremity of a full-... 46 0.092
54emb|BX070541.1|CNS09QLD Single read from an extremity of a full-... 46 0.092
55emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-... 46 0.092
56emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-... 46 0.092
57emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-... 46 0.092
58emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-... 46 0.092
59emb|BX061090.1|CNS09JAU Single read from an extremity of a full-... 46 0.092
60emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-... 46 0.092
61emb|BX061042.1|CNS09J9I Single read from an extremity of a full-... 46 0.092
62emb|BX069588.1|CNS09PUW Single read from an extremity of a full-... 46 0.092
63emb|BX069403.1|CNS09PPR Single read from an extremity of a full-... 46 0.092
64emb|BX069336.1|CNS09PNW Single read from an extremity of a full-... 46 0.092
65emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-... 46 0.092
66emb|BX069142.1|CNS09PII Single read from an extremity of a full-... 46 0.092
67emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-... 46 0.092
68emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-... 46 0.092
69emb|BX068833.1|CNS09P9X Single read from an extremity of a full-... 46 0.092
70emb|BX068815.1|CNS09P9F Single read from an extremity of a full-... 46 0.092
71emb|BX068760.1|CNS09P7W Single read from an extremity of a full-... 46 0.092
72emb|BX068607.1|CNS09P3N Single read from an extremity of a full-... 46 0.092
73emb|BX068471.1|CNS09OZV Single read from an extremity of a full-... 46 0.092
74emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-... 46 0.092
75emb|BX068019.1|CNS09ONB Single read from an extremity of a full-... 46 0.092
76emb|BX067891.1|CNS09OJR Single read from an extremity of a full-... 46 0.092
77emb|BX067841.1|CNS09OID Single read from an extremity of a full-... 46 0.092
78emb|BX067819.1|CNS09OHR Single read from an extremity of a full-... 46 0.092
79emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-... 46 0.092
80emb|BX067752.1|CNS09OFW Single read from an extremity of a full-... 46 0.092
81emb|BX067707.1|CNS09OEN Single read from an extremity of a full-... 46 0.092
82emb|BX067564.1|CNS09OAO Single read from an extremity of a full-... 46 0.092
83emb|BX067487.1|CNS09O8J Single read from an extremity of a full-... 46 0.092
84emb|BX067429.1|CNS09O6X Single read from an extremity of a full-... 46 0.092
85emb|BX066992.1|CNS09NUS Single read from an extremity of a full-... 46 0.092
86emb|BX067216.1|CNS09O10 Single read from an extremity of a full-... 46 0.092
87emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-... 46 0.092
88emb|BX066854.1|CNS09NQY Single read from an extremity of a full-... 46 0.092
89emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-... 46 0.092
90emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-... 46 0.092
91emb|BX066597.1|CNS09NJT Single read from an extremity of a full-... 46 0.092
92emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-... 46 0.092
93emb|BX066412.1|CNS09NEO Single read from an extremity of a full-... 46 0.092
94emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-... 46 0.092
95emb|BX066329.1|CNS09NCD Single read from an extremity of a full-... 46 0.092
96emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-... 46 0.092
97emb|BX065714.1|CNS09MVA Single read from an extremity of a full-... 46 0.092
98emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-... 46 0.092
99emb|BX065465.1|CNS09MOD Single read from an extremity of a full-... 46 0.092
100emb|BX065359.1|CNS09MLF Single read from an extremity of a full-... 46 0.092
101emb|BX065269.1|CNS09MIX Single read from an extremity of a full-... 46 0.092
102emb|BX065249.1|CNS09MID Single read from an extremity of a full-... 46 0.092
103emb|BX065042.1|CNS09MCM Single read from an extremity of a full-... 46 0.092
104emb|BX065015.1|CNS09MBV Single read from an extremity of a full-... 46 0.092
105emb|BX065006.1|CNS09MBM Single read from an extremity of a full-... 46 0.092
106emb|BX065005.1|CNS09MBL Single read from an extremity of a full-... 46 0.092
107emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-... 46 0.092
108emb|BX064796.1|CNS09M5S Single read from an extremity of a full-... 46 0.092
109emb|BX064760.1|CNS09M4S Single read from an extremity of a full-... 46 0.092
110emb|BX064725.1|CNS09M3T Single read from an extremity of a full-... 46 0.092
111emb|BX064530.1|CNS09LYE Single read from an extremity of a full-... 46 0.092
112emb|BX064423.1|CNS09LVF Single read from an extremity of a full-... 46 0.092
113emb|BX064284.1|CNS09LRK Single read from an extremity of a full-... 46 0.092
114emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-... 46 0.092
115emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-... 46 0.092
116emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-... 46 0.092
117emb|BX064068.1|CNS09LLK Single read from an extremity of a full-... 46 0.092
118emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-... 46 0.092
119emb|BX063577.1|CNS09L7X Single read from an extremity of a full-... 46 0.092
120emb|BX063467.1|CNS09L4V Single read from an extremity of a full-... 46 0.092
121emb|BX063466.1|CNS09L4U Single read from an extremity of a full-... 46 0.092
122emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-... 46 0.092
123emb|BX063420.1|CNS09L3K Single read from an extremity of a full-... 46 0.092
124emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-... 46 0.092
125emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-... 46 0.092
126emb|BX062552.1|CNS09KFG Single read from an extremity of a full-... 46 0.092
127emb|BX062546.1|CNS09KFA Single read from an extremity of a full-... 46 0.092
128emb|BX062387.1|CNS09KAV Single read from an extremity of a full-... 46 0.092
129emb|BX062299.1|CNS09K8F Single read from an extremity of a full-... 46 0.092
130emb|BX062297.1|CNS09K8D Single read from an extremity of a full-... 46 0.092
131emb|BX062183.1|CNS09K57 Single read from an extremity of a full-... 46 0.092
132emb|BX062169.1|CNS09K4T Single read from an extremity of a full-... 46 0.092
133emb|BX062048.1|CNS09K1G Single read from an extremity of a full-... 46 0.092
134emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-... 46 0.092
135emb|BX061190.1|CNS09JDM Single read from an extremity of a full-... 46 0.092
136emb|BX061164.1|CNS09JCW Single read from an extremity of a full-... 46 0.092
137emb|BX061163.1|CNS09JCV Single read from an extremity of a full-... 46 0.092
138emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-... 46 0.092
139emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-... 46 0.092
140emb|BX060642.1|CNS09IYE Single read from an extremity of a full-... 46 0.092
141emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-... 46 0.092
142emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-... 46 0.092
143emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-... 46 0.092
144emb|BX060443.1|CNS09ISV Single read from an extremity of a full-... 46 0.092
145emb|BX060185.1|CNS09ILP Single read from an extremity of a full-... 46 0.092
146emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-... 46 0.092
147emb|BX059866.1|CNS09ICU Single read from an extremity of a full-... 46 0.092
148emb|BX059758.1|CNS09I9U Single read from an extremity of a full-... 46 0.092
149emb|BX059741.1|CNS09I9D Single read from an extremity of a full-... 46 0.092
150emb|BX059642.1|CNS09I6M Single read from an extremity of a full-... 46 0.092
151emb|BX059587.1|CNS09I53 Single read from an extremity of a full-... 46 0.092
152emb|BX059585.1|CNS09I51 Single read from an extremity of a full-... 46 0.092
153emb|BX059469.1|CNS09I1T Single read from an extremity of a full-... 46 0.092
154emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-... 46 0.092
155emb|BX059220.1|CNS09HUW Single read from an extremity of a full-... 46 0.092
156emb|BX059184.1|CNS09HTW Single read from an extremity of a full-... 46 0.092
157emb|BX059095.1|CNS09HRF Single read from an extremity of a full-... 46 0.092
158emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-... 46 0.092
159emb|BX058839.1|CNS09HKB Single read from an extremity of a full-... 46 0.092
160emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-... 46 0.092
161emb|BX058740.1|CNS09HHK Single read from an extremity of a full-... 46 0.092
162emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-... 46 0.092
163emb|BX058315.1|CNS09H5R Single read from an extremity of a full-... 46 0.092
164emb|BX058203.1|CNS09H2N Single read from an extremity of a full-... 46 0.092
165emb|BX056754.1|CNS09FYE Single read from an extremity of a full-... 46 0.092
166emb|BX057924.1|CNS09GUW Single read from an extremity of a full-... 46 0.092
167emb|BX057796.1|CNS09GRC Single read from an extremity of a full-... 46 0.092
168emb|BX057631.1|CNS09GMR Single read from an extremity of a full-... 46 0.092
169emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-... 46 0.092
170emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-... 46 0.092
171emb|BX057218.1|CNS09GBA Single read from an extremity of a full-... 46 0.092
172emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-... 46 0.092
173emb|BX057133.1|CNS09G8X Single read from an extremity of a full-... 46 0.092
174emb|BX057094.1|CNS09G7U Single read from an extremity of a full-... 46 0.092
175emb|BX057074.1|CNS09G7A Single read from an extremity of a full-... 46 0.092
176emb|BX056996.1|CNS09G54 Single read from an extremity of a full-... 46 0.092
177emb|BX056958.1|CNS09G42 Single read from an extremity of a full-... 46 0.092
178emb|BX056914.1|CNS09G2U Single read from an extremity of a full-... 46 0.092
179emb|BX056483.1|CNS09FQV Single read from an extremity of a full-... 46 0.092
180emb|BX055960.1|CNS09FCC Single read from an extremity of a full-... 46 0.092
181emb|BX055808.1|CNS09F84 Single read from an extremity of a full-... 46 0.092
182emb|BX056320.1|CNS09FMC Single read from an extremity of a full-... 46 0.092
183emb|BX056288.1|CNS09FLG Single read from an extremity of a full-... 46 0.092
184emb|BX056287.1|CNS09FLF Single read from an extremity of a full-... 46 0.092
185emb|BX056283.1|CNS09FLB Single read from an extremity of a full-... 46 0.092
186emb|BX055999.1|CNS09FDF Single read from an extremity of a full-... 46 0.092
187emb|BX055725.1|CNS09F5T Single read from an extremity of a full-... 46 0.092
188emb|BX055721.1|CNS09F5P Single read from an extremity of a full-... 46 0.092
189emb|BX055621.1|CNS09F2X Single read from an extremity of a full-... 46 0.092
190emb|BX055603.1|CNS09F2F Single read from an extremity of a full-... 46 0.092
191emb|BX055567.1|CNS09F1F Single read from an extremity of a full-... 46 0.092
192emb|BX053214.1|CNS09D82 Single read from an extremity of a full-... 46 0.092
193emb|BX053185.1|CNS09D79 Single read from an extremity of a full-... 46 0.092
194emb|BX053146.1|CNS09D66 Single read from an extremity of a full-... 46 0.092
195emb|BX052948.1|CNS09D0O Single read from an extremity of a full-... 46 0.092
196emb|BX052946.1|CNS09D0M Single read from an extremity of a full-... 46 0.092
197emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-... 46 0.092
198emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-... 46 0.092
199emb|BX054345.1|CNS09E3H Single read from an extremity of a full-... 46 0.092
200emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-... 46 0.092
201emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-... 46 0.092
202emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-... 46 0.092
203emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-... 46 0.092
204emb|BX053890.1|CNS09DQU Single read from an extremity of a full-... 46 0.092
205emb|BX053889.1|CNS09DQT Single read from an extremity of a full-... 46 0.092
206emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-... 46 0.092
207emb|BX053704.1|CNS09DLO Single read from an extremity of a full-... 46 0.092
208emb|BX053693.1|CNS09DLD Single read from an extremity of a full-... 46 0.092
209emb|BX053532.1|CNS09DGW Single read from an extremity of a full-... 46 0.092
210emb|BX052874.1|CNS09CYM Single read from an extremity of a full-... 46 0.092
211emb|BX052836.1|CNS09CXK Single read from an extremity of a full-... 46 0.092
212emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-... 46 0.092
213emb|BX052777.1|CNS09CVX Single read from an extremity of a full-... 46 0.092
214emb|BX052724.1|CNS09CUG Single read from an extremity of a full-... 46 0.092
215emb|BX052368.1|CNS09CKK Single read from an extremity of a full-... 46 0.092
216emb|BX052263.1|CNS09CHN Single read from an extremity of a full-... 46 0.092
217emb|BX052235.1|CNS09CGV Single read from an extremity of a full-... 46 0.092
218emb|BX052085.1|CNS09CCP Single read from an extremity of a full-... 46 0.092
219emb|BX052064.1|CNS09CC4 Single read from an extremity of a full-... 46 0.092
220emb|BX052006.1|CNS09CAI Single read from an extremity of a full-... 46 0.092
221emb|BX051964.1|CNS09C9C Single read from an extremity of a full-... 46 0.092
222emb|BX051899.1|CNS09C7J Single read from an extremity of a full-... 46 0.092
223emb|BX051866.1|CNS09C6M Single read from an extremity of a full-... 46 0.092
224emb|BX051626.1|CNS09BZY Single read from an extremity of a full-... 46 0.092
225emb|BX051618.1|CNS09BZQ Single read from an extremity of a full-... 46 0.092
226emb|BX051600.1|CNS09BZ8 Single read from an extremity of a full-... 46 0.092
227emb|BX051577.1|CNS09BYL Single read from an extremity of a full-... 46 0.092
228emb|BX051509.1|CNS09BWP Single read from an extremity of a full-... 46 0.092
229emb|BX051472.1|CNS09BVO Single read from an extremity of a full-... 46 0.092
230emb|BX051379.1|CNS09BT3 Single read from an extremity of a full-... 46 0.092
231emb|BX051301.1|CNS09BQX Single read from an extremity of a full-... 46 0.092
232emb|BX050244.1|CNS09AXK Single read from an extremity of a full-... 46 0.092
233emb|BX050212.1|CNS09AWO Single read from an extremity of a full-... 46 0.092
234emb|BX050202.1|CNS09AWE Single read from an extremity of a full-... 46 0.092
235emb|BX050196.1|CNS09AW8 Single read from an extremity of a full-... 46 0.092
236emb|BX050804.1|CNS09BD4 Single read from an extremity of a full-... 46 0.092
237emb|BX050797.1|CNS09BCX Single read from an extremity of a full-... 46 0.092
238emb|BX050762.1|CNS09BBY Single read from an extremity of a full-... 46 0.092
239emb|BX050723.1|CNS09BAV Single read from an extremity of a full-... 46 0.092
240emb|BX050711.1|CNS09BAJ Single read from an extremity of a full-... 46 0.092
241emb|BX050679.1|CNS09B9N Single read from an extremity of a full-... 46 0.092
242emb|BX050552.1|CNS09B64 Single read from an extremity of a full-... 46 0.092
243emb|BX050545.1|CNS09B5X Single read from an extremity of a full-... 46 0.092
244emb|BX050514.1|CNS09B52 Single read from an extremity of a full-... 46 0.092
245emb|BX050479.1|CNS09B43 Single read from an extremity of a full-... 46 0.092
246emb|BX050437.1|CNS09B2X Single read from an extremity of a full-... 46 0.092
247emb|BX050412.1|CNS09B28 Single read from an extremity of a full-... 46 0.092
248emb|BX050290.1|CNS09AYU Single read from an extremity of a full-... 46 0.092
249emb|BX049856.1|CNS09AMS Single read from an extremity of a full-... 46 0.092
250emb|BX049758.1|CNS09AK2 Single read from an extremity of a full-... 46 0.092
251emb|BX049674.1|CNS09AHQ Single read from an extremity of a full-... 46 0.092
252emb|BX030999.1|CNS08W2Z Single read from an extremity of a full-... 46 0.092
253emb|BX030941.1|CNS08W1D Single read from an extremity of a full-... 46 0.092
254emb|BX030929.1|CNS08W11 Single read from an extremity of a full-... 46 0.092
255emb|BX030903.1|CNS08W0B Single read from an extremity of a full-... 46 0.092
256emb|BX049615.1|CNS09AG3 Single read from an extremity of a full-... 46 0.092
257emb|BX049546.1|CNS09AE6 Single read from an extremity of a full-... 46 0.092
258emb|BX049524.1|CNS09ADK Single read from an extremity of a full-... 46 0.092
259emb|BX049466.1|CNS09ABY Single read from an extremity of a full-... 46 0.092
260emb|BX049240.1|CNS09A5O Single read from an extremity of a full-... 46 0.092
261emb|BX049187.1|CNS09A47 Single read from an extremity of a full-... 46 0.092
262emb|BX048525.1|CNS099LT Single read from an extremity of a full-... 46 0.092
263emb|BX048433.1|CNS099J9 Single read from an extremity of a full-... 46 0.092
264emb|BX048234.1|CNS099DQ Single read from an extremity of a full-... 46 0.092
265emb|BX048199.1|CNS099CR Single read from an extremity of a full-... 46 0.092
266emb|BX047999.1|CNS09977 Single read from an extremity of a full-... 46 0.092
267emb|BX047946.1|CNS0995Q Single read from an extremity of a full-... 46 0.092
268emb|BX047843.1|CNS0992V Single read from an extremity of a full-... 46 0.092
269emb|BX047734.1|CNS098ZU Single read from an extremity of a full-... 46 0.092
270emb|BX047732.1|CNS098ZS Single read from an extremity of a full-... 46 0.092
271emb|BX047714.1|CNS098ZA Single read from an extremity of a full-... 46 0.092
272emb|BX047691.1|CNS098YN Single read from an extremity of a full-... 46 0.092
273emb|BX047277.1|CNS098N5 Single read from an extremity of a full-... 46 0.092
274emb|BX047157.1|CNS098JT Single read from an extremity of a full-... 46 0.092
275emb|BX047017.1|CNS098FX Single read from an extremity of a full-... 46 0.092
276emb|BX046849.1|CNS098B9 Single read from an extremity of a full-... 46 0.092
277emb|BX046679.1|CNS0986J Single read from an extremity of a full-... 46 0.092
278emb|BX046353.1|CNS097XH Single read from an extremity of a full-... 46 0.092
279emb|BX046290.1|CNS097VQ Single read from an extremity of a full-... 46 0.092
280emb|BX046163.1|CNS097S7 Single read from an extremity of a full-... 46 0.092
281emb|BX046117.1|CNS097QX Single read from an extremity of a full-... 46 0.092
282emb|BX046099.1|CNS097QF Single read from an extremity of a full-... 46 0.092
283emb|BX046025.1|CNS097OD Single read from an extremity of a full-... 46 0.092
284emb|BX045705.1|CNS097FH Single read from an extremity of a full-... 46 0.092
285emb|BX045497.1|CNS0979P Single read from an extremity of a full-... 46 0.092
286emb|BX045440.1|CNS09784 Single read from an extremity of a full-... 46 0.092
287emb|BX045432.1|CNS0977W Single read from an extremity of a full-... 46 0.092
288emb|BX045074.1|CNS096XY Single read from an extremity of a full-... 46 0.092
289emb|BX045040.1|CNS096X0 Single read from an extremity of a full-... 46 0.092
290emb|BX045257.1|CNS09731 Single read from an extremity of a full-... 46 0.092
291emb|BX044857.1|CNS096RX Single read from an extremity of a full-... 46 0.092
292emb|BX044741.1|CNS096OP Single read from an extremity of a full-... 46 0.092
293emb|BX044735.1|CNS096OJ Single read from an extremity of a full-... 46 0.092
294emb|BX043090.1|CNS095EU Single read from an extremity of a full-... 46 0.092
295emb|BX043059.1|CNS095DZ Single read from an extremity of a full-... 46 0.092
296emb|BX042955.1|CNS095B3 Single read from an extremity of a full-... 46 0.092
297emb|BX044619.1|CNS096LB Single read from an extremity of a full-... 46 0.092
298emb|BX044429.1|CNS096G1 Single read from an extremity of a full-... 46 0.092
299emb|BX044185.1|CNS09699 Single read from an extremity of a full-... 46 0.092
300emb|BX044159.1|CNS0968J Single read from an extremity of a full-... 46 0.092
301emb|BX044153.1|CNS0968D Single read from an extremity of a full-... 46 0.092
302emb|BX044099.1|CNS0966V Single read from an extremity of a full-... 46 0.092
303emb|BX044052.1|CNS0965K Single read from an extremity of a full-... 46 0.092
304emb|BX044026.1|CNS0964U Single read from an extremity of a full-... 46 0.092
305emb|BX043798.1|CNS095YI Single read from an extremity of a full-... 46 0.092
306emb|BX043757.1|CNS095XD Single read from an extremity of a full-... 46 0.092
307emb|BX043472.1|CNS095PG Single read from an extremity of a full-... 46 0.092
308emb|BX043702.1|CNS095VU Single read from an extremity of a full-... 46 0.092
309emb|BX043623.1|CNS095TN Single read from an extremity of a full-... 46 0.092
310emb|BX043251.1|CNS095JB Single read from an extremity of a full-... 46 0.092
311emb|BX043128.1|CNS095FW Single read from an extremity of a full-... 46 0.092
312emb|BX043127.1|CNS095FV Single read from an extremity of a full-... 46 0.092
313emb|BX043118.1|CNS095FM Single read from an extremity of a full-... 46 0.092
314emb|BX042609.1|CNS0951H Single read from an extremity of a full-... 46 0.092
315emb|BX042524.1|CNS094Z4 Single read from an extremity of a full-... 46 0.092
316emb|BX042434.1|CNS094WM Single read from an extremity of a full-... 46 0.092
317emb|BX042404.1|CNS094VS Single read from an extremity of a full-... 46 0.092
318emb|BX042353.1|CNS094UD Single read from an extremity of a full-... 46 0.092
319emb|BX041748.1|CNS094DK Single read from an extremity of a full-... 46 0.092
320emb|BX041651.1|CNS094AV Single read from an extremity of a full-... 46 0.092
321emb|BX041602.1|CNS0949I Single read from an extremity of a full-... 46 0.092
322emb|BX041467.1|CNS0945R Single read from an extremity of a full-... 46 0.092
323emb|BX041389.1|CNS0943L Single read from an extremity of a full-... 46 0.092
324emb|BX041365.1|CNS0942X Single read from an extremity of a full-... 46 0.092
325emb|BX041135.1|CNS093WJ Single read from an extremity of a full-... 46 0.092
326emb|BX041109.1|CNS093VT Single read from an extremity of a full-... 46 0.092
327emb|BX041108.1|CNS093VS Single read from an extremity of a full-... 46 0.092
328emb|BX040887.1|CNS093PN Single read from an extremity of a full-... 46 0.092
329emb|BX040837.1|CNS093O9 Single read from an extremity of a full-... 46 0.092
330emb|BX040799.1|CNS093N7 Single read from an extremity of a full-... 46 0.092
331emb|BX040616.1|CNS093I4 Single read from an extremity of a full-... 46 0.092
332emb|BX040351.1|CNS093AR Single read from an extremity of a full-... 46 0.092
333emb|BX040297.1|CNS09399 Single read from an extremity of a full-... 46 0.092
334emb|BX040236.1|CNS0937K Single read from an extremity of a full-... 46 0.092
335emb|BX040137.1|CNS0934T Single read from an extremity of a full-... 46 0.092
336emb|BX040069.1|CNS0932X Single read from an extremity of a full-... 46 0.092
337emb|BX039907.1|CNS092YF Single read from an extremity of a full-... 46 0.092
338emb|BX039734.1|CNS092TM Single read from an extremity of a full-... 46 0.092
339emb|BX039373.1|CNS092JL Single read from an extremity of a full-... 46 0.092
340emb|BX039309.1|CNS092HT Single read from an extremity of a full-... 46 0.092
341emb|BX039262.1|CNS092GI Single read from an extremity of a full-... 46 0.092
342emb|BX037386.1|CNS0910E Single read from an extremity of a full-... 46 0.092
343emb|BX037345.1|CNS090Z9 Single read from an extremity of a full-... 46 0.092
344emb|BX037247.1|CNS090WJ Single read from an extremity of a full-... 46 0.092
345emb|BX037215.1|CNS090VN Single read from an extremity of a full-... 46 0.092
346emb|BX036759.1|CNS090IZ Single read from an extremity of a full-... 46 0.092
347emb|BX036700.1|CNS090HC Single read from an extremity of a full-... 46 0.092
348emb|BX036670.1|CNS090GI Single read from an extremity of a full-... 46 0.092
349emb|BX037189.1|CNS090UX Single read from an extremity of a full-... 46 0.092
350emb|BX037187.1|CNS090UV Single read from an extremity of a full-... 46 0.092
351emb|BX037165.1|CNS090U9 Single read from an extremity of a full-... 46 0.092
352emb|BX037106.1|CNS090SM Single read from an extremity of a full-... 46 0.092
353emb|BX037012.1|CNS090Q0 Single read from an extremity of a full-... 46 0.092
354emb|BX036831.1|CNS090KZ Single read from an extremity of a full-... 46 0.092
355emb|BX036518.1|CNS090CA Single read from an extremity of a full-... 46 0.092
356emb|BX036428.1|CNS0909S Single read from an extremity of a full-... 46 0.092
357emb|BX036405.1|CNS09095 Single read from an extremity of a full-... 46 0.092
358emb|BX036358.1|CNS0907U Single read from an extremity of a full-... 46 0.092
359emb|BX036158.1|CNS0902A Single read from an extremity of a full-... 46 0.092
360emb|BX036109.1|CNS0900X Single read from an extremity of a full-... 46 0.092
361emb|BX035782.1|CNS08ZRU Single read from an extremity of a full-... 46 0.092
362emb|BX035671.1|CNS08ZOR Single read from an extremity of a full-... 46 0.092
363emb|BX035626.1|CNS08ZNI Single read from an extremity of a full-... 46 0.092
364emb|BX035617.1|CNS08ZN9 Single read from an extremity of a full-... 46 0.092
365emb|BX035548.1|CNS08ZLC Single read from an extremity of a full-... 46 0.092
366emb|BX035515.1|CNS08ZKF Single read from an extremity of a full-... 46 0.092
367emb|BX035485.1|CNS08ZJL Single read from an extremity of a full-... 46 0.092
368emb|BX035372.1|CNS08ZGG Single read from an extremity of a full-... 46 0.092
369emb|BX035343.1|CNS08ZFN Single read from an extremity of a full-... 46 0.092
370emb|BX035328.1|CNS08ZF8 Single read from an extremity of a full-... 46 0.092
371emb|BX035267.1|CNS08ZDJ Single read from an extremity of a full-... 46 0.092
372emb|BX035228.1|CNS08ZCG Single read from an extremity of a full-... 46 0.092
373emb|BX035165.1|CNS08ZAP Single read from an extremity of a full-... 46 0.092
374emb|BX034803.1|CNS08Z0N Single read from an extremity of a full-... 46 0.092
375emb|BX034670.1|CNS08YWY Single read from an extremity of a full-... 46 0.092
376emb|BX035008.1|CNS08Z6C Single read from an extremity of a full-... 46 0.092
377emb|BX034906.1|CNS08Z3I Single read from an extremity of a full-... 46 0.092
378emb|BX034904.1|CNS08Z3G Single read from an extremity of a full-... 46 0.092
379emb|BX034886.1|CNS08Z2Y Single read from an extremity of a full-... 46 0.092
380emb|BX034882.1|CNS08Z2U Single read from an extremity of a full-... 46 0.092
381emb|BX034881.1|CNS08Z2T Single read from an extremity of a full-... 46 0.092
382emb|BX034538.1|CNS08YTA Single read from an extremity of a full-... 46 0.092
383emb|BX034506.1|CNS08YSE Single read from an extremity of a full-... 46 0.092
384emb|BX034480.1|CNS08YRO Single read from an extremity of a full-... 46 0.092
385emb|BX034370.1|CNS08YOM Single read from an extremity of a full-... 46 0.092
386emb|BX034264.1|CNS08YLO Single read from an extremity of a full-... 46 0.092
387emb|BX034229.1|CNS08YKP Single read from an extremity of a full-... 46 0.092
388emb|BX034221.1|CNS08YKH Single read from an extremity of a full-... 46 0.092
389emb|BX034196.1|CNS08YJS Single read from an extremity of a full-... 46 0.092
390emb|BX034144.1|CNS08YIC Single read from an extremity of a full-... 46 0.092
391emb|BX034142.1|CNS08YIA Single read from an extremity of a full-... 46 0.092
392emb|BX034126.1|CNS08YHU Single read from an extremity of a full-... 46 0.092
393emb|BX034110.1|CNS08YHE Single read from an extremity of a full-... 46 0.092
394emb|BX034108.1|CNS08YHC Single read from an extremity of a full-... 46 0.092
395emb|BX034106.1|CNS08YHA Single read from an extremity of a full-... 46 0.092
396emb|BX034010.1|CNS08YEM Single read from an extremity of a full-... 46 0.092
397emb|BX034008.1|CNS08YEK Single read from an extremity of a full-... 46 0.092
398emb|BX033976.1|CNS08YDO Single read from an extremity of a full-... 46 0.092
399emb|BX033938.1|CNS08YCM Single read from an extremity of a full-... 46 0.092
400emb|BX033860.1|CNS08YAG Single read from an extremity of a full-... 46 0.092
401emb|BX033846.1|CNS08YA2 Single read from an extremity of a full-... 46 0.092
402emb|BX033821.1|CNS08Y9D Single read from an extremity of a full-... 46 0.092
403emb|BX033820.1|CNS08Y9C Single read from an extremity of a full-... 46 0.092
404emb|BX033818.1|CNS08Y9A Single read from an extremity of a full-... 46 0.092
405emb|BX033673.1|CNS08Y59 Single read from an extremity of a full-... 46 0.092
406emb|BX033647.1|CNS08Y4J Single read from an extremity of a full-... 46 0.092
407emb|BX033618.1|CNS08Y3Q Single read from an extremity of a full-... 46 0.092
408emb|BX033569.1|CNS08Y2D Single read from an extremity of a full-... 46 0.092
409emb|BX033479.1|CNS08XZV Single read from an extremity of a full-... 46 0.092
410emb|BX033311.1|CNS08XV7 Single read from an extremity of a full-... 46 0.092
411emb|BX033238.1|CNS08XT6 Single read from an extremity of a full-... 46 0.092
412emb|BX033237.1|CNS08XT5 Single read from an extremity of a full-... 46 0.092
413emb|BX033218.1|CNS08XSM Single read from an extremity of a full-... 46 0.092
414emb|BX033076.1|CNS08XOO Single read from an extremity of a full-... 46 0.092
415emb|BX033023.1|CNS08XN7 Single read from an extremity of a full-... 46 0.092
416emb|BX032861.1|CNS08XIP Single read from an extremity of a full-... 46 0.092
417emb|BX032848.1|CNS08XIC Single read from an extremity of a full-... 46 0.092
418emb|BX032759.1|CNS08XFV Single read from an extremity of a full-... 46 0.092
419emb|BX032572.1|CNS08XAO Single read from an extremity of a full-... 46 0.092
420emb|BX032456.1|CNS08X7G Single read from an extremity of a full-... 46 0.092
421emb|BX032454.1|CNS08X7E Single read from an extremity of a full-... 46 0.092
422emb|BX032379.1|CNS08X5B Single read from an extremity of a full-... 46 0.092
423emb|BX032309.1|CNS08X3D Single read from an extremity of a full-... 46 0.092
424emb|BX032149.1|CNS08WYX Single read from an extremity of a full-... 46 0.092
425emb|BX032101.1|CNS08WXL Single read from an extremity of a full-... 46 0.092
426emb|BX032100.1|CNS08WXK Single read from an extremity of a full-... 46 0.092
427emb|BX031868.1|CNS08WR4 Single read from an extremity of a full-... 46 0.092
428emb|BX031826.1|CNS08WPY Single read from an extremity of a full-... 46 0.092
429emb|BX031749.1|CNS08WNT Single read from an extremity of a full-... 46 0.092
430emb|BX031528.1|CNS08WHO Single read from an extremity of a full-... 46 0.092
431emb|BX031481.1|CNS08WGD Single read from an extremity of a full-... 46 0.092
432emb|BX031424.1|CNS08WES Single read from an extremity of a full-... 46 0.092
433emb|BX031365.1|CNS08WD5 Single read from an extremity of a full-... 46 0.092
434emb|BX031330.1|CNS08WC6 Single read from an extremity of a full-... 46 0.092
435emb|BX030842.1|CNS08VYM Single read from an extremity of a full-... 46 0.092
436emb|BX030693.1|CNS08VUH Single read from an extremity of a full-... 46 0.092
437emb|BX031290.1|CNS08WB2 Single read from an extremity of a full-... 46 0.092
438emb|BX031264.1|CNS08WAC Single read from an extremity of a full-... 46 0.092
439emb|BX031187.1|CNS08W87 Single read from an extremity of a full-... 46 0.092
440emb|BX031162.1|CNS08W7I Single read from an extremity of a full-... 46 0.092
441emb|BX031150.1|CNS08W76 Single read from an extremity of a full-... 46 0.092
442emb|BX030510.1|CNS08VPE Single read from an extremity of a full-... 46 0.092
443emb|BX030498.1|CNS08VP2 Single read from an extremity of a full-... 46 0.092
444emb|BX030436.1|CNS08VNC Single read from an extremity of a full-... 46 0.092
445emb|BX030414.1|CNS08VMQ Single read from an extremity of a full-... 46 0.092
446emb|BX030353.1|CNS08VL1 Single read from an extremity of a full-... 46 0.092
447emb|BX030216.1|CNS08VH8 Single read from an extremity of a full-... 46 0.092
448emb|BX030189.1|CNS08VGH Single read from an extremity of a full-... 46 0.092
449emb|BX030043.1|CNS08VCF Single read from an extremity of a full-... 46 0.092
450emb|BX030039.1|CNS08VCB Single read from an extremity of a full-... 46 0.092
451emb|BX029932.1|CNS08V9C Single read from an extremity of a full-... 46 0.092
452emb|BX029856.1|CNS08V78 Single read from an extremity of a full-... 46 0.092
453emb|BX029781.1|CNS08V55 Single read from an extremity of a full-... 46 0.092
454emb|BX029776.1|CNS08V50 Single read from an extremity of a full-... 46 0.092
455emb|BX029391.1|CNS08UUB Single read from an extremity of a full-... 46 0.092
456emb|BX029322.1|CNS08USE Single read from an extremity of a full-... 46 0.092
457emb|BX029190.1|CNS08UOQ Single read from an extremity of a full-... 46 0.092
458emb|BX029189.1|CNS08UOP Single read from an extremity of a full-... 46 0.092
459emb|BX029177.1|CNS08UOD Single read from an extremity of a full-... 46 0.092
460emb|BX029754.1|CNS08V4E Single read from an extremity of a full-... 46 0.092
461emb|BX029752.1|CNS08V4C Single read from an extremity of a full-... 46 0.092
462emb|BX029599.1|CNS08V03 Single read from an extremity of a full-... 46 0.092
463emb|BX029095.1|CNS08UM3 Single read from an extremity of a full-... 46 0.092
464emb|BX028997.1|CNS08UJD Single read from an extremity of a full-... 46 0.092
465emb|BX028987.1|CNS08UJ3 Single read from an extremity of a full-... 46 0.092
466emb|BX028918.1|CNS08UH6 Single read from an extremity of a full-... 46 0.092
467emb|BX028886.1|CNS08UGA Single read from an extremity of a full-... 46 0.092
468emb|BX028727.1|CNS08UBV Single read from an extremity of a full-... 46 0.092
469emb|BX028691.1|CNS08UAV Single read from an extremity of a full-... 46 0.092
470emb|BX028689.1|CNS08UAT Single read from an extremity of a full-... 46 0.092
471emb|BX028609.1|CNS08U8L Single read from an extremity of a full-... 46 0.092
472emb|BX028582.1|CNS08U7U Single read from an extremity of a full-... 46 0.092
473emb|BX022309.1|CNS08PDL Single read from an extremity of a full-... 46 0.092
474emb|BX022280.1|CNS08PCS Single read from an extremity of a full-... 46 0.092
475emb|BX022279.1|CNS08PCR Single read from an extremity of a full-... 46 0.092
476emb|BX028394.1|CNS08U2M Single read from an extremity of a full-... 46 0.092
477emb|BX028306.1|CNS08U06 Single read from an extremity of a full-... 46 0.092
478emb|BX028287.1|CNS08TZN Single read from an extremity of a full-... 46 0.092
479emb|BX028182.1|CNS08TWQ Single read from an extremity of a full-... 46 0.092
480emb|BX028181.1|CNS08TWP Single read from an extremity of a full-... 46 0.092
481emb|BX028180.1|CNS08TWO Single read from an extremity of a full-... 46 0.092
482emb|BX028178.1|CNS08TWM Single read from an extremity of a full-... 46 0.092
483emb|BX028050.1|CNS08TT2 Single read from an extremity of a full-... 46 0.092
484emb|BX027882.1|CNS08TOE Single read from an extremity of a full-... 46 0.092
485emb|BX027773.1|CNS08TLD Single read from an extremity of a full-... 46 0.092
486emb|BX027701.1|CNS08TJD Single read from an extremity of a full-... 46 0.092
487emb|BX027697.1|CNS08TJ9 Single read from an extremity of a full-... 46 0.092
488emb|BX027691.1|CNS08TJ3 Single read from an extremity of a full-... 46 0.092
489emb|BX027598.1|CNS08TGI Single read from an extremity of a full-... 46 0.092
490emb|BX027520.1|CNS08TEC Single read from an extremity of a full-... 46 0.092
491emb|BX027504.1|CNS08TDW Single read from an extremity of a full-... 46 0.092
492emb|BX027388.1|CNS08TAO Single read from an extremity of a full-... 46 0.092
493emb|BX027364.1|CNS08TA0 Single read from an extremity of a full-... 46 0.092
494emb|BX027329.1|CNS08T91 Single read from an extremity of a full-... 46 0.092
495emb|BX027328.1|CNS08T90 Single read from an extremity of a full-... 46 0.092
496emb|BX027316.1|CNS08T8O Single read from an extremity of a full-... 46 0.092
497emb|BX027279.1|CNS08T7N Single read from an extremity of a full-... 46 0.092
498emb|BX027154.1|CNS08T46 Single read from an extremity of a full-... 46 0.092
499emb|BX027074.1|CNS08T1Y Single read from an extremity of a full-... 46 0.092
500emb|BX027064.1|CNS08T1O Single read from an extremity of a full-... 46 0.092

>ref|XM_479931.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1236

 Score =  347 bits (175), Expect = 2e-92
 Identities = 262/291 (90%)
 Strand = Plus / Plus

                                                                       
Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 128 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 187

                                                                       
Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 188 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 247

                                                                       
Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 248 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 307

                                                                       
Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 308 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 367

                                                              
Query: 374 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtg 424
           ||||||    |||||||||||| ||||||||||||||||||||||||||||
Sbjct: 368 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtg 418



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                    
Query: 1  aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 42
          ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 2  aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 43



to top

>dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK704 mRNA for acidic
           ribosomal protein P0, complete cds
          Length = 1220

 Score =  347 bits (175), Expect = 2e-92
 Identities = 262/291 (90%)
 Strand = Plus / Plus

                                                                       
Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 110 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 169

                                                                       
Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 170 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 229

                                                                       
Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 230 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 289

                                                                       
Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 290 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 349

                                                              
Query: 374 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtg 424
           ||||||    |||||||||||| ||||||||||||||||||||||||||||
Sbjct: 350 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtg 400



to top

>dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000H12, full
           insert sequence
          Length = 1236

 Score =  347 bits (175), Expect = 2e-92
 Identities = 262/291 (90%)
 Strand = Plus / Plus

                                                                       
Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 128 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 187

                                                                       
Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 188 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 247

                                                                       
Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 248 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 307

                                                                       
Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 308 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 367

                                                              
Query: 374 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtg 424
           ||||||    |||||||||||| ||||||||||||||||||||||||||||
Sbjct: 368 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtg 418



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                    
Query: 1  aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 42
          ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 2  aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 43



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  297 bits (150), Expect = 2e-77
 Identities = 222/246 (90%)
 Strand = Plus / Minus

                                                                           
Query: 134     cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193
               ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 1716667 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 1716608

                                                                           
Query: 194     agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253
               || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 1716607 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 1716548

                                                                           
Query: 254     agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313
               |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 1716547 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 1716488

                                                                           
Query: 314     ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373
               |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 1716487 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 1716428

                     
Query: 374     agctca 379
               ||||||
Sbjct: 1716427 agctca 1716422



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Minus

                                                         
Query: 1       aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 42
               ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1716793 aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 1716752



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                           
Query: 397     aacgttggcctcatcttcaccaagggtg 424
               ||||||||||||||||||||||||||||
Sbjct: 1716313 aacgttggcctcatcttcaccaagggtg 1716286



to top

>dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0582D05
          Length = 150483

 Score =  297 bits (150), Expect = 2e-77
 Identities = 222/246 (90%)
 Strand = Plus / Minus

                                                                          
Query: 134    cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193
              ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 116167 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 116108

                                                                          
Query: 194    agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253
              || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 116107 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 116048

                                                                          
Query: 254    agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313
              |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 116047 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 115988

                                                                          
Query: 314    ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 373
              |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 115987 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 115928

                    
Query: 374    agctca 379
              ||||||
Sbjct: 115927 agctca 115922



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 41/42 (97%)
 Strand = Plus / Minus

                                                        
Query: 1      aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 42
              ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 116293 aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 116252



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 397    aacgttggcctcatcttcaccaagggtg 424
              ||||||||||||||||||||||||||||
Sbjct: 115813 aacgttggcctcatcttcaccaagggtg 115786



to top

>gb|AC123528.2| Oryza sativa chromosome 11 clone  OSJNBa0078E03, complete sequence
          Length = 149493

 Score =  278 bits (140), Expect = 1e-71
 Identities = 218/244 (89%)
 Strand = Plus / Minus

                                                                        
Query: 136  atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195
            |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 5848 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 5789

                                                                        
Query: 196  ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255
             | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 5788 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 5729

                                                                        
Query: 256  ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315
            || ||||||||||||||||| ||| | || ||||||||||| ||||||||||||||||||
Sbjct: 5728 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 5669

                                                                        
Query: 316  ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375
            || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 5668 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 5609

                
Query: 376  ctca 379
            ||||
Sbjct: 5608 ctca 5605



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 397  aacgttggcctcatcttcaccaagggtg 424
            |||||||| |||||||||||||||||||
Sbjct: 5485 aacgttggtctcatcttcaccaagggtg 5458



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  278 bits (140), Expect = 1e-71
 Identities = 218/244 (89%)
 Strand = Plus / Minus

                                                                           
Query: 136     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1650134 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1650075

                                                                           
Query: 196     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1650074 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1650015

                                                                           
Query: 256     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315
               || ||||||||||||||||| ||| | || ||||||||||| ||||||||||||||||||
Sbjct: 1650014 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 1649955

                                                                           
Query: 316     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1649954 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1649895

                   
Query: 376     ctca 379
               ||||
Sbjct: 1649894 ctca 1649891



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                           
Query: 397     aacgttggcctcatcttcaccaagggtg 424
               |||||||| |||||||||||||||||||
Sbjct: 1649771 aacgttggtctcatcttcaccaagggtg 1649744



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  278 bits (140), Expect = 1e-71
 Identities = 218/244 (89%)
 Strand = Plus / Minus

                                                                           
Query: 136     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1647855 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1647796

                                                                           
Query: 196     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1647795 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1647736

                                                                           
Query: 256     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315
               || ||||||||||||||||| ||| | || ||||||||||| ||||||||||||||||||
Sbjct: 1647735 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 1647676

                                                                           
Query: 316     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1647675 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1647616

                   
Query: 376     ctca 379
               ||||
Sbjct: 1647615 ctca 1647612



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                           
Query: 397     aacgttggcctcatcttcaccaagggtg 424
               |||||||| |||||||||||||||||||
Sbjct: 1647492 aacgttggtctcatcttcaccaagggtg 1647465



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  270 bits (136), Expect = 3e-69
 Identities = 217/244 (88%)
 Strand = Plus / Minus

                                                                           
Query: 136     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1603328 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1603269

                                                                           
Query: 196     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1603268 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1603209

                                                                           
Query: 256     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315
               || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 1603208 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 1603149

                                                                           
Query: 316     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1603148 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1603089

                   
Query: 376     ctca 379
               ||||
Sbjct: 1603088 ctca 1603085



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                              
Query: 394     ggtaacgttggcctcatcttcaccaagggtg 424
               ||||||||||| |||||||||||||||||||
Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtg 1602958



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  270 bits (136), Expect = 3e-69
 Identities = 217/244 (88%)
 Strand = Plus / Minus

                                                                           
Query: 136     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1603328 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1603269

                                                                           
Query: 196     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1603268 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1603209

                                                                           
Query: 256     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315
               || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 1603208 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 1603149

                                                                           
Query: 316     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1603148 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1603089

                   
Query: 376     ctca 379
               ||||
Sbjct: 1603088 ctca 1603085



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                              
Query: 394     ggtaacgttggcctcatcttcaccaagggtg 424
               ||||||||||| |||||||||||||||||||
Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtg 1602958



to top

>emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575_G05 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 91883

 Score =  270 bits (136), Expect = 3e-69
 Identities = 217/244 (88%)
 Strand = Plus / Plus

                                                                         
Query: 136   atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195
             |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 89594 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 89653

                                                                         
Query: 196   ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255
              | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 89654 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 89713

                                                                         
Query: 256   ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315
             || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 89714 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 89773

                                                                         
Query: 316   ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375
             || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 89774 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 89833

                 
Query: 376   ctca 379
             ||||
Sbjct: 89834 ctca 89837



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                            
Query: 394   ggtaacgttggcctcatcttcaccaagggtg 424
             ||||||||||| |||||||||||||||||||
Sbjct: 89934 ggtaacgttggtctcatcttcaccaagggtg 89964



to top

>emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa0009F13 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 183385

 Score =  270 bits (136), Expect = 3e-69
 Identities = 217/244 (88%)
 Strand = Plus / Plus

                                                                         
Query: 136   atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195
             |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 22404 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 22463

                                                                         
Query: 196   ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255
              | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 22464 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 22523

                                                                         
Query: 256   ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315
             || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 22524 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 22583

                                                                         
Query: 316   ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 375
             || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 22584 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 22643

                 
Query: 376   ctca 379
             ||||
Sbjct: 22644 ctca 22647



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                            
Query: 394   ggtaacgttggcctcatcttcaccaagggtg 424
             ||||||||||| |||||||||||||||||||
Sbjct: 22744 ggtaacgttggtctcatcttcaccaagggtg 22774



to top

>gb|BT016531.1| Zea mays clone Contig364 mRNA sequence
          Length = 1230

 Score =  194 bits (98), Expect = 2e-46
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                       
Query: 136 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 195
           |||||||||||| |||||||||| ||||||||||||||||||||| ||||||| |||   
Sbjct: 114 atggcgatcaagcggaccaaggcggagaagaagatcgcgtacgacaagaagctgtgcagc 173

                                                                       
Query: 196 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 255
            ||||||| |||||||||||||||||||||||| |||||||||| ||||| |||||||||
Sbjct: 174 ctgctcgatgagtacaccaaggtgctcatcgccctcgccgacaacgtcggttccaagcag 233

                                                                       
Query: 256 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 315
           |||||||| ||||||  ||| ||| | || |||||  | ||||||||||| |||||||| 
Sbjct: 234 ctccaggacatccgccggggcctcaggggcgactcggtggtgctcatggggaagaacacg 293

                                                 
Query: 316 ctgatccgccgctgcatcaaggtgcactcggagaagac 353
           || ||| | ||||||||||||||| || | ||||||||
Sbjct: 294 ctcatcaggcgctgcatcaaggtgtacgccgagaagac 331



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 383 acctcctcgtcggtaacgttggcctcatcttcaccaaggg 422
           ||||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 361 acctcctggtcggcaacgtaggcctcatcttcaccaaggg 400



to top

>emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0
          Length = 1253

 Score =  174 bits (88), Expect = 2e-40
 Identities = 187/220 (85%)
 Strand = Plus / Plus

                                                                       
Query: 134 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 193
           |||||||||||||| |||| ||||| ||||||||||||||||||||| ||||||| ||| 
Sbjct: 131 cgatggcgatcaagcggactaaggcggagaagaagatcgcgtacgacaagaagctgtgca 190

                                                                       
Query: 194 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 253
              ||||||| |||||||||||||||||||||||| | |||||||| ||||| |||||||
Sbjct: 191 gcctgctcgatgagtacaccaaggtgctcatcgccctggccgacaacgtcggttccaagc 250

                                                                       
Query: 254 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 313
           |||||||||| ||||||  ||| ||| | || |||||  | ||||||||||| |||||||
Sbjct: 251 agctccaggacatccgccggggcctcaggggcgactcggtggtgctcatggggaagaaca 310

                                                   
Query: 314 ccctgatccgccgctgcatcaaggtgcactcggagaagac 353
           | || ||| | || |||||||||||| || | ||||||||
Sbjct: 311 cgctcatcaggcgttgcatcaaggtgtacgccgagaagac 350



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 37/37 (100%)
 Strand = Plus / Plus

                                               
Query: 1  aggttaaagcgacgccgccgccgcaagccgtccgcct 37
          |||||||||||||||||||||||||||||||||||||
Sbjct: 2  aggttaaagcgacgccgccgccgcaagccgtccgcct 38



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 383 acctcctcgtcggtaacgttggcctcatcttcaccaaggg 422
           ||||||| ||||| ||||| ||||||||||||||||||||
Sbjct: 380 acctcctggtcggcaacgtaggcctcatcttcaccaaggg 419



to top

>emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein
          Length = 1332

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 151 accaaggccgagaagaagatcgcgtacgaccagaagctctgcca 194
           |||||||| |||||||||||||| ||||| |||||||| |||||
Sbjct: 255 accaaggctgagaagaagatcgcatacgatcagaagctatgcca 298



to top

>gb|AY880417.1| Gekko japonicus GekBS186P mRNA, complete cds
          Length = 1118

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 235 gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactccatc 294
           |||||||| |||||||||||| | ||| ||||||||| |  |||||||||  |  || | 
Sbjct: 147 gacaatgtgggctccaagcagatgcagcagatccgcatgtctctccgcgggaaagccgtg 206

                                     
Query: 295 gtgctcatgggcaagaacaccctgat 320
           ||||| ||||||||||||||| ||||
Sbjct: 207 gtgctgatgggcaagaacaccatgat 232



to top

>dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acidic ribosomal
           protein P0, partial cds
          Length = 820

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 154 aaggccgagaagaagatcgcgtacgaccagaagctctgccag 195
           ||||| || ||||||||||| ||||| |||||||||||||||
Sbjct: 226 aaggctgataagaagatcgcttacgatcagaagctctgccag 267



to top

>emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ribosomal protein
           (rpp0 gene)
          Length = 608

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 292 atcgtgctcatgggcaagaacaccctgat 320
           |||||||||||||||||||||||| ||||
Sbjct: 154 atcgtgctcatgggcaagaacaccatgat 182



to top

>gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, complete cds
          Length = 1081

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 292 atcgtgctcatgggcaagaacaccctgat 320
           |||||||||||||||||||||||| ||||
Sbjct: 227 atcgtgctcatgggcaagaacaccatgat 255



to top

>dbj|AB113109.1| Aotus trivirgatus Aotr-B1 gene for MHC class I antigen, partial cds
            and promoter region
          Length = 3861

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 235  gacaatgtcggctccaagcagctccaggagatccgca 271
            |||||||| |||||||||||| | |||||||||||||
Sbjct: 1649 gacaatgtgggctccaagcagatgcaggagatccgca 1685



to top

>ref|XM_787003.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic
           ribosomal phosphoprotein P0 (LOC587264), mRNA
          Length = 533

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 293 tcgtgctcatgggcaagaacaccctgatccgc 324
           |||| |||||||||||||||||| ||||||||
Sbjct: 196 tcgtcctcatgggcaagaacaccatgatccgc 227



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 235 gacaatgtcggctccaagcag 255
           |||||||||||||||||||||
Sbjct: 138 gacaatgtcggctccaagcag 158



to top

>emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX019003.1|CNS08MTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 290 ccatcgtgctcatgggcaagaacaccctgatccgcc 325
           |||||||||| ||||||||||||||| |||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgatgcgcc 271



to top

>emb|BX018793.1|CNS08MNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX013777.1|CNS08ISL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 211 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX006032.1|CNS08CTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 200 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 243



to top

>emb|BX005998.1|CNS08CSI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 277 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 214 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 257



to top

>ref|XM_789716.1| PREDICTED: Strongylocentrotus purpuratus similar to acidic
           ribosomal phosphoprotein P0 (LOC590099), mRNA
          Length = 198

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 293 tcgtgctcatgggcaagaacaccctgatccgc 324
           |||| |||||||||||||||||| ||||||||
Sbjct: 119 tcgtcctcatgggcaagaacaccatgatccgc 150



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 235 gacaatgtcggctccaagcag 255
           |||||||||||||||||||||
Sbjct: 61  gacaatgtcggctccaagcag 81



to top

>gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA, complete cds
          Length = 1247

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 253 cagctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaac 312
           ||||||||| | || ||||||||||| ||||| |||||  | || |||||||| ||||||
Sbjct: 245 cagctccagaacattcgcaagggtcttcgcggcgactctgttgtcctcatggggaagaac 304

                   
Query: 313 accctgat 320
           ||| ||||
Sbjct: 305 accatgat 312



 Score = 44.1 bits (22), Expect = 0.36
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 150 gaccaaggccgagaagaagatcgcgtacga 179
           ||||||||| |||||||||||||| |||||
Sbjct: 142 gaccaaggctgagaagaagatcgcttacga 171



to top

>emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX072146.1|CNS09RTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX072055.1|CNS09RRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX072031.1|CNS09RQR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX071993.1|CNS09RPP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276



to top

>emb|BX071847.1|CNS09RLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX071747.1|CNS09RIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX071518.1|CNS09RCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 290

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 91  ccatcgtgctgatgggcaagaacaccatgat 121



to top

>emb|BX071226.1|CNS09R4E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX071445.1|CNS09RAH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX071386.1|CNS09R8U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071251.1|CNS09R53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX070973.1|CNS09QXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX070900.1|CNS09QVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 55  ccatcgtgctgatgggcaagaacaccatgat 85



to top

>emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 102 ccatcgtgctgatgggcaagaacaccatgat 132



to top

>emb|BX070622.1|CNS09QNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX070541.1|CNS09QLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX061090.1|CNS09JAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1063

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX061042.1|CNS09J9I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX069588.1|CNS09PUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX069403.1|CNS09PPR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX069336.1|CNS09PNW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249



to top

>emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX069142.1|CNS09PII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX068833.1|CNS09P9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 253 ccatcgtgctgatgggcaagaacaccatgat 283



to top

>emb|BX068815.1|CNS09P9F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX068760.1|CNS09P7W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 245 ccatcgtgctgatgggcaagaacaccatgat 275



to top

>emb|BX068607.1|CNS09P3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX068471.1|CNS09OZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX068019.1|CNS09ONB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX067891.1|CNS09OJR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 374

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 52  ccatcgtgctgatgggcaagaacaccatgat 82



to top

>emb|BX067841.1|CNS09OID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX067819.1|CNS09OHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 335

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX067752.1|CNS09OFW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX067707.1|CNS09OEN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX067564.1|CNS09OAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 340

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 149 ccatcgtgctgatgggcaagaacaccatgat 179



to top

>emb|BX067487.1|CNS09O8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX067429.1|CNS09O6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX066992.1|CNS09NUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234



to top

>emb|BX067216.1|CNS09O10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066854.1|CNS09NQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 240 ccatcgtgctgatgggcaagaacaccatgat 270



to top

>emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 203 ccatcgtgctgatgggcaagaacaccatgat 233



to top

>emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 222 ccatcgtgctgatgggcaagaacaccatgat 252



to top

>emb|BX066597.1|CNS09NJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX066412.1|CNS09NEO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 540

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX066329.1|CNS09NCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237



to top

>emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX065714.1|CNS09MVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 850 ccatcgtgctgatgggcaagaacaccatgat 820



to top

>emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX065465.1|CNS09MOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 201 ccatcgtgctgatgggcaagaacaccatgat 231



to top

>emb|BX065359.1|CNS09MLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 500

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX065269.1|CNS09MIX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201



to top

>emb|BX065249.1|CNS09MID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX065042.1|CNS09MCM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 104 ccatcgtgctgatgggcaagaacaccatgat 134



to top

>emb|BX065015.1|CNS09MBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX065006.1|CNS09MBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 771 ccatcgtgctgatgggcaagaacaccatgat 741



to top

>emb|BX065005.1|CNS09MBL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 311 ccatcgtgctgatgggcaagaacaccatgat 341



to top

>emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1073

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX064796.1|CNS09M5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 304

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064760.1|CNS09M4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064725.1|CNS09M3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX064530.1|CNS09LYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 467

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064423.1|CNS09LVF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 380

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX064284.1|CNS09LRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 790 ccatcgtgctgatgggcaagaacaccatgat 760



to top

>emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX064068.1|CNS09LLK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX063577.1|CNS09L7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 439

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 92  ccatcgtgctgatgggcaagaacaccatgat 122



to top

>emb|BX063467.1|CNS09L4V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 884 ccatcgtgctgatgggcaagaacaccatgat 854



to top

>emb|BX063466.1|CNS09L4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 198

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063420.1|CNS09L3K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 199 ccatcgtgctgatgggcaagaacaccatgat 229



to top

>emb|BX062552.1|CNS09KFG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX062546.1|CNS09KFA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 103 ccatcgtgctgatgggcaagaacaccatgat 133



to top

>emb|BX062387.1|CNS09KAV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX062299.1|CNS09K8F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 176 ccatcgtgctgatgggcaagaacaccatgat 206



to top

>emb|BX062297.1|CNS09K8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX062183.1|CNS09K57 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1052

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX062169.1|CNS09K4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX062048.1|CNS09K1G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235



to top

>emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX061190.1|CNS09JDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX061164.1|CNS09JCW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 785 ccatcgtgctgatgggcaagaacaccatgat 755



to top

>emb|BX061163.1|CNS09JCV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX060642.1|CNS09IYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 172 ccatcgtgctgatgggcaagaacaccatgat 202



to top

>emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 786 ccatcgtgctgatgggcaagaacaccatgat 756



to top

>emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 326 ccatcgtgctgatgggcaagaacaccatgat 356



to top

>emb|BX060443.1|CNS09ISV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1047

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX060185.1|CNS09ILP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1050

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX059866.1|CNS09ICU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX059758.1|CNS09I9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX059741.1|CNS09I9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269



to top

>emb|BX059642.1|CNS09I6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 430

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232



to top

>emb|BX059587.1|CNS09I53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX059585.1|CNS09I51 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 152 ccatcgtgctgatgggcaagaacaccatgat 182



to top

>emb|BX059469.1|CNS09I1T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 108 ccatcgtgctgatgggcaagaacaccatgat 138



to top

>emb|BX059220.1|CNS09HUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX059184.1|CNS09HTW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX059095.1|CNS09HRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235



to top

>emb|BX058839.1|CNS09HKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1035

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX058740.1|CNS09HHK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237



to top

>emb|BX058315.1|CNS09H5R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 557

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 217 ccatcgtgctgatgggcaagaacaccatgat 247



to top

>emb|BX058203.1|CNS09H2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX056754.1|CNS09FYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201



to top

>emb|BX057924.1|CNS09GUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 269



to top

>emb|BX057796.1|CNS09GRC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX057631.1|CNS09GMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 415

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 88  ccatcgtgctgatgggcaagaacaccatgat 118



to top

>emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 480

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 159

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 87  ccatcgtgctgatgggcaagaacaccatgat 117



to top

>emb|BX057218.1|CNS09GBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX057133.1|CNS09G8X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX057094.1|CNS09G7U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 287

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX057074.1|CNS09G7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 457

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 202 ccatcgtgctgatgggcaagaacaccatgat 232



to top

>emb|BX056996.1|CNS09G54 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX056958.1|CNS09G42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX056914.1|CNS09G2U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX056483.1|CNS09FQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 162 ccatcgtgctgatgggcaagaacaccatgat 192



to top

>emb|BX055960.1|CNS09FCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX055808.1|CNS09F84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276



to top

>emb|BX056320.1|CNS09FMC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX056288.1|CNS09FLG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 889 ccatcgtgctgatgggcaagaacaccatgat 859



to top

>emb|BX056287.1|CNS09FLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX056283.1|CNS09FLB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 98  ccatcgtgctgatgggcaagaacaccatgat 128



to top

>emb|BX055999.1|CNS09FDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 190 ccatcgtgctgatgggcaagaacaccatgat 220



to top

>emb|BX055725.1|CNS09F5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX055721.1|CNS09F5P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272



to top

>emb|BX055621.1|CNS09F2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 450

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX055603.1|CNS09F2F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 599

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX055567.1|CNS09F1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 242 ccatcgtgctgatgggcaagaacaccatgat 272



to top

>emb|BX053214.1|CNS09D82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX053185.1|CNS09D79 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 362

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX053146.1|CNS09D66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX052948.1|CNS09D0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 210 ccatcgtgctgatgggcaagaacaccatgat 240



to top

>emb|BX052946.1|CNS09D0M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX054345.1|CNS09E3H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 188 ccatcgtgctgatgggcaagaacaccatgat 218



to top

>emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX053890.1|CNS09DQU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 800 ccatcgtgctgatgggcaagaacaccatgat 770



to top

>emb|BX053889.1|CNS09DQT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 282 ccatcgtgctgatgggcaagaacaccatgat 312



to top

>emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 248 ccatcgtgctgatgggcaagaacaccatgat 278



to top

>emb|BX053704.1|CNS09DLO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX053693.1|CNS09DLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 243 ccatcgtgctgatgggcaagaacaccatgat 273



to top

>emb|BX053532.1|CNS09DGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX052874.1|CNS09CYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX052836.1|CNS09CXK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 239 ccatcgtgctgatgggcaagaacaccatgat 209



to top

>emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 772

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX052777.1|CNS09CVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234



to top

>emb|BX052724.1|CNS09CUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX052368.1|CNS09CKK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX052263.1|CNS09CHN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX052235.1|CNS09CGV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 289

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249



to top

>emb|BX052085.1|CNS09CCP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1013

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX052064.1|CNS09CC4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 113 ccatcgtgctgatgggcaagaacaccatgat 143



to top

>emb|BX052006.1|CNS09CAI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 217 ccatcgtgctgatgggcaagaacaccatgat 247



to top

>emb|BX051964.1|CNS09C9C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 512

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 97  ccatcgtgctgatgggcaagaacaccatgat 127



to top

>emb|BX051899.1|CNS09C7J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX051866.1|CNS09C6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 213 ccatcgtgctgatgggcaagaacaccatgat 243



to top

>emb|BX051626.1|CNS09BZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 405

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 212 ccatcgtgctgatgggcaagaacaccatgat 242



to top

>emb|BX051618.1|CNS09BZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 679

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 198 ccatcgtgctgatgggcaagaacaccatgat 228



to top

>emb|BX051600.1|CNS09BZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 95  ccatcgtgctgatgggcaagaacaccatgat 125



to top

>emb|BX051577.1|CNS09BYL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1080

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX051509.1|CNS09BWP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX051472.1|CNS09BVO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX051379.1|CNS09BT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 382

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 185 ccatcgtgctgatgggcaagaacaccatgat 215



to top

>emb|BX051301.1|CNS09BQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX050244.1|CNS09AXK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 503

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX050212.1|CNS09AWO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 736

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 213 ccatcgtgctgatgggcaagaacaccatgat 243



to top

>emb|BX050202.1|CNS09AWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 197

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 8   ccatcgtgctgatgggcaagaacaccatgat 38



to top

>emb|BX050196.1|CNS09AW8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249



to top

>emb|BX050804.1|CNS09BD4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 915

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 181 ccatcgtgctgatgggcaagaacaccatgat 211



to top

>emb|BX050797.1|CNS09BCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 222 ccatcgtgctgatgggcaagaacaccatgat 252



to top

>emb|BX050762.1|CNS09BBY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 232 ccatcgtgctgatgggcaagaacaccatgat 262



to top

>emb|BX050723.1|CNS09BAV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX050711.1|CNS09BAJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX050679.1|CNS09B9N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX050552.1|CNS09B64 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 611

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX050545.1|CNS09B5X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX050514.1|CNS09B52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 627

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX050479.1|CNS09B43 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX050437.1|CNS09B2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX050412.1|CNS09B28 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 210 ccatcgtgctgatgggcaagaacaccatgat 240



to top

>emb|BX050290.1|CNS09AYU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX049856.1|CNS09AMS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 217 ccatcgtgctgatgggcaagaacaccatgat 247



to top

>emb|BX049758.1|CNS09AK2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 290 ccatcgtgctcatgggcaagaacaccctgat 320
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,232,757
Number of Sequences: 3902068
Number of extensions: 3232757
Number of successful extensions: 74695
Number of sequences better than 10.0: 1016
Number of HSP's better than 10.0 without gapping: 1015
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 72132
Number of HSP's gapped (non-prelim): 2556
length of query: 424
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 402
effective length of database: 17,147,199,772
effective search space: 6893174308344
effective search space used: 6893174308344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top