Clone Information

BLAST Search Result

Clone Name	bart59h11
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AF247652.1\|AF247652 Mus musculus complement regulatory protei...	48	0.018
2	gb\|AF292401.2\| Mus musculus CD59B (CD59B) and CD59A (CD59A) gene...	48	0.018
3	ref\|NM_103628.3\| Arabidopsis thaliana unknown protein AT1G47340 ...	46	0.070
4	ref\|NM_119571.2\| Arabidopsis thaliana protein binding / ubiquiti...	46	0.070
5	ref\|NM_103627.3\| Arabidopsis thaliana unknown protein AT1G47330 ...	46	0.070
6	gb\|AC142244.11\| Mus musculus chromosome 1, clone RP23-79H24, com...	46	0.070
7	ref\|XM_637419.1\| Dictyostelium discoideum hypothetical protein (...	46	0.070
8	gb\|AC163032.5\| Mus musculus BAC clone RP24-144G20 from chromosom...	46	0.070
9	ref\|NM_193116.1\| Oryza sativa (japonica cultivar-group), mRNA	46	0.070
10	gb\|AY501431.1\| Zea mays microRNA 166a gene, complete sequence	46	0.070
11	gb\|AC100893.13\| Mus musculus chromosome 8, clone RP23-68I8, comp...	46	0.070
12	gb\|AC105166.16\| Mus musculus chromosome 5, clone RP24-311D15, co...	46	0.070
13	gb\|AC025353.9\| Mus musculus chromosome 9, clone RP23-93E19, comp...	46	0.070
14	gb\|AC140207.3\| Mus musculus BAC clone RP24-446P10 from chromosom...	46	0.070
15	gb\|AC115292.5\| Mus musculus BAC clone RP23-73F10 from chromosome...	46	0.070
16	gb\|AC129331.4\| Mus musculus BAC clone RP23-75C8 from chromosome ...	46	0.070
17	gb\|AC124581.4\| Mus musculus BAC clone RP23-116E3 from chromosome...	46	0.070
18	gb\|AF521190.1\| Triticum aestivum from endosperm nonphosphorylati...	46	0.070
19	gb\|AC124774.4\| Mus musculus BAC clone RP23-49E5 from 15, complet...	46	0.070
20	gb\|AC123872.4\| Mus musculus BAC clone RP23-254P8 from 2, complet...	46	0.070
21	gb\|AC122799.4\| Mus musculus BAC clone RP23-308K11 from 16, compl...	46	0.070
22	gb\|AC116584.2\| Mus musculus BAC clone RP23-353J13 from 15, compl...	46	0.070
23	gb\|AC093655.4\| Homo sapiens BAC clone RP11-424F6 from 7, complet...	46	0.070
24	gb\|AC073216.7\| Homo sapiens BAC clone RP11-521C10 from 7, comple...	46	0.070
25	emb\|BX571801.6\| Human DNA sequence from clone DASS-335H18 on chr...	46	0.070
26	emb\|AL805917.3\| Human DNA sequence from clone DAQB-10J12 on chro...	46	0.070
27	emb\|AL662797.7\| Human DNA sequence from clone XXbac-252P9 on chr...	46	0.070
28	emb\|AL662848.6\| Human DNA sequence from clone XXbac-111D4 on chr...	46	0.070
29	emb\|AL451132.9\| Human DNA sequence from clone RP11-7N10 on chrom...	46	0.070
30	emb\|AL160169.12\| Human DNA sequence from clone RP11-405C6 on chr...	46	0.070
31	emb\|AL109837.22\|HS1128N12 Human DNA sequence from clone RP5-1128...	46	0.070
32	emb\|AL049868.20\|HSJ927M24 Human DNA sequence from clone RP5-927M...	46	0.070
33	gb\|AC162905.4\| Mus musculus BAC clone RP24-281B12 from chromosom...	46	0.070
34	emb\|AL161584.2\|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, ...	46	0.070
35	emb\|AL021961.2\|ATF28A23 Arabidopsis thaliana DNA chromosome 4, B...	46	0.070
36	emb\|AL021767.1\|SPBC16C6 S.pombe chromosome II cosmid c16C6	46	0.070
37	emb\|CR847861.4\| Human DNA sequence from clone DAMA-220E23 on chr...	46	0.070
38	gb\|AC007212.7\| Arabidopsis thaliana chromosome 2 clone F8D23 map...	46	0.070
39	gb\|AC157516.2\| Mus musculus BAC clone RP24-279F18 from chromosom...	46	0.070
40	ref\|NM_001023827.1\| Schizosaccharomyces pombe 972h- hypothetical...	46	0.070
41	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.070
42	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.070
43	emb\|BX814040.1\|CNS0ADHI Arabidopsis thaliana Full-length cDNA Co...	46	0.070
44	gb\|BT003911.1\| Arabidopsis thaliana clone RAFL15-24-G06 (R20663)...	46	0.070
45	gb\|AC015449.3\|AC015449 Arabidopsis thaliana chromosome I BAC T3F...	46	0.070
46	dbj\|BA000025.2\| Homo sapiens genomic DNA, chromosome 6p21.3, HLA...	46	0.070
47	dbj\|AP004334.2\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.070
48	dbj\|AP005393.3\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.070
49	dbj\|AP005559.3\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.070
50	dbj\|AB006706.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	46	0.070
51	dbj\|AP004339.3\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.070
52	gb\|AC004212.1\|AC004212 Homo sapiens clone UWGC:y67c126 from 6p21...	46	0.070
53	gb\|AC167979.3\| Mus musculus BAC clone CH36-45M24 from chromosome...	46	0.070
54	emb\|AL928811.8\| Mouse DNA sequence from clone RP23-74P23 on chro...	46	0.070
55	gb\|AC160762.4\| Mus musculus BAC clone RP24-330E8 from chromosome...	46	0.070
56	emb\|AL672219.7\| Mouse DNA sequence from clone RP23-456B9 on chro...	46	0.070
57	emb\|AL713875.14\| Mouse DNA sequence from clone RP23-17N7 on chro...	46	0.070
58	dbj\|AB023050.1\| Homo sapiens genomic DNA, chromosome 6p21.3, HLA...	46	0.070
59	emb\|AL627185.10\| Mouse DNA sequence from clone RP23-332E2 on chr...	46	0.070
60	gb\|AC009253.17\| Drosophila melanogaster clone BACR24F17, complet...	44	0.28
61	ref\|NM_128509.2\| Arabidopsis thaliana phosphopyruvate hydratase ...	44	0.28
62	ref\|NM_121649.4\| Arabidopsis thaliana IPP1; isopentenyl-diphosph...	44	0.28
63	gb\|AC167537.7\| Mus musculus chromosome 8, clone RP23-99B10, comp...	44	0.28
64	ref\|XM_630125.1\| Dictyostelium discoideum hypothetical protein (...	44	0.28
65	ref\|XM_479829.1\| Oryza sativa (japonica cultivar-group), mRNA	44	0.28
66	ref\|XM_507104.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.28
67	gb\|AC160765.4\| Mus musculus BAC clone RP23-26O24 from chromosome...	44	0.28
68	gb\|AC167244.2\| Mus musculus BAC clone RP24-84C23 from chromosome...	44	0.28
69	gb\|AC025722.2\| Caenorhabditis elegans cosmid Y50D4C, complete se...	44	0.28
70	gb\|AC166258.12\| Mus musculus BAC RP23-353G9 (Roswell Park Cance...	44	0.28
71	gb\|AC100212.8\| Mus musculus chromosome 18, clone RP23-60D22, com...	44	0.28
72	ref\|XM_715407.1\| Candida albicans SC5314 hypothetical protein (C...	44	0.28
73	ref\|XM_715406.1\| Candida albicans SC5314 hypothetical protein (C...	44	0.28
74	ref\|XM_715176.1\| Candida albicans SC5314 hypothetical protein (C...	44	0.28
75	ref\|XM_715175.1\| Candida albicans SC5314 hypothetical protein (C...	44	0.28
76	gb\|AC140443.2\| Mus musculus BAC clone RP24-171A23 from chromosom...	44	0.28
77	ref\|XM_855075.1\| PREDICTED: Canis familiaris similar to transcri...	44	0.28
78	ref\|XM_855031.1\| PREDICTED: Canis familiaris similar to transcri...	44	0.28
79	ref\|XM_854999.1\| PREDICTED: Canis familiaris similar to transcri...	44	0.28
80	ref\|XM_854964.1\| PREDICTED: Canis familiaris similar to transcri...	44	0.28
81	ref\|XM_854924.1\| PREDICTED: Canis familiaris similar to transcri...	44	0.28
82	ref\|XM_854886.1\| PREDICTED: Canis familiaris similar to transcri...	44	0.28
83	ref\|XM_538084.2\| PREDICTED: Canis familiaris similar to transcri...	44	0.28
84	gb\|AC154910.3\| Mus musculus BAC clone RP23-70L9 from chromosome ...	44	0.28
85	ref\|XR_002963.1\| PREDICTED: Mus musculus hypothetical protein LO...	44	0.28
86	ref\|XM_983307.1\| PREDICTED: Mus musculus PR domain containing 10...	44	0.28
87	ref\|XM_983332.1\| PREDICTED: Mus musculus PR domain containing 10...	44	0.28
88	ref\|XM_983270.1\| PREDICTED: Mus musculus PR domain containing 10...	44	0.28
89	ref\|XM_983233.1\| PREDICTED: Mus musculus PR domain containing 10...	44	0.28
90	ref\|XM_922774.2\| PREDICTED: Mus musculus PR domain containing 10...	44	0.28
91	ref\|XM_922769.1\| PREDICTED: Mus musculus PR domain containing 10...	44	0.28
92	ref\|XM_913442.1\| PREDICTED: Mus musculus PR domain containing 10...	44	0.28
93	gb\|AC126426.3\| Mus musculus BAC clone RP24-291G13 from chromosom...	44	0.28
94	ref\|XM_568751.1\| Cryptococcus neoformans var. neoformans JEC21 h...	44	0.28
95	ref\|XM_799689.1\| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.28
96	ref\|XM_803117.1\| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.28
97	gb\|AY163378.1\| Zea mays putative ROP family GTPase ROP9 gene, co...	44	0.28
98	gb\|AY163377.1\| Zea mays putative ROP family GTPase ROP9 mRNA, co...	44	0.28
99	ref\|XM_812966.1\| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.28
100	gb\|AC164702.2\| Mus musculus BAC clone RP23-402H19 from chromosom...	44	0.28
101	gb\|AC163665.4\| Mus musculus BAC clone RP23-325J23 from chromosom...	44	0.28
102	emb\|AL513191.4\| Human DNA sequence from clone RP11-224F24 on chr...	44	0.28
103	emb\|AL390777.13\| Human DNA sequence from clone RP11-301F14 on ch...	44	0.28
104	emb\|AL138958.18\| Human DNA sequence from clone RP11-206I15 on ch...	44	0.28
105	emb\|Z69730.1\|SPAC22H10 S.pombe chromosome I cosmid c22H10	44	0.28
106	gb\|AY035128.1\| Arabidopsis thaliana putative enolase 2-phospho-D...	44	0.28
107	emb\|AL669858.8\| Mouse DNA sequence from clone RP23-51G7 on chrom...	44	0.28
108	gb\|AE017342.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	44	0.28
109	gb\|AY935523.1\| Aedes aegypti CTCF-like protein mRNA, complete cds	44	0.28
110	gb\|AF465682.1\| Strongylocentrotus droebechiensis alpha-tubulin 2...	44	0.28
111	gb\|AC107398.4\| Homo sapiens BAC clone RP11-731J8 from 4, complet...	44	0.28
112	gb\|AC004561.3\| Arabidopsis thaliana chromosome 2 clone F16P2 map...	44	0.28
113	gb\|AC107992.3\| Homo sapiens chromosome 15, clone RP11-150L8, com...	44	0.28
114	dbj\|AK139221.1\| Mus musculus 7 days neonate cerebellum cDNA, RIK...	44	0.28
115	gb\|AC021192.7\| Homo sapiens BAC clone RP11-767N15 from 4, comple...	44	0.28
116	gb\|AY065053.1\| Arabidopsis thaliana AT5g16440/MQK4_17 mRNA, comp...	44	0.28
117	gb\|AF332093.1\|AF332093 White spot syndrome virus, complete genome	44	0.28
118	dbj\|AK164883.1\| Mus musculus 15 days embryo head cDNA, RIKEN ful...	44	0.28
119	dbj\|AB169911.1\| Macaca fascicularis brain cDNA, clone: QtrA-1344...	44	0.28
120	ref\|NM_001019179.1\| Schizosaccharomyces pombe 972h- hypothetical...	44	0.28
121	gb\|AC160147.6\| Mus musculus 10 BAC RP24-576A6 (Roswell Park Canc...	44	0.28
122	gb\|AC022740.4\|AC022740 Homo sapiens chromosome 15, clone RP11-61...	44	0.28
123	dbj\|AP008214.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.28
124	emb\|BX820555.1\|CNS0A8M3 Arabidopsis thaliana Full-length cDNA Co...	44	0.28
125	emb\|BX829906.1\|CNS09ZYW Arabidopsis thaliana Full-length cDNA Co...	44	0.28
126	gb\|AF369029.2\| White spot syndrome virus, complete genome	44	0.28
127	gb\|AC112666.9\| Mus musculus chromosome 3, clone RP24-119D5, comp...	44	0.28
128	dbj\|AP006723.2\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.28
129	emb\|BX000428.10\| Mouse DNA sequence from clone RP23-474G7 on chr...	44	0.28
130	dbj\|AB018117.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	44	0.28
131	dbj\|AB005242.1\| Arabidopsis thaliana genomic DNA, chromosome 5, ...	44	0.28
132	gb\|AF440570.1\| Shrimp white spot syndrome virus, complete genome	44	0.28
133	dbj\|AK104952.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.28
134	dbj\|AK069887.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.28
135	gb\|AY106325.1\| Zea mays PCO091374 mRNA sequence	44	0.28
136	gb\|AC005598.6\|AC005598 Homo sapiens chromosome 4 clone C0024K08 ...	44	0.28
137	gb\|AE003669.5\| Drosophila melanogaster chromosome 2L, section 78...	44	0.28
138	gb\|AC157793.6\| Mus musculus chromosome 1, clone RP24-175H22, com...	44	0.28
139	gb\|AC121256.22\| Mus musculus chromosome 1, clone RP24-576N23, co...	44	0.28
140	gb\|AC005187.1\|AC005187 Homo sapiens chromosome 4 clone B153K6 ma...	44	0.28
141	gb\|AC137155.3\| Mus musculus BAC clone RP23-66E11 from 12, comple...	44	0.28
142	gb\|BC064128.1\| Mus musculus PR domain containing 10, mRNA (cDNA ...	44	0.28
143	dbj\|AP004950.1\| Lotus japonicus genomic DNA, chromosome 1, clone...	44	0.28
144	emb\|AL831718.6\| Mouse DNA sequence from clone RP23-146O20 on chr...	44	0.28
145	gb\|AC171318.3\| Mus musculus chromosome 8, clone wi1-1251L9, comp...	44	0.28
146	gb\|AC116136.9\| Mus musculus chromosome 5, clone RP23-116G17, com...	42	1.1
147	gb\|AC138358.12\| Mus musculus chromosome 1, clone RP24-147G10, co...	42	1.1
148	gb\|AC105976.13\| Mus musculus chromosome 5, clone RP24-315H14, co...	42	1.1
149	gb\|AC115795.11\| Mus musculus chromosome 5, clone RP23-400O10, co...	42	1.1
150	gb\|AY825246.1\| Tetrahymena pyriformis translation elongation fac...	42	1.1
151	gb\|AC126598.13\| Mus musculus chromosome 5, clone RP24-486L9, com...	42	1.1
152	gb\|AC153729.1\| Mus musculus BAC RP23-88C11 (Roswell Park Cancer...	42	1.1
153	ref\|NM_199713.1\| Danio rerio calreticulin, like 2 (calrl2), mRNA	42	1.1
154	ref\|NM_123795.2\| Arabidopsis thaliana protein binding / ubiquiti...	42	1.1
155	ref\|NM_115090.3\| Arabidopsis thaliana unknown protein AT3G52300 ...	42	1.1
156	ref\|NM_001035768.1\| Arabidopsis thaliana unknown protein AT3G523...	42	1.1
157	ref\|NM_113022.3\| Arabidopsis thaliana ADOF2; DNA binding / trans...	42	1.1
158	ref\|NM_129386.2\| Arabidopsis thaliana DNA binding / transcriptio...	42	1.1
159	ref\|NM_111567.2\| Arabidopsis thaliana unknown protein AT3G06870 ...	42	1.1
160	ref\|NM_128940.2\| Arabidopsis thaliana SPL3 (SQUAMOSA PROMOTER BI...	42	1.1
161	ref\|NM_101752.2\| Arabidopsis thaliana tRNA ligase AT1G18950 mRNA...	42	1.1
162	ref\|NM_129781.2\| Arabidopsis thaliana unknown protein AT2G42190 ...	42	1.1
163	ref\|NM_113643.1\| Arabidopsis thaliana unknown protein AT3G27290 ...	42	1.1
164	ref\|NM_124527.3\| Arabidopsis thaliana copper ion binding AT5G514...	42	1.1
165	ref\|NM_104228.3\| Arabidopsis thaliana MUM4 (MUCILAGE-MODIFIED 4)...	42	1.1
166	ref\|NM_105349.2\| Arabidopsis thaliana antiporter/ drug transport...	42	1.1
167	ref\|NM_127534.2\| Arabidopsis thaliana PRF1 (PROFILIN 1); actin b...	42	1.1
168	gb\|AC152960.1\| Mus musculus 6 BAC RP23-38B21 (Roswell Park Cance...	42	1.1
169	gb\|AC114617.16\| Mus musculus chromosome 5, clone RP24-84E3, comp...	42	1.1
170	ref\|NM_126303.2\| Arabidopsis thaliana STI (STICHEL) AT2G02480 (S...	42	1.1
171	ref\|NM_113468.3\| Arabidopsis thaliana CHUP1 (CHLOROPLAST UNUSUAL...	42	1.1
172	ref\|NM_112968.3\| Arabidopsis thaliana EIN3 (ETHYLENE-INSENSITIVE...	42	1.1
173	gb\|AC165299.13\| Mus musculus chromosome 15, clone RP23-266F2, co...	42	1.1
174	gb\|AC165256.2\| Mus musculus BAC clone RP23-216O10 from chromosom...	42	1.1
175	gb\|AC131995.14\| Mus musculus chromosome 1, clone RP24-338G10, co...	42	1.1
176	gb\|AC102311.10\| Mus musculus chromosome 1, clone RP24-426M1, com...	42	1.1
177	gb\|BC043352.2\| Homo sapiens zinc finger and BTB domain containin...	42	1.1
178	gb\|AC152957.1\| Mus musculus 6 BAC RP23-353I5 (Roswell Park Cance...	42	1.1
179	gb\|AC154808.2\| Mus musculus BAC clone RP24-512K19 from chromosom...	42	1.1
180	gb\|AC166709.9\| Mus musculus chromosome 1, clone RP23-406B10, com...	42	1.1
181	gb\|AC141887.5\| Mus musculus BAC clone RP23-478L20 from chromosom...	42	1.1
182	gb\|AC102130.7\| Mus musculus chromosome 3, clone RP23-223I2, comp...	42	1.1
183	gb\|AC154516.2\| Mus musculus BAC clone RP24-83D23 from chromosome...	42	1.1
184	gb\|AC157992.7\| Mus musculus chromosome 8, clone RP23-302J17, com...	42	1.1
185	gb\|AC164397.6\| Mus musculus chromosome 1, clone RP23-276M15, com...	42	1.1
186	gb\|AY421967.1\| Cryptococcus gattii strain ATCC 32609 MAT-alpha m...	42	1.1
187	gb\|AC099884.12\| Mus musculus chromosome 15, clone RP23-11F24, co...	42	1.1
188	gb\|AC102739.7\| Mus musculus chromosome 5, clone RP24-309H3, comp...	42	1.1
189	gb\|AC117757.23\| Mus musculus chromosome 1, clone RP24-420I4, com...	42	1.1
190	gb\|AC158551.5\| Mus musculus chromosome 8, clone RP23-466C10, com...	42	1.1
191	gb\|AC131975.28\| Mus musculus chromosome 17, clone RP24-146B4, co...	42	1.1
192	ref\|XM_633564.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
193	ref\|XM_631860.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
194	gb\|AC164549.4\| Mus musculus BAC clone RP24-273K1 from chromosome...	42	1.1
195	gb\|AC160389.4\| Mus musculus chromosome 7, clone RP23-257G13, com...	42	1.1
196	gb\|AC115006.12\| Mus musculus chromosome 8, clone RP24-184D21, co...	42	1.1
197	gb\|AC114667.12\| Mus musculus chromosome 1, clone RP24-175L10, co...	42	1.1
198	gb\|AY337613.1\| Vitis vinifera 9-cis-epoxycarotenoid dioxygenase ...	42	1.1
199	ref\|XM_639032.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
200	ref\|XM_639017.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
201	gb\|AC115749.12\| Mus musculus chromosome 3, clone RP23-14C17, com...	42	1.1
202	ref\|XM_642353.1\| Dictyostelium discoideum SMAD/FHA domain-contai...	42	1.1
203	ref\|XM_641631.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
204	ref\|XM_641118.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
205	gb\|AC121832.3\| Mus musculus chromosome 10 clone RP24-67D23, comp...	42	1.1
206	gb\|AC121851.4\| Mus musculus chromosome 8 clone RP24-92F5, comple...	42	1.1
207	ref\|XM_640458.1\| Dictyostelium discoideum putative RNA polymeras...	42	1.1
208	ref\|XM_640188.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
209	ref\|XM_639141.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
210	ref\|XM_638977.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
211	gb\|AC109498.10\| Mus musculus chromosome 5, clone RP23-22K24, com...	42	1.1
212	ref\|XM_637292.1\| Dictyostelium discoideum SMAD/FHA domain-contai...	42	1.1
213	ref\|XM_636969.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
214	ref\|XM_636657.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
215	ref\|XM_634285.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
216	ref\|XM_629681.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
217	ref\|XM_629430.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
218	ref\|XM_629371.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
219	ref\|XM_629057.1\| Dictyostelium discoideum hypothetical protein (...	42	1.1
220	ref\|XM_511977.1\| PREDICTED: Pan troglodytes LOC455235 (LOC455235...	42	1.1
221	gb\|AC166826.4\| Mus musculus BAC clone RP23-370K22 from chromosom...	42	1.1
222	gb\|AC165958.2\| Mus musculus BAC clone RP23-417I20 from chromosom...	42	1.1
223	gb\|AC163351.2\| Mus musculus BAC clone RP23-150D4 from chromosome...	42	1.1
224	gb\|AC165426.3\| Mus musculus BAC clone RP23-157G2 from chromosome...	42	1.1
225	gb\|AC154400.2\| Mus musculus BAC clone RP23-163P4 from chromosome...	42	1.1
226	gb\|AC164550.2\| Mus musculus BAC clone RP23-469K15 from chromosom...	42	1.1
227	gb\|AC165247.2\| Mus musculus BAC clone RP24-213G21 from chromosom...	42	1.1
228	gb\|AC159627.2\| Mus musculus BAC clone RP24-202P24 from chromosom...	42	1.1
229	gb\|AC159245.2\| Mus musculus BAC clone RP24-260B5 from chromosome...	42	1.1
230	gb\|AC167814.4\| Mus musculus BAC clone RP24-248O12 from chromosom...	42	1.1
231	gb\|AC127565.5\| Mus musculus BAC clone RP24-292K9 from chromosome...	42	1.1
232	gb\|AC164302.2\| Mus musculus BAC clone RP23-286N12 from chromosom...	42	1.1
233	gb\|AC163660.4\| Mus musculus BAC clone RP23-283J16 from chromosom...	42	1.1
234	gb\|AC166364.2\| Mus musculus BAC clone RP24-394E6 from chromosome...	42	1.1
235	gb\|AC162799.4\| Mus musculus BAC clone RP24-392E13 from chromosom...	42	1.1
236	gb\|AC166097.5\| Mus musculus BAC clone RP24-447P10 from chromosom...	42	1.1
237	gb\|AC168054.4\| Mus musculus BAC clone RP24-571H12 from chromosom...	42	1.1
238	gb\|AC168217.2\| Mus musculus BAC clone RP24-498P8 from chromosome...	42	1.1
239	gb\|AC160986.5\| Mus musculus BAC clone RP23-258K21 from chromosom...	42	1.1
240	gb\|AC166832.2\| Mus musculus BAC clone RP23-220N17 from chromosom...	42	1.1
241	gb\|AC154510.2\| Mus musculus BAC clone RP23-210I20 from chromosom...	42	1.1
242	gb\|AC161342.10\| Mus musculus chromosome 1, clone RP23-313K17, co...	42	1.1
243	gb\|AC154039.17\| Mus musculus 10 BAC RP23-282M20 (Roswell Park Ca...	42	1.1
244	ref\|XM_509959.1\| PREDICTED: Pan troglodytes WD repeat and HMG-bo...	42	1.1
245	ref\|XM_522538.1\| PREDICTED: Pan troglodytes similar to Probable ...	42	1.1
246	ref\|XM_479680.1\| Oryza sativa (japonica cultivar-group), mRNA	42	1.1
247	ref\|XM_466864.1\| Oryza sativa (japonica cultivar-group), mRNA	42	1.1
248	gb\|AC165317.8\| Mus musculus chromosome 5, clone RP23-265O20, com...	42	1.1
249	ref\|XM_463777.1\| Oryza sativa (japonica cultivar-group), mRNA	42	1.1
250	ref\|NM_197238.1\| Oryza sativa (japonica cultivar-group) putative...	42	1.1
251	gb\|AC158156.10\| Mus musculus chromosome 3, clone RP23-145F12, co...	42	1.1
252	gb\|AY710430.1\| Cryptococcus gattii strain WM276 MATalpha locus, ...	42	1.1
253	gb\|AC100043.9\| Mus musculus chromosome 3, clone RP23-32D13, comp...	42	1.1
254	gb\|AC164602.7\| Mus musculus chromosome 1, clone RP24-364G11, com...	42	1.1
255	ref\|XM_513327.1\| PREDICTED: Pan troglodytes similar to cell divi...	42	1.1
256	gb\|AC162523.9\| Mus musculus chromosome 8, clone RP23-370L21, com...	42	1.1
257	gb\|AC161516.9\| Mus musculus chromosome 5, clone RP23-130C18, com...	42	1.1
258	gb\|AC153558.7\| Mus musculus 10 BAC RP23-367D2 (Roswell Park Canc...	42	1.1
259	gb\|AC101802.9\| Mus musculus chromosome 1, clone RP24-221A4, comp...	42	1.1
260	gb\|AC133489.32\| Mus musculus strain C57BL/6J clone rp23-74a5, co...	42	1.1
261	gb\|AC163337.2\| Mus musculus chromosome 5, clone RP23-297I15, com...	42	1.1
262	gb\|AC137842.8\| Mus musculus chromosome 15, clone RP23-91M6, comp...	42	1.1
263	ref\|NM_080737.1\| Homo sapiens synaptotagmin-like 4 (granuphilin-...	42	1.1
264	gb\|AC022775.16\| Mus musculus chromosome 15, clone RP23-71O17, co...	42	1.1
265	gb\|AC160028.9\| Mus musculus 10 BAC RP24-570M12 (Roswell Park Can...	42	1.1
266	gb\|AC115846.7\| Mus musculus chromosome 1, clone RP24-245O4, comp...	42	1.1
267	gb\|AC138204.7\| Mus musculus chromosome 3, clone RP23-381G8, comp...	42	1.1
268	ref\|NM_009292.1\| Mus musculus stimulated by retinoic acid gene 8...	42	1.1
269	gb\|AC102410.5\| Mus musculus chromosome 18, clone RP24-369O1, com...	42	1.1
270	gb\|AC109272.20\| Mus musculus chromosome 7, clone RP23-354L18, co...	42	1.1
271	gb\|AY540637.1\| Plasmodium yoelii nigeriensis P2 ribosomal protei...	42	1.1
272	gb\|AC157991.5\| Mus musculus chromosome 18, clone RP23-335B10, co...	42	1.1
273	gb\|AC162163.2\| Mus musculus chromosome 1, clone RP23-258N15, com...	42	1.1
274	gb\|AC162171.7\| Mus musculus chromosome 5, clone RP23-143N11, com...	42	1.1
275	gb\|AF030694.2\| Plasmodium falciparum strain Dd2 heat shock prote...	42	1.1
276	gb\|U65590.1\|HSU65590 Homo sapiens IL-1 receptor antagonist IL-1R...	42	1.1
277	gb\|AF326781.1\| Triticum monococcum actin (ACT-1) gene, partial c...	42	1.1
278	gb\|AY022818.1\| Oryza sativa microsatellite MRG5143 containing (C...	42	1.1
279	gb\|AC004649.1\| Homo sapiens chromosome 5, P1 clone 603E12 (LBNL ...	42	1.1
280	gb\|AC084023.8\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.1
281	gb\|AC105982.10\| Mus musculus chromosome 15, clone RP24-159I1, co...	42	1.1
282	gb\|AC113473.20\| Mus musculus chromosome 1, clone RP23-280F6, com...	42	1.1
283	gb\|AC113078.17\| Mus musculus chromosome 18, clone RP23-287G21, c...	42	1.1
284	gb\|AC166648.4\| Mus musculus chromosome 5, clone RP23-102C14, com...	42	1.1
285	gb\|AC113007.11\| Mus musculus chromosome 3, clone RP23-349H13, co...	42	1.1
286	gb\|AC109268.10\| Mus musculus chromosome 1, clone RP23-305F24, co...	42	1.1
287	gb\|AC139231.11\| Mus musculus chromosome 1, clone RP24-87I22, com...	42	1.1
288	gb\|AC102124.16\| Mus musculus chromosome 18, clone RP23-188D1, co...	42	1.1
289	gb\|AC102499.10\| Mus musculus chromosome 1, clone RP24-151M13, co...	42	1.1
290	gb\|AC154623.2\| Mus musculus BAC clone RP23-327K7 from chromosome...	42	1.1
291	gb\|AC160993.5\| Mus musculus BAC clone RP23-159D11 from chromosom...	42	1.1
292	gb\|AC118630.8\| Mus musculus chromosome 14, clone RP24-92O1, comp...	42	1.1
293	gb\|AC160471.10\| Mus musculus chromosome 7, clone RP23-432D9, com...	42	1.1
294	gb\|AC156576.3\| Mus musculus BAC clone RP23-7C22 from chromosome ...	42	1.1
295	gb\|AC152065.4\| Mus musculus BAC clone RP23-16D9 from chromosome ...	42	1.1
296	gb\|AC165971.3\| Mus musculus BAC clone RP23-94L17 from chromosome...	42	1.1
297	gb\|AC165090.3\| Mus musculus BAC clone RP23-95H4 from chromosome ...	42	1.1
298	gb\|AC163297.4\| Mus musculus BAC clone RP23-106G24 from chromosom...	42	1.1
299	gb\|AC163620.4\| Mus musculus BAC clone RP23-117D22 from chromosom...	42	1.1
300	gb\|AC163623.5\| Mus musculus BAC clone RP23-123D6 from chromosome...	42	1.1
301	gb\|AC160136.2\| Mus musculus BAC clone RP23-125E11 from chromosom...	42	1.1
302	gb\|AC133103.5\| Mus musculus BAC clone RP23-226J10 from chromosom...	42	1.1
303	gb\|AC162902.4\| Mus musculus BAC clone RP23-448D23 from chromosom...	42	1.1
304	gb\|AC159260.3\| Mus musculus BAC clone RP24-85M18 from chromosome...	42	1.1
305	gb\|AC154760.2\| Mus musculus BAC clone RP24-414E6 from chromosome...	42	1.1
306	gb\|AC158514.2\| Mus musculus BAC clone RP24-480D16 from chromosom...	42	1.1
307	gb\|AC164700.3\| Mus musculus BAC clone RP24-548M16 from chromosom...	42	1.1
308	gb\|AC165141.4\| Mus musculus BAC clone RP24-535G5 from chromosome...	42	1.1
309	gb\|AC164557.3\| Mus musculus BAC clone RP23-282G1 from chromosome...	42	1.1
310	gb\|AC167019.4\| Mus musculus BAC clone RP23-262K24 from chromosom...	42	1.1
311	gb\|AC110536.10\| Mus musculus chromosome 1, clone RP24-545N23, co...	42	1.1
312	gb\|AC102469.7\| Mus musculus chromosome 1, clone RP24-356O3, comp...	42	1.1
313	gb\|AC109186.7\| Mus musculus chromosome 5, clone RP24-351E22, com...	42	1.1
314	gb\|AC102232.12\| Mus musculus chromosome 18, clone RP24-76F12, co...	42	1.1
315	gb\|AC131297.11\| Mus musculus chromosome 8, clone RP23-284E15, co...	42	1.1
316	gb\|AC130481.11\| Mus musculus chromosome 1, clone RP24-125E22, co...	42	1.1
317	gb\|AC137676.11\| Mus musculus chromosome 5, clone RP23-1N19, comp...	42	1.1
318	gb\|AC101982.9\| Mus musculus chromosome 3, clone RP24-346F13, com...	42	1.1
319	gb\|AC129554.13\| Mus musculus chromosome 17, clone RP24-358N7, co...	42	1.1
320	gb\|AC124323.10\| Mus musculus chromosome 19, clone RP24-444B6, co...	42	1.1
321	gb\|AC138741.7\| Mus musculus chromosome 1, clone RP24-260D21, com...	42	1.1
322	gb\|AC120339.18\| Mus musculus chromosome 14, clone RP23-126A8, co...	42	1.1
323	gb\|AC115968.10\| Mus musculus chromosome 1, clone RP24-72P6, comp...	42	1.1
324	gb\|AC102458.8\| Mus musculus chromosome 1, clone RP24-312N11, com...	42	1.1
325	gb\|AC116839.8\| Mus musculus chromosome 8, clone RP24-390L13, com...	42	1.1
326	gb\|AC161357.4\| Mus musculus chromosome 5, clone wi1-1640B17, com...	42	1.1
327	gb\|AC118627.6\| Mus musculus chromosome 15, clone RP24-91E8, comp...	42	1.1
328	gb\|AC123658.9\| Mus musculus chromosome 15, clone RP23-192C13, co...	42	1.1
329	gb\|AC098570.7\| Mus musculus chromosome 1, clone RP23-278N11, com...	42	1.1
330	gb\|AC118472.8\| Mus musculus chromosome 19, clone RP23-187N14, co...	42	1.1
331	gb\|AC107679.19\| Mus musculus chromosome 1, clone RP23-256H11, co...	42	1.1
332	gb\|AC165240.6\| Mus musculus chromosome 5, clone RP24-174P7, comp...	42	1.1
333	gb\|AC166813.4\| Mus musculus chromosome 3, clone RP23-404H11, com...	42	1.1
334	gb\|AC114613.12\| Mus musculus chromosome 5, clone RP24-80F7, comp...	42	1.1
335	gb\|AC134411.7\| Mus musculus chromosome 5, clone RP24-369N6, comp...	42	1.1
336	gb\|AC122791.13\| Mus musculus chromosome 13, clone RP24-266G22, c...	42	1.1
337	gb\|AC101651.6\| Mus musculus chromosome 18, clone RP23-42D12, com...	42	1.1
338	ref\|XM_594095.2\| PREDICTED: Bos taurus similar to synaptotagmin-...	42	1.1
339	gb\|AC144460.31\| Mus musculus strain C57BL/6J clone rp23-109m13, ...	42	1.1
340	gb\|AC003067.59\| Mus musculus Chromosome 16 BAC Clone tbx3 Synten...	42	1.1
341	gb\|AC127189.4\| Rattus norvegicus 1 BAC CH230-266M16 (Children's ...	42	1.1
342	gb\|AC126959.6\| Rattus norvegicus 8 BAC CH230-10P12 (Children's H...	42	1.1
343	gb\|AC126115.5\| Rattus norvegicus 4 BAC CH230-213L22 (Children's ...	42	1.1
344	gb\|AC097023.6\| Rattus norvegicus BAC CH230-35L12 (Children's Hos...	42	1.1
345	gb\|AC095688.7\| Rattus norvegicus 2 BAC CH230-9C20 (Children's Ho...	42	1.1
346	gb\|AC120877.15\| Mus musculus chromosome 6, clone RP24-548D19, co...	42	1.1
347	gb\|AC145477.2\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.1
348	gb\|AC111122.13\| Mus musculus chromosome 7, clone RP23-230L8, com...	42	1.1
349	gb\|AC099728.6\| Mus musculus chromosome 7, clone RP23-417I5, comp...	42	1.1
350	gb\|AC131989.8\| Mus musculus chromosome 14, clone RP24-186N15, co...	42	1.1
351	gb\|AF130357.2\| Mus musculus chromosome X clone CT7-148C10, compl...	42	1.1
352	gb\|AF133093.2\| Mus musculus chromosome X clones CT7-116D19, CT7-...	42	1.1
353	gb\|AC150657.1\| Pan troglodytes chromosome 8 clone PTB-123K23 map...	42	1.1
354	gb\|AC105979.13\| Mus musculus chromosome 14, clone RP24-301E12, c...	42	1.1
355	ref\|XM_866375.1\| PREDICTED: Bos taurus similar to p21-activated ...	42	1.1
356	ref\|XM_878292.1\| PREDICTED: Bos taurus similar to p21-activated ...	42	1.1
357	ref\|XM_614322.2\| PREDICTED: Bos taurus similar to p21-activated ...	42	1.1
358	ref\|XM_585160.2\| PREDICTED: Bos taurus similar to olfactory rece...	42	1.1
359	gb\|AC161409.11\| Mus musculus chromosome 7, clone RP23-292B24, co...	42	1.1
360	gb\|AC101983.16\| Mus musculus chromosome 6, clone RP24-352A8, com...	42	1.1
361	gb\|AC118747.5\| Mus musculus chromosome 5, clone RP24-194J1, comp...	42	1.1
362	gb\|AC107316.3\| Mus musculus strain C57BL6/J chromosome 6 clone R...	42	1.1
363	gb\|AC124614.11\| Mus musculus chromosome 10, clone RP24-417L12, c...	42	1.1
364	gb\|AC091454.2\| Mus musculus chromosome X, clones RP21-438P10, RP...	42	1.1
365	gb\|AC124322.7\| Mus musculus chromosome 7, clone RP24-330M21, com...	42	1.1
366	gb\|BC075691.1\| Mus musculus apoptotic chromatin condensation ind...	42	1.1
367	ref\|NM_009820.2\| Mus musculus runt related transcription factor ...	42	1.1
368	gb\|AC118259.10\| Mus musculus chromosome 15, clone RP24-352J7, co...	42	1.1
369	gb\|AC114674.10\| Mus musculus chromosome 9, clone RP24-209N21, co...	42	1.1
370	gb\|AC123071.3\| Mus musculus BAC clone RP23-70P8 from chromosome ...	42	1.1
371	gb\|AC133496.3\| Mus musculus BAC clone RP24-386G2 from chromosome...	42	1.1
372	gb\|AC140189.3\| Mus musculus BAC clone RP24-370G18 from chromosom...	42	1.1
373	gb\|AC137156.3\| Mus musculus BAC clone RP23-118K10 from chromosom...	42	1.1
374	gb\|AC133092.4\| Mus musculus BAC clone RP23-404G6 from chromosome...	42	1.1
375	gb\|AC136976.5\| Mus musculus BAC clone RP23-362K12 from chromosom...	42	1.1
376	gb\|AC134898.4\| Mus musculus BAC clone RP23-478H2 from chromosome...	42	1.1
377	gb\|AC140247.3\| Mus musculus BAC clone RP23-469I15 from chromosom...	42	1.1
378	gb\|AC135567.3\| Mus musculus BAC clone RP23-312I24 from chromosom...	42	1.1
379	gb\|AC147260.3\| Mus musculus BAC clone RP24-186L11 from chromosom...	42	1.1
380	gb\|AC101713.7\| Mus musculus chromosome 15, clone RP23-282L9, com...	42	1.1
381	gb\|AC118802.7\| Rattus norvegicus 13 BAC CH230-72B9 (Children's H...	42	1.1
382	gb\|AC137147.9\| Mus musculus chromosome 5, clone RP24-141O20, com...	42	1.1
383	gb\|BC008079.2\| Homo sapiens cell division cycle associated 8, mR...	42	1.1
384	gb\|BC051644.1\| Mus musculus tumor rejection antigen P1A, mRNA (c...	42	1.1
385	gb\|AC110243.9\| Mus musculus chromosome 15, clone RP23-246C6, com...	42	1.1
386	gb\|AC123747.26\| Mus musculus chromosome 3, clone RP24-123I12, co...	42	1.1
387	gb\|BC000422.2\| Homo sapiens ariadne homolog 2 (Drosophila), mRNA...	42	1.1
388	gb\|BC016944.1\| Homo sapiens cell division cycle associated 8, mR...	42	1.1
389	gb\|AC119839.8\| Mus musculus chromosome 1, clone RP24-170N13, com...	42	1.1
390	gb\|AC139211.13\| Mus musculus chromosome 6, clone RP23-302O24, co...	42	1.1
391	gb\|AC117586.10\| Mus musculus chromosome 3, clone RP23-166M8, com...	42	1.1
392	gb\|AC101777.8\| Mus musculus chromosome 1, clone RP24-123J3, comp...	42	1.1
393	gb\|AC124211.2\| Mus musculus chromosome X clone CT7-497M13 map qA...	42	1.1
394	gb\|AC107274.11\| Rattus norvegicus 18 BAC CH230-207M17 (Children'...	42	1.1
395	gb\|AY508815.2\| Homo sapiens pluripotent embryonic stem cell-rela...	42	1.1
396	ref\|NM_146110.2\| Mus musculus angio-associated migratory protein...	42	1.1
397	ref\|NM_006321.2\| Homo sapiens ariadne homolog 2 (Drosophila) (AR...	42	1.1
398	gb\|AC112938.11\| Mus musculus chromosome 5, clone RP24-72E12, com...	42	1.1
399	gb\|AC137150.11\| Mus musculus chromosome 18, clone RP23-342A15, c...	42	1.1
400	gb\|AC165233.6\| Mus musculus chromosome 8, clone RP23-307O2, comp...	42	1.1
401	gb\|AC131720.2\| Mus musculus BAC clone RP23-137I3 from chromosome...	42	1.1
402	ref\|NM_012316.3\| Homo sapiens karyopherin alpha 6 (importin alph...	42	1.1
403	gb\|AC146605.3\| Mus musculus BAC clone RP23-304J7 from chromosome...	42	1.1
404	gb\|AC133649.2\| Mus musculus BAC clone RP23-341M13 from chromosom...	42	1.1
405	gb\|AC134583.5\| Mus musculus BAC clone RP24-94C12 from chromosome...	42	1.1
406	gb\|AC110092.4\| Mus musculus BAC clone RP24-94E17 from chromosome...	42	1.1
407	gb\|AC122403.3\| Mus musculus BAC clone RP24-112A10 from chromosom...	42	1.1
408	ref\|XM_715812.1\| Candida albicans SC5314 hypothetical protein (C...	42	1.1
409	gb\|AC134569.4\| Mus musculus BAC clone RP24-240H21 from chromosom...	42	1.1
410	ref\|NM_023879.1\| Mus musculus retinitis pigmentosa GTPase regula...	42	1.1
411	gb\|AC101968.11\| Mus musculus chromosome 3, clone RP24-257N17, co...	42	1.1
412	gb\|AC102115.11\| Mus musculus chromosome 3, clone RP23-145A18, co...	42	1.1
413	gb\|AC147143.2\| Pan troglodytes BAC clone CH251-267L18 from Y, co...	42	1.1
414	gb\|AC147028.3\| Pan troglodytes BAC clone RP43-93F8 from 7, compl...	42	1.1
415	gb\|AC146000.4\| Pan troglodytes BAC clone RP43-147L18 from 7, com...	42	1.1
416	gb\|AC147045.2\| Mus musculus BAC clone RP23-100E5 from chromosome...	42	1.1
417	gb\|AC133954.3\| Mus musculus BAC clone RP23-154C17 from chromosom...	42	1.1
418	gb\|AC129608.3\| Mus musculus BAC clone RP23-193A2 from chromosome...	42	1.1
419	gb\|AC135240.2\| Mus musculus BAC clone RP24-63O24 from chromosome...	42	1.1
420	gb\|AC122457.4\| Mus musculus BAC clone RP24-266P11 from chromosom...	42	1.1
421	gb\|AC140336.2\| Mus musculus BAC clone RP24-266F17 from chromosom...	42	1.1
422	gb\|AC132288.5\| Mus musculus BAC clone RP24-315D13 from chromosom...	42	1.1
423	gb\|AC123048.4\| Mus musculus BAC clone RP24-394D5 from chromosome...	42	1.1
424	gb\|AC140286.3\| Mus musculus BAC clone RP24-573E14 from chromosom...	42	1.1
425	gb\|AC134540.3\| Mus musculus BAC clone RP24-400M10 from chromosom...	42	1.1
426	gb\|AC132235.3\| Mus musculus BAC clone RP24-497H15 from chromosom...	42	1.1
427	gb\|AC139335.3\| Mus musculus BAC clone RP23-376N11 from chromosom...	42	1.1
428	gb\|AC135962.4\| Mus musculus BAC clone RP23-342H15 from chromosom...	42	1.1
429	gb\|AC072048.4\| Mus musculus strain C57BL6/J chromosome 6 clone R...	42	1.1
430	ref\|NM_011635.1\| Mus musculus tumor rejection antigen P1A (Trap1...	42	1.1
431	ref\|XM_452901.1\| Kluyveromyces lactis NRRL Y-1140, KLLA0C15697g ...	42	1.1
432	gb\|AC161228.7\| Mus musculus chromosome 3, clone RP24-77I5, compl...	42	1.1
433	gb\|AC158301.4\| Mus musculus chromosome 5, clone RP24-71D19, comp...	42	1.1
434	gb\|AC157805.3\| Mus musculus chromosome 1, clone RP24-324B17, com...	42	1.1
435	gb\|AC149044.1\| Pan troglodytes chromosome X clone PTB-089E19 map...	42	1.1
436	ref\|NM_024297.1\| Homo sapiens PHD finger protein 23 (PHF23), mRNA	42	1.1
437	gb\|BC100746.1\| Mus musculus stimulated by retinoic acid gene 8, ...	42	1.1
438	gb\|AC102217.9\| Mus musculus chromosome 1, clone RP24-160A23, com...	42	1.1
439	gb\|AC133459.9\| Mus musculus chromosome 12, clone RP23-383O15, co...	42	1.1
440	gb\|AC109170.10\| Mus musculus chromosome 8, clone RP23-87B3, comp...	42	1.1
441	gb\|AC110521.14\| Mus musculus chromosome 12, clone RP23-50H15, co...	42	1.1
442	gb\|AC120403.8\| Mus musculus chromosome 17, clone RP24-405C18, co...	42	1.1
443	ref\|XM_813532.1\| Trypanosoma cruzi strain CL Brener mucin-associ...	42	1.1
444	gb\|AC161000.5\| Mus musculus BAC clone RP23-51A9 from chromosome ...	42	1.1
445	gb\|AC024914.48\| Mus musculus BAC Clone 262c6 RPCI-23, complete s...	42	1.1
446	gb\|AC145396.3\| Oryza sativa (japonica cultivar-group) chromosome...	42	1.1
447	gb\|AC104318.2\| Homo sapiens chromosome 8 clone RP11-291K24, comp...	42	1.1
448	gb\|AC107834.13\| Mus musculus chromosome 1, clone RP23-251L12, co...	42	1.1
449	gb\|AC158520.2\| Mus musculus BAC clone RP23-434P22 from chromosom...	42	1.1
450	gb\|AC159888.2\| Mus musculus BAC clone RP24-133O9 from chromosome...	42	1.1
451	gb\|AC124978.19\| Mus musculus chromosome 5, clone RP24-107D19, co...	42	1.1
452	gb\|AC138394.7\| Mus musculus chromosome 3, clone RP23-333D8, comp...	42	1.1
453	gb\|AC121119.12\| Mus musculus chromosome 1, clone RP23-395D10, co...	42	1.1
454	gb\|AC036146.10\| Mus musculus chromosome 5, clone RP23-294A15, co...	42	1.1
455	gb\|AC119896.6\| Mus musculus chromosome 10, clone RP24-226B10, co...	42	1.1
456	gb\|AC140051.10\| Mus musculus chromosome 12, clone RP23-296J15, c...	42	1.1
457	gb\|AC159209.2\| Mus musculus BAC clone RP23-100C6 from chromosome...	42	1.1
458	gb\|AC117547.19\| Mus musculus chromosome 1, clone RP23-221M20, co...	42	1.1
459	gb\|AC113504.10\| Mus musculus chromosome 5, clone RP23-370G17, co...	42	1.1
460	gb\|AC113033.13\| Mus musculus chromosome 7, clone RP23-220I5, com...	42	1.1
461	gb\|AC154316.3\| Mus musculus BAC clone RP23-338D3 from chromosome...	42	1.1
462	gb\|AC157944.2\| Mus musculus BAC clone RP23-456N8 from chromosome...	42	1.1
463	gb\|AC116694.9\| Mus musculus chromosome 7, clone RP24-386G12, com...	42	1.1
464	gb\|AC103605.8\| Mus musculus chromosome 3, clone RP23-335H1, comp...	42	1.1
465	gb\|AC153376.10\| Mus musculus 6 BAC RP23-210L10 (Roswell Park Can...	42	1.1
466	gb\|BC006137.1\| Homo sapiens RNA binding motif protein 19, mRNA (...	42	1.1
467	gb\|BC004289.1\| Homo sapiens RNA binding motif protein 19, mRNA (...	42	1.1
468	gb\|AC109139.15\| Mus musculus chromosome 8, clone RP23-47L13, com...	42	1.1
469	gb\|AC152409.8\| Mus musculus chromosome 1, clone RP23-395C1, comp...	42	1.1
470	gb\|AC163991.3\| Mus musculus chromosome 15, clone RP24-119L11, co...	42	1.1
471	gb\|AC116107.10\| Mus musculus chromosome 1, clone RP23-28F18, com...	42	1.1
472	gb\|AC166052.5\| Mus musculus BAC clone RP24-95N16 from chromosome...	42	1.1
473	gb\|BC008630.1\| Homo sapiens PHD finger protein 23, mRNA (cDNA cl...	42	1.1
474	gb\|DP000012.1\| Macropus eugenii target 1 genomic scaffold	42	1.1
475	gb\|AC116692.15\| Mus musculus chromosome 1, clone RP24-355C22, co...	42	1.1
476	gb\|AC161169.10\| Mus musculus chromosome 5, clone RP24-102B13, co...	42	1.1
477	gb\|AC165409.3\| Mus musculus chromosome 18, clone RP23-90F15, com...	42	1.1
478	gb\|AC153530.9\| Mus musculus 10 BAC RP23-202A18 (Roswell Park Can...	42	1.1
479	gb\|AC163690.4\| Mus musculus BAC clone RP23-470F9 from chromosome...	42	1.1
480	gb\|AC163903.4\| Mus musculus BAC clone RP24-314J18 from chromosom...	42	1.1
481	gb\|AC164316.3\| Mus musculus BAC clone RP23-16B4 from chromosome ...	42	1.1
482	gb\|AC119880.11\| Mus musculus chromosome 7, clone RP24-428H4, com...	42	1.1
483	gb\|AC105161.10\| Mus musculus chromosome 1, clone RP24-73O16, com...	42	1.1
484	gb\|AC166969.4\| Mus musculus chromosome 1, clone RP23-226P1, comp...	42	1.1
485	gb\|AC161056.5\| Mus musculus BAC clone RP23-241J7 from chromosome...	42	1.1
486	gb\|AC148980.6\| Mus musculus BAC clone RP23-230C16 from chromosom...	42	1.1
487	gb\|AC154903.4\| Mus musculus BAC clone RP23-414E24 from chromosom...	42	1.1
488	gb\|AC125190.4\| Mus musculus BAC clone RP23-288O24 from chromosom...	42	1.1
489	gb\|AC156399.9\| Mus musculus 6 BAC RP24-238J9 (Roswell Park Cance...	42	1.1
490	gb\|AC115904.13\| Mus musculus chromosome 16, clone RP24-472P22, c...	42	1.1
491	gb\|AC140074.2\| Mus musculus BAC clone RP23-141A5 from chromosome...	42	1.1
492	gb\|AC122820.4\| Mus musculus BAC clone RP23-200M5 from chromosome...	42	1.1
493	ref\|XM_858510.1\| PREDICTED: Canis familiaris similar to Serine/t...	42	1.1
494	ref\|XM_846255.1\| PREDICTED: Canis familiaris similar to Serine/t...	42	1.1
495	ref\|XM_858464.1\| PREDICTED: Canis familiaris similar to Serine/t...	42	1.1
496	ref\|XM_858440.1\| PREDICTED: Canis familiaris similar to Serine/t...	42	1.1
497	ref\|XM_858402.1\| PREDICTED: Canis familiaris similar to Serine/t...	42	1.1
498	ref\|XM_858383.1\| PREDICTED: Canis familiaris similar to Serine/t...	42	1.1
499	ref\|XM_858358.1\| PREDICTED: Canis familiaris similar to Serine/t...	42	1.1
500	ref\|XM_858334.1\| PREDICTED: Canis familiaris similar to Serine/t...	42	1.1

>gb|AF247652.1|AF247652 Mus musculus complement regulatory protein CD59 gene, exons 2, 3 and 4
             and complete cds
          Length = 13528

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 8     tctatcttcttcttcttcctcttc 31
             ||||||||||||||||||||||||
Sbjct: 11773 tctatcttcttcttcttcctcttc 11796

to top

>gb|AF292401.2| Mus musculus CD59B (CD59B) and CD59A (CD59A) genes, complete cds
          Length = 48384

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 8     tctatcttcttcttcttcctcttc 31
             ||||||||||||||||||||||||
Sbjct: 43495 tctatcttcttcttcttcctcttc 43518

to top

>ref|NM_103628.3| Arabidopsis thaliana unknown protein AT1G47340 mRNA, complete cds
          Length = 2067

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 11   atcttcttcttcttcctcttccc 33
            |||||||||||||||||||||||
Sbjct: 1374 atcttcttcttcttcctcttccc 1352

to top

>ref|NM_119571.2| Arabidopsis thaliana protein binding / ubiquitin-protein ligase/
          zinc ion binding AT4G34100 mRNA, complete cds
          Length = 3279

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                 
Query: 10 tatcttcttcttcttcctcttcc 32
          |||||||||||||||||||||||
Sbjct: 74 tatcttcttcttcttcctcttcc 96

to top

>ref|NM_103627.3| Arabidopsis thaliana unknown protein AT1G47330 mRNA, complete cds
          Length = 2237

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 11   atcttcttcttcttcctcttccc 33
            |||||||||||||||||||||||
Sbjct: 2112 atcttcttcttcttcctcttccc 2134

to top

>gb|AC142244.11| Mus musculus chromosome 1, clone RP23-79H24, complete sequence
          Length = 132061

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 72374 tcttcttcttcttcctcttcccc 72396

to top

>ref|XM_637419.1| Dictyostelium discoideum hypothetical protein (DDB0218016), partial
            mRNA
          Length = 1524

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 12   tcttcttcttcttcctcttcccc 34
            |||||||||||||||||||||||
Sbjct: 1189 tcttcttcttcttcctcttcccc 1211

to top

>gb|AC163032.5| Mus musculus BAC clone RP24-144G20 from chromosome 12, complete sequence
          Length = 186416

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 172528 tcttcttcttcttcctcttcccc 172550

to top

>ref|NM_193116.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1107

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 12  tcttcttcttcttcctcttccccgatccgcc 42
           |||||||||||||| ||||||||| ||||||
Sbjct: 167 tcttcttcttcttcttcttccccgctccgcc 137

to top

>gb|AY501431.1| Zea mays microRNA 166a gene, complete sequence
          Length = 589

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 12  tcttcttcttcttcctcttcccc 34
           |||||||||||||||||||||||
Sbjct: 119 tcttcttcttcttcctcttcccc 141

to top

>gb|AC100893.13| Mus musculus chromosome 8, clone RP23-68I8, complete sequence
          Length = 253420

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 55895 tcttcttcttcttcctcttcccc 55917

to top

>gb|AC105166.16| Mus musculus chromosome 5, clone RP24-311D15, complete sequence
          Length = 145019

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 128791 tcttcttcttcttcctcttcccc 128813

to top

>gb|AC025353.9| Mus musculus chromosome 9, clone RP23-93E19, complete sequence
          Length = 274853

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 164026 tcttcttcttcttcctcttcccc 164048

to top

>gb|AC140207.3| Mus musculus BAC clone RP24-446P10 from chromosome 18, complete
             sequence
          Length = 185316

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 87465 tcttcttcttcttcctcttcccc 87487

to top

>gb|AC115292.5| Mus musculus BAC clone RP23-73F10 from chromosome 14, complete sequence
          Length = 212983

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 127016 tcttcttcttcttcctcttcccc 126994



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 127034 tcttcttcttcttcctcttc 127015

to top

>gb|AC129331.4| Mus musculus BAC clone RP23-75C8 from chromosome 8, complete sequence
          Length = 257765

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 211677 tcttcttcttcttcctcttcccc 211699

to top

>gb|AC124581.4| Mus musculus BAC clone RP23-116E3 from chromosome 13, complete sequence
          Length = 205173

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 150715 tcttcttcttcttcctcttcccc 150693



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 22482 tcttcttcttcttcctcttcc 22462

to top

>gb|AF521190.1| Triticum aestivum from endosperm nonphosphorylating
           glyceraldehyde-3-phosphate dehydrogenase mRNA, complete
           cds
          Length = 1891

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 13  cttcttcttcttcctcttccccgat 37
           ||||||||||||| |||||||||||
Sbjct: 171 cttcttcttcttcytcttccccgat 195

to top

>gb|AC124774.4| Mus musculus BAC clone RP23-49E5 from 15, complete sequence
          Length = 227514

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 123596 tcttcttcttcttcctcttcccc 123574

to top

>gb|AC123872.4| Mus musculus BAC clone RP23-254P8 from 2, complete sequence
          Length = 185953

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 130670 tcttcttcttcttcctcttcccc 130648

to top

>gb|AC122799.4| Mus musculus BAC clone RP23-308K11 from 16, complete sequence
          Length = 203686

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 124813 tcttcttcttcttcctcttcccc 124835

to top

>gb|AC116584.2| Mus musculus BAC clone RP23-353J13 from 15, complete sequence
          Length = 220203

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 199321 tcttcttcttcttcctcttcccc 199343

to top

>gb|AC093655.4| Homo sapiens BAC clone RP11-424F6 from 7, complete sequence
          Length = 119721

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 38081 tcttcttcttcttcctcttcccc 38103

to top

>gb|AC073216.7| Homo sapiens BAC clone RP11-521C10 from 7, complete sequence
          Length = 113530

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 31306 tcttcttcttcttcctcttcccc 31328

to top

>emb|BX571801.6| Human DNA sequence from clone DASS-335H18 on chromosome 6, complete
            sequence
          Length = 24616

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 12   tcttcttcttcttcctcttcccc 34
            |||||||||||||||||||||||
Sbjct: 9547 tcttcttcttcttcctcttcccc 9569

to top

>emb|AL805917.3| Human DNA sequence from clone DAQB-10J12 on chromosome 6 Contains the
            TIGD1L gene for tigger transposable element derived
            1-like, the 5' end of the C6orf214 gene for chromosome 6
            open reading frame 214, the 5' end of the DDR1 gene for
            discoidin domain receptor family, member 1, and 1 CpG
            island, complete sequence
          Length = 65373

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 12   tcttcttcttcttcctcttcccc 34
            |||||||||||||||||||||||
Sbjct: 3660 tcttcttcttcttcctcttcccc 3682

to top

>emb|AL662797.7| Human DNA sequence from clone XXbac-252P9 on chromosome 6 contains the 3'
              end of a putative novel transcript, the NRM gene for nurim
              (nuclear envelope membrane protein), a ribosomal protein L7
              (RPL7) pseudogene, the gene for KIAA0170 protein, the TUBB
              gene for tubulin, beta polypeptide, the FLOT1 gene for
              flotillin 1, the IER3 gene for immediate early response 3,
              a putative novel transcript and five CpG islands, complete
              sequence
          Length = 171627

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 146499 tcttcttcttcttcctcttcccc 146521

to top

>emb|AL662848.6| Human DNA sequence from clone XXbac-111D4 on chromosome 6 contains a
              ribosomal protein L7 (RPL7) pseudogene, the gene for
              KIAA0170 protein, the TUBB gene for tubulin, beta
              polypeptide, the FLOT1 gene for flotillin 1, the IER3 gene
              for immediate early response 3 , two putative novel
              transcripts and three CpG islands, complete sequence
          Length = 185617

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 131585 tcttcttcttcttcctcttcccc 131607

to top

>emb|AL451132.9| Human DNA sequence from clone RP11-7N10 on chromosome 9 Contains a
             pseudogene similar to part of serine/threonine kinase 33
             (STK33), complete sequence
          Length = 69362

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 55346 tcttcttcttcttcctcttcccc 55324

to top

>emb|AL160169.12| Human DNA sequence from clone RP11-405C6 on chromosome 9 Contains the
             3' end of the gene for a novel protein (KIAA1993), the 5'
             end of the RALGPS1A gene for Ral guanine nucleotide
             exchange factor RalGPS1A (RALGEF2, KIAA0351) and a CpG
             island, complete sequence
          Length = 124025

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 99152 tcttcttcttcttcctcttcccc 99174



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 99062 tcttcttcttcttcctcttc 99081

to top

>emb|AL109837.22|HS1128N12 Human DNA sequence from clone RP5-1128N12 on chromosome 20 Contains the
              PGAM3P gene for phosphoglycerate mutase 3 pseudogene and a
              CpG island, complete sequence
          Length = 139214

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 6      catctatcttcttcttcttcctcttcc 32
              ||||| |||||||||||||||||||||
Sbjct: 114368 catctttcttcttcttcttcctcttcc 114394

to top

>emb|AL049868.20|HSJ927M24 Human DNA sequence from clone RP5-927M24 on chromosome 20 Contains a
              novel gene (LOC128439), the 5' end of the gene for a novel
              protein (KIAA1219), the RPS3P2 gene for ribosomal protein
              S3 pseudogene 2 and a CpG island, complete sequence
          Length = 121922

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 121234 tcttcttcttcttcctcttcccc 121256

to top

>gb|AC162905.4| Mus musculus BAC clone RP24-281B12 from chromosome 9, complete sequence
          Length = 205771

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 120950 tcttcttcttcttcctcttcccc 120972

to top

>emb|AL161584.2|ATCHRIV80 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 80
          Length = 192861

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 10     tatcttcttcttcttcctcttcc 32
              |||||||||||||||||||||||
Sbjct: 164221 tatcttcttcttcttcctcttcc 164243



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 44691 tcttcttcttcttcctcttc 44710

to top

>emb|AL021961.2|ATF28A23 Arabidopsis thaliana DNA chromosome 4, BAC clone F28A23 (ESSA project)
          Length = 94091

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 10    tatcttcttcttcttcctcttcc 32
             |||||||||||||||||||||||
Sbjct: 34172 tatcttcttcttcttcctcttcc 34194

to top

>emb|AL021767.1|SPBC16C6 S.pombe chromosome II cosmid c16C6
          Length = 34722

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 24586 tcttcttcttcttcctcttcccc 24608

to top

>emb|CR847861.4| Human DNA sequence from clone DAMA-220E23 on chromosome 6, complete
             sequence
          Length = 16748

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 12023 tcttcttcttcttcctcttcccc 12045

to top

>gb|AC007212.7| Arabidopsis thaliana chromosome 2 clone F8D23 map PhyB, complete
             sequence
          Length = 57550

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 18096 tcttcttcttcttcctcttcccc 18118

to top

>gb|AC157516.2| Mus musculus BAC clone RP24-279F18 from chromosome 9, complete sequence
          Length = 175493

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 102410 tcttcttcttcttcctcttcccc 102388

to top

>ref|NM_001023827.1| Schizosaccharomyces pombe 972h- hypothetical protein
           (SPBC16C6.08c), partial mRNA
          Length = 645

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 12  tcttcttcttcttcctcttcccc 34
           |||||||||||||||||||||||
Sbjct: 422 tcttcttcttcttcctcttcccc 400

to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 12       tcttcttcttcttcctcttcccc 34
                |||||||||||||||||||||||
Sbjct: 16897050 tcttcttcttcttcctcttcccc 16897072



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 276      ggttgcggccgaggagggga 295
                ||||||||||||||||||||
Sbjct: 18663303 ggttgcggccgaggagggga 18663284



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 12       tcttcttcttcttcctcttc 31
                ||||||||||||||||||||
Sbjct: 10213467 tcttcttcttcttcctcttc 10213448



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 276     ggttgcggccgaggagggga 295
               ||||||||||||||||||||
Sbjct: 6060316 ggttgcggccgaggagggga 6060335



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 276   ggttgcggccgaggagggga 295
             ||||||||||||||||||||
Sbjct: 84270 ggttgcggccgaggagggga 84289



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 276   ggttgcggccgaggagggga 295
             ||||||||||||||||||||
Sbjct: 71689 ggttgcggccgaggagggga 71708

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                               
Query: 12       tcttcttcttcttcctcttccccgatccgcc 42
                |||||||||||||| ||||||||| ||||||
Sbjct: 26257690 tcttcttcttcttcttcttccccgctccgcc 26257720



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 276      ggttgcggccgaggagggga 295
                ||||||||||||||||||||
Sbjct: 25996555 ggttgcggccgaggagggga 25996536



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 276      ggttgcggccgaggagggga 295
                ||||||||||||||||||||
Sbjct: 13646433 ggttgcggccgaggagggga 13646414



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 8       tctatcttcttcttcttcct 27
               ||||||||||||||||||||
Sbjct: 3902677 tctatcttcttcttcttcct 3902696

to top

>emb|BX814040.1|CNS0ADHI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB53ZD03 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1563

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 11   atcttcttcttcttcctcttccc 33
            |||||||||||||||||||||||
Sbjct: 1374 atcttcttcttcttcctcttccc 1352

to top

>gb|BT003911.1| Arabidopsis thaliana clone RAFL15-24-G06 (R20663) unknown protein
            (At1g47340) mRNA, complete cds
          Length = 1645

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 11   atcttcttcttcttcctcttccc 33
            |||||||||||||||||||||||
Sbjct: 1330 atcttcttcttcttcctcttccc 1308

to top

>gb|AC015449.3|AC015449 Arabidopsis thaliana chromosome I BAC T3F24 genomic sequence, complete
             sequence
          Length = 77424

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 11    atcttcttcttcttcctcttccc 33
             |||||||||||||||||||||||
Sbjct: 52954 atcttcttcttcttcctcttccc 52932

to top

>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region
          Length = 2229817

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 12      tcttcttcttcttcctcttcccc 34
               |||||||||||||||||||||||
Sbjct: 1118747 tcttcttcttcttcctcttcccc 1118725



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 12      tcttcttcttcttcctcttcc 32
               |||||||||||||||||||||
Sbjct: 2217311 tcttcttcttcttcctcttcc 2217331

to top

>dbj|AP004334.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0455H11
          Length = 101607

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 12    tcttcttcttcttcctcttccccgatccgcc 42
             |||||||||||||| ||||||||| ||||||
Sbjct: 32318 tcttcttcttcttcttcttccccgctccgcc 32348

to top

>dbj|AP005393.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0488D02
          Length = 154537

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 26863 tcttcttcttcttcctcttcccc 26885

to top

>dbj|AP005559.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1163_C07
          Length = 107121

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 94741 tcttcttcttcttcctcttcccc 94763

to top

>dbj|AB006706.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MVA3
          Length = 81701

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 12    tcttcttcttcttcctcttccccgatc 38
             |||||||||||||| ||||||||||||
Sbjct: 76088 tcttcttcttcttcttcttccccgatc 76114

to top

>dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0519E12
          Length = 152448

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 12     tcttcttcttcttcctcttccccgatccgcc 42
              |||||||||||||| ||||||||| ||||||
Sbjct: 149548 tcttcttcttcttcttcttccccgctccgcc 149578

to top

>gb|AC004212.1|AC004212 Homo sapiens clone UWGC:y67c126 from 6p21, complete sequence
          Length = 39395

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 12924 tcttcttcttcttcctcttcccc 12902

to top

>gb|AC167979.3| Mus musculus BAC clone CH36-45M24 from chromosome 12, complete sequence
          Length = 173138

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 121280 tcttcttcttcttcctcttcccc 121258

to top

>emb|AL928811.8| Mouse DNA sequence from clone RP23-74P23 on chromosome 2, complete
              sequence
          Length = 222061

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 191737 tcttcttcttcttcctcttcccc 191759

to top

>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence
          Length = 149232

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 79166 tcttcttcttcttcctcttcccc 79188



 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 78915 tcttcttcttcttcctcttcccc 78937



 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 78761 tcttcttcttcttcctcttcccc 78783



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 79296 tcttcttcttcttcctcttc 79315



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 79013 tcttcttcttcttcctcttc 79032



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 78900 tcttcttcttcttcctcttc 78919



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 78282 tcttcttcttcttcctcttc 78301

to top

>emb|AL672219.7| Mouse DNA sequence from clone RP23-456B9 on chromosome 9, complete
              sequence
          Length = 206125

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 147523 tcttcttcttcttcctcttcccc 147501

to top

>emb|AL713875.14| Mouse DNA sequence from clone RP23-17N7 on chromosome 11, complete
             sequence
          Length = 201123

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 54028 tcttcttcttcttcctcttcccc 54006

to top

>dbj|AB023050.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA class I region,
             clone:832F2, complete sequence
          Length = 112018

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 12    tcttcttcttcttcctcttcccc 34
             |||||||||||||||||||||||
Sbjct: 93777 tcttcttcttcttcctcttcccc 93755

to top

>emb|AL627185.10| Mouse DNA sequence from clone RP23-332E2 on chromosome 4, complete
              sequence
          Length = 120180

 Score = 46.1 bits (23), Expect = 0.070
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 12     tcttcttcttcttcctcttcccc 34
              |||||||||||||||||||||||
Sbjct: 109660 tcttcttcttcttcctcttcccc 109638

to top

>gb|AC009253.17| Drosophila melanogaster clone BACR24F17, complete sequence
          Length = 160280

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 13    cttcttcttcttcctcttcccc 34
             ||||||||||||||||||||||
Sbjct: 19911 cttcttcttcttcctcttcccc 19932

to top

>ref|NM_128509.2| Arabidopsis thaliana phosphopyruvate hydratase AT2G29560 mRNA,
          complete cds
          Length = 1686

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 11 atcttcttcttcttcctcttcc 32
          ||||||||||||||||||||||
Sbjct: 48 atcttcttcttcttcctcttcc 27

to top

>ref|NM_121649.4| Arabidopsis thaliana IPP1; isopentenyl-diphosphate delta-isomerase
           AT5G16440 (IPP1) mRNA, complete cds
          Length = 1061

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 12  tcttcttcttcttcctcttccc 33
           ||||||||||||||||||||||
Sbjct: 95  tcttcttcttcttcctcttccc 116

to top

>gb|AC167537.7| Mus musculus chromosome 8, clone RP23-99B10, complete sequence
          Length = 201791

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 13    cttcttcttcttcctcttcccc 34
             ||||||||||||||||||||||
Sbjct: 22295 cttcttcttcttcctcttcccc 22316

to top

>ref|XM_630125.1| Dictyostelium discoideum hypothetical protein (DDB0183900), partial
           mRNA
          Length = 1851

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 309 atcttcttcttcttcctcttcc 288

to top

>ref|XM_479829.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1370

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 11 atcttcttcttcttcctcttcc 32
          ||||||||||||||||||||||
Sbjct: 24 atcttcttcttcttcctcttcc 45

to top

>ref|XM_507104.1| PREDICTED Oryza sativa (japonica cultivar-group), B1203H11.11
          mRNA
          Length = 1406

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 11 atcttcttcttcttcctcttcc 32
          ||||||||||||||||||||||
Sbjct: 23 atcttcttcttcttcctcttcc 44

to top

>gb|AC160765.4| Mus musculus BAC clone RP23-26O24 from chromosome 13, complete sequence
          Length = 234761

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 57626 atcttcttcttcttcctcttcc 57647

to top

>gb|AC167244.2| Mus musculus BAC clone RP24-84C23 from chromosome 9, complete sequence
          Length = 235852

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 55010 atcttcttcttcttcctcttcc 54989

to top

>gb|AC025722.2| Caenorhabditis elegans cosmid Y50D4C, complete sequence
          Length = 72325

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 12    tcttcttcttcttcctcttccccgatccgccatt 45
             |||||||||||||||||||| ||| ||| |||||
Sbjct: 43847 tcttcttcttcttcctcttctccggtcccccatt 43880

to top

>gb|AC166258.12| Mus musculus  BAC RP23-353G9 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 216565

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 13     cttcttcttcttcctcttcccc 34
              ||||||||||||||||||||||
Sbjct: 204760 cttcttcttcttcctcttcccc 204739



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 80651 tcttcttcttcttcctcttcc 80631

to top

>gb|AC100212.8| Mus musculus chromosome 18, clone RP23-60D22, complete sequence
          Length = 225698

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 81461 atcttcttcttcttcctcttcc 81482



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 81492 tcttcttcttcttcctcttcc 81512

to top

>ref|XM_715407.1| Candida albicans SC5314 hypothetical protein (CaO19_2750), mRNA
          Length = 312

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 10  tatcttcttcttcttcctcttc 31
           ||||||||||||||||||||||
Sbjct: 173 tatcttcttcttcttcctcttc 194

to top

>ref|XM_715406.1| Candida albicans SC5314 hypothetical protein (CaO19_2749), mRNA
          Length = 1473

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 10   tatcttcttcttcttcctcttc 31
            ||||||||||||||||||||||
Sbjct: 1180 tatcttcttcttcttcctcttc 1159

to top

>ref|XM_715176.1| Candida albicans SC5314 hypothetical protein (CaO19_10264), mRNA
          Length = 312

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 10  tatcttcttcttcttcctcttc 31
           ||||||||||||||||||||||
Sbjct: 173 tatcttcttcttcttcctcttc 194

to top

>ref|XM_715175.1| Candida albicans SC5314 hypothetical protein (CaO19_10263), mRNA
          Length = 1473

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 10   tatcttcttcttcttcctcttc 31
            ||||||||||||||||||||||
Sbjct: 1180 tatcttcttcttcttcctcttc 1159

to top

>gb|AC140443.2| Mus musculus BAC clone RP24-171A23 from chromosome 13, complete
             sequence
          Length = 180633

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 15462 atcttcttcttcttcctcttcc 15441

to top

>ref|XM_855075.1| PREDICTED: Canis familiaris similar to transcriptional regulator ATRX
            isoform 1, transcript variant 7 (LOC480963), mRNA
          Length = 9004

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 4488 atcttcttcttcttcctcttcc 4467

to top

>ref|XM_855031.1| PREDICTED: Canis familiaris similar to transcriptional regulator ATRX
            isoform 1, transcript variant 6 (LOC480963), mRNA
          Length = 8873

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 4357 atcttcttcttcttcctcttcc 4336

to top

>ref|XM_854999.1| PREDICTED: Canis familiaris similar to transcriptional regulator ATRX
            isoform 1, transcript variant 5 (LOC480963), mRNA
          Length = 9011

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 4495 atcttcttcttcttcctcttcc 4474

to top

>ref|XM_854964.1| PREDICTED: Canis familiaris similar to transcriptional regulator ATRX
            isoform 1, transcript variant 4 (LOC480963), mRNA
          Length = 9077

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 4600 atcttcttcttcttcctcttcc 4579

to top

>ref|XM_854924.1| PREDICTED: Canis familiaris similar to transcriptional regulator ATRX
            isoform 1, transcript variant 3 (LOC480963), mRNA
          Length = 9134

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 4627 atcttcttcttcttcctcttcc 4606

to top

>ref|XM_854886.1| PREDICTED: Canis familiaris similar to transcriptional regulator ATRX
            isoform 1, transcript variant 2 (LOC480963), mRNA
          Length = 5656

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 4582 atcttcttcttcttcctcttcc 4561

to top

>ref|XM_538084.2| PREDICTED: Canis familiaris similar to transcriptional regulator ATRX
            isoform 1, transcript variant 1 (LOC480963), mRNA
          Length = 9098

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 4582 atcttcttcttcttcctcttcc 4561

to top

>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence
          Length = 243671

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 80434 atcttcttcttcttcctcttcc 80455

to top

>ref|XR_002963.1| PREDICTED: Mus musculus hypothetical protein LOC670415 (LOC670415),
           mRNA
          Length = 466

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 12  tcttcttcttcttcctcttccc 33
           ||||||||||||||||||||||
Sbjct: 370 tcttcttcttcttcctcttccc 349

to top

>ref|XM_983307.1| PREDICTED: Mus musculus PR domain containing 10, transcript variant 3
            (Prdm10), mRNA
          Length = 3096

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 1786 atcttcttcttcttcctcttcc 1765

to top

>ref|XM_983332.1| PREDICTED: Mus musculus PR domain containing 10, transcript variant
           4 (Prdm10), mRNA
          Length = 1960

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 650 atcttcttcttcttcctcttcc 629

to top

>ref|XM_983270.1| PREDICTED: Mus musculus PR domain containing 10, transcript variant
           2 (Prdm10), mRNA
          Length = 3716

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 674 atcttcttcttcttcctcttcc 653

to top

>ref|XM_983233.1| PREDICTED: Mus musculus PR domain containing 10, transcript variant
           1 (Prdm10), mRNA
          Length = 3728

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 674 atcttcttcttcttcctcttcc 653

to top

>ref|XM_922774.2| PREDICTED: Mus musculus PR domain containing 10, transcript variant
           7 (Prdm10), mRNA
          Length = 1961

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 651 atcttcttcttcttcctcttcc 630

to top

>ref|XM_922769.1| PREDICTED: Mus musculus PR domain containing 10, transcript variant
           6 (Prdm10), mRNA
          Length = 3486

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 444 atcttcttcttcttcctcttcc 423

to top

>ref|XM_913442.1| PREDICTED: Mus musculus PR domain containing 10, transcript variant
           5 (Prdm10), mRNA
          Length = 3498

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 444 atcttcttcttcttcctcttcc 423

to top

>gb|AC126426.3| Mus musculus BAC clone RP24-291G13 from chromosome 13, complete sequence
          Length = 201051

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 13     cttcttcttcttcctcttcccc 34
              ||||||||||||||||||||||
Sbjct: 122598 cttcttcttcttcctcttcccc 122619

to top

>ref|XM_568751.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNB00050) partial mRNA
          Length = 5912

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 12   tcttcttcttcttcctcttccc 33
            ||||||||||||||||||||||
Sbjct: 5783 tcttcttcttcttcctcttccc 5762

to top

>ref|XM_799689.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053503747.40) partial mRNA
          Length = 1929

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 1905 atcttcttcttcttcctcttcc 1884

to top

>ref|XM_803117.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053504009.60) partial mRNA
          Length = 3405

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 1128 atcttcttcttcttcctcttcc 1107

to top

>gb|AY163378.1| Zea mays putative ROP family GTPase ROP9 gene, complete cds
          Length = 3625

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                        
Query: 5  ccatctatcttcttcttcttcctcttcccc 34
          |||||| |||||||||||||| ||||||||
Sbjct: 17 ccatctctcttcttcttcttcttcttcccc 46

to top

>gb|AY163377.1| Zea mays putative ROP family GTPase ROP9 mRNA, complete cds
          Length = 1136

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                        
Query: 5  ccatctatcttcttcttcttcctcttcccc 34
          |||||| |||||||||||||| ||||||||
Sbjct: 18 ccatctctcttcttcttcttcttcttcccc 47

to top

>ref|XM_812966.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053511245.110) partial mRNA
          Length = 2988

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 1575 atcttcttcttcttcctcttcc 1554

to top

>gb|AC164702.2| Mus musculus BAC clone RP23-402H19 from chromosome 10, complete sequence
          Length = 208221

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 11     atcttcttcttcttcctcttcc 32
              ||||||||||||||||||||||
Sbjct: 188278 atcttcttcttcttcctcttcc 188299

to top

>gb|AC163665.4| Mus musculus BAC clone RP23-325J23 from chromosome 16, complete
             sequence
          Length = 209920

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 12    tcttcttcttcttcctcttccc 33
             ||||||||||||||||||||||
Sbjct: 79565 tcttcttcttcttcctcttccc 79544



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 168035 tcttcttcttcttcctcttcc 168055



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 167993 tcttcttcttcttcctcttcc 168013



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 168305 tcttcttcttcttcctcttc 168324



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 168155 tcttcttcttcttcctcttc 168174

to top

>emb|AL513191.4| Human DNA sequence from clone RP11-224F24 on chromosome 1 Contains the
             5' end of a novel gene novel gene (FLJ34497), complete
             sequence
          Length = 153830

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 8     tctatcttcttcttcttcctcttccc 33
             |||| |||||||||||||||||||||
Sbjct: 97275 tctaccttcttcttcttcctcttccc 97300

to top

>emb|AL390777.13| Human DNA sequence from clone RP11-301F14 on chromosome 9 Contains the
             5' end of the NTRK2 gene for Neurotrophic tyrosine kinase,
             receptor, type 2 (TRKB) and a CpG island, complete
             sequence
          Length = 182914

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 13    cttcttcttcttcctcttcccc 34
             ||||||||||||||||||||||
Sbjct: 78822 cttcttcttcttcctcttcccc 78843

to top

>emb|AL138958.18| Human DNA sequence from clone RP11-206I15 on chromosome 13 Contains the
             3' end of a novel gene (KIAA0410), a transcription
             elongation factor B (SIII) polypeptide 2 (18kD, elongin B)
             (TCEB2) pseudogene, the 5' end of the ATP8A2 gene for
             aminophospholipid transporter-like ATPase Class I type 8A
             member 2  and three CpG islands, complete sequence
          Length = 162973

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 62552 atcttcttcttcttcctcttcc 62573

to top

>emb|Z69730.1|SPAC22H10 S.pombe chromosome I cosmid c22H10
          Length = 27227

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 10    tatcttcttcttcttcctcttc 31
             ||||||||||||||||||||||
Sbjct: 23489 tatcttcttcttcttcctcttc 23510

to top

>gb|AY035128.1| Arabidopsis thaliana putative enolase 2-phospho-D-glycerate
          hydroylase (At2g29560) mRNA, complete cds
          Length = 1605

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 11 atcttcttcttcttcctcttcc 32
          ||||||||||||||||||||||
Sbjct: 48 atcttcttcttcttcctcttcc 27

to top

>emb|AL669858.8| Mouse DNA sequence from clone RP23-51G7 on chromosome 11 Contains a
             ribosomal protein L15 (Rpl15) pseudogene, the Otx1 gene
             for orthodenticle homolog 1, the 3' end of a novel gene
             and two CpG islands, complete sequence
          Length = 240514

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 15226 atcttcttcttcttcctcttcc 15205

to top

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
            sequence
          Length = 1632307

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 12   tcttcttcttcttcctcttccc 33
            ||||||||||||||||||||||
Sbjct: 9050 tcttcttcttcttcctcttccc 9071



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 13    cttcttcttcttcctcttccc 33
             |||||||||||||||||||||
Sbjct: 21576 cttcttcttcttcctcttccc 21596



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 13     cttcttcttcttcctcttcc 32
              ||||||||||||||||||||
Sbjct: 387429 cttcttcttcttcctcttcc 387410

to top

>gb|AY935523.1| Aedes aegypti CTCF-like protein mRNA, complete cds
          Length = 2616

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 427 atcttcttcttcttcctcttcc 406

to top

>gb|AF465682.1| Strongylocentrotus droebechiensis alpha-tubulin 2 (TUBA2) gene,
           partial cds
          Length = 1560

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 10  tatcttcttcttcttcctcttc 31
           ||||||||||||||||||||||
Sbjct: 502 tatcttcttcttcttcctcttc 481

to top

>gb|AC107398.4| Homo sapiens BAC clone RP11-731J8 from 4, complete sequence
          Length = 136836

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 50023 atcttcttcttcttcctcttcc 50044

to top

>gb|AC004561.3| Arabidopsis thaliana chromosome 2 clone F16P2 map ve014, complete
             sequence
          Length = 131743

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 13102 atcttcttcttcttcctcttcc 13123

to top

>gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, complete sequence
          Length = 149015

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 40659 atcttcttcttcttcctcttcc 40638

to top

>dbj|AK139221.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730073K21 product:PR domain
           containing 10, full insert sequence
          Length = 1721

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 431 atcttcttcttcttcctcttcc 410

to top

>gb|AC021192.7| Homo sapiens BAC clone RP11-767N15 from 4, complete sequence
          Length = 202563

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 7     atctatcttcttcttcttcctcttcc 32
             |||| |||||||||||||||||||||
Sbjct: 20940 atctctcttcttcttcttcctcttcc 20915

to top

>gb|AY065053.1| Arabidopsis thaliana AT5g16440/MQK4_17 mRNA, complete cds
          Length = 1037

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 12 tcttcttcttcttcctcttccc 33
          ||||||||||||||||||||||
Sbjct: 66 tcttcttcttcttcctcttccc 87

to top

>gb|AF332093.1|AF332093 White spot syndrome virus, complete genome
          Length = 305107

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 10    tatcttcttcttcttcctcttc 31
             ||||||||||||||||||||||
Sbjct: 55535 tatcttcttcttcttcctcttc 55514

to top

>dbj|AK164883.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:D930044B03 product:PR domain containing
            10, full insert sequence
          Length = 3064

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 11   atcttcttcttcttcctcttcc 32
            ||||||||||||||||||||||
Sbjct: 1773 atcttcttcttcttcctcttcc 1752

to top

>dbj|AB169911.1| Macaca fascicularis brain cDNA, clone: QtrA-13442, similar to human
           amyloid beta (A4) precursor-like protein 2 (APLP2),
           mRNA, RefSeq: NM_001642.1
          Length = 3560

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 768 atcttcttcttcttcctcttcc 747

to top

>ref|NM_001019179.1| Schizosaccharomyces pombe 972h- hypothetical protein
           (SPAC22H10.11c), partial mRNA
          Length = 1890

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 10  tatcttcttcttcttcctcttc 31
           ||||||||||||||||||||||
Sbjct: 628 tatcttcttcttcttcctcttc 607

to top

>gb|AC160147.6| Mus musculus 10 BAC RP24-576A6 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 145198

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 13   cttcttcttcttcctcttcccc 34
            ||||||||||||||||||||||
Sbjct: 2997 cttcttcttcttcctcttcccc 2976

to top

>gb|AC022740.4|AC022740 Homo sapiens chromosome 15, clone RP11-617D22, complete sequence
          Length = 162482

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 78919 atcttcttcttcttcctcttcc 78898

to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 11      atcttcttcttcttcctcttcc 32
               ||||||||||||||||||||||
Sbjct: 1123186 atcttcttcttcttcctcttcc 1123165



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 12       tcttcttcttcttcctcttcc 32
                |||||||||||||||||||||
Sbjct: 26565245 tcttcttcttcttcctcttcc 26565265



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 9      ctatcttcttcttcttcctcttccc 33
              ||||||||||||||||| |||||||
Sbjct: 244425 ctatcttcttcttcttcttcttccc 244449



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 12       tcttcttcttcttcctcttc 31
                ||||||||||||||||||||
Sbjct: 27951469 tcttcttcttcttcctcttc 27951450

to top

>emb|BX820555.1|CNS0A8M3 Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTPGH47ZG12 of Hormone Treated Callus of strain
          col-0 of Arabidopsis thaliana (thale cress)
          Length = 1602

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 11 atcttcttcttcttcctcttcc 32
          ||||||||||||||||||||||
Sbjct: 39 atcttcttcttcttcctcttcc 18

to top

>emb|BX829906.1|CNS09ZYW Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTFB45ZC08 of Flowers and buds of strain col-0
          of Arabidopsis thaliana (thale cress)
          Length = 963

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 12 tcttcttcttcttcctcttccc 33
          ||||||||||||||||||||||
Sbjct: 7  tcttcttcttcttcctcttccc 28

to top

>gb|AF369029.2| White spot syndrome virus, complete genome
          Length = 292967

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 10     tatcttcttcttcttcctcttc 31
              ||||||||||||||||||||||
Sbjct: 104487 tatcttcttcttcttcctcttc 104466

to top

>gb|AC112666.9| Mus musculus chromosome 3, clone RP24-119D5, complete sequence
          Length = 193302

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 7     atctatcttcttcttcttcctcttcc 32
             |||| |||||||||||||||||||||
Sbjct: 55187 atctttcttcttcttcttcctcttcc 55212

to top

>dbj|AP006723.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:B1203H11
          Length = 156561

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 36423 atcttcttcttcttcctcttcc 36402

to top

>emb|BX000428.10| Mouse DNA sequence from clone RP23-474G7 on chromosome X, complete
             sequence
          Length = 162246

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 12    tcttcttcttcttcctcttccc 33
             ||||||||||||||||||||||
Sbjct: 64138 tcttcttcttcttcctcttccc 64117

to top

>dbj|AB018117.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQL5
          Length = 88398

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 55281 atcttcttcttcttcctcttcc 55260

to top

>dbj|AB005242.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4
          Length = 82001

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 12    tcttcttcttcttcctcttccc 33
             ||||||||||||||||||||||
Sbjct: 38546 tcttcttcttcttcctcttccc 38567

to top

>gb|AF440570.1| Shrimp white spot syndrome virus, complete genome
          Length = 307287

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 10    tatcttcttcttcttcctcttc 31
             ||||||||||||||||||||||
Sbjct: 89117 tatcttcttcttcttcctcttc 89096

to top

>dbj|AK104952.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-D12,
          full insert sequence
          Length = 1405

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 11 atcttcttcttcttcctcttcc 32
          ||||||||||||||||||||||
Sbjct: 23 atcttcttcttcttcctcttcc 44

to top

>dbj|AK069887.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038B06,
          full insert sequence
          Length = 1370

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                
Query: 11 atcttcttcttcttcctcttcc 32
          ||||||||||||||||||||||
Sbjct: 24 atcttcttcttcttcctcttcc 45

to top

>gb|AY106325.1| Zea mays PCO091374 mRNA sequence
          Length = 1451

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 5   ccatctatcttcttcttcttcctcttcccc 34
           |||||| |||||||||||||| ||||||||
Sbjct: 334 ccatctctcttcttcttcttcttcttcccc 363

to top

>gb|AC005598.6|AC005598 Homo sapiens chromosome 4 clone C0024K08 map 4p16, complete sequence
          Length = 166743

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 33839 atcttcttcttcttcctcttcc 33860

to top

>gb|AE003669.5| Drosophila melanogaster chromosome 2L, section 78 of 83 of the complete
             sequence
          Length = 273993

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 13    cttcttcttcttcctcttcccc 34
             ||||||||||||||||||||||
Sbjct: 24707 cttcttcttcttcctcttcccc 24728

to top

>gb|AC157793.6| Mus musculus chromosome 1, clone RP24-175H22, complete sequence
          Length = 130354

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 12    tcttcttcttcttcctcttccc 33
             ||||||||||||||||||||||
Sbjct: 44135 tcttcttcttcttcctcttccc 44114

to top

>gb|AC121256.22| Mus musculus chromosome 1, clone RP24-576N23, complete sequence
          Length = 182551

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 12    tcttcttcttcttcctcttccc 33
             ||||||||||||||||||||||
Sbjct: 35664 tcttcttcttcttcctcttccc 35643

to top

>gb|AC005187.1|AC005187 Homo sapiens chromosome 4 clone B153K6 map 4q25, complete sequence
          Length = 114621

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 75101 atcttcttcttcttcctcttcc 75122

to top

>gb|AC137155.3| Mus musculus BAC clone RP23-66E11 from 12, complete sequence
          Length = 211064

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 11     atcttcttcttcttcctcttcc 32
              ||||||||||||||||||||||
Sbjct: 169099 atcttcttcttcttcctcttcc 169120

to top

>gb|BC064128.1| Mus musculus PR domain containing 10, mRNA (cDNA clone
           IMAGE:3975690), complete cds
          Length = 1924

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 11  atcttcttcttcttcctcttcc 32
           ||||||||||||||||||||||
Sbjct: 600 atcttcttcttcttcctcttcc 579

to top

>dbj|AP004950.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT42E10, TM0123,
             complete sequence
          Length = 79601

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 11    atcttcttcttcttcctcttcc 32
             ||||||||||||||||||||||
Sbjct: 27973 atcttcttcttcttcctcttcc 27952

to top

>emb|AL831718.6| Mouse DNA sequence from clone RP23-146O20 on chromosome X, complete
             sequence
          Length = 116076

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 13    cttcttcttcttcctcttcccc 34
             ||||||||||||||||||||||
Sbjct: 75298 cttcttcttcttcctcttcccc 75277

to top

>gb|AC171318.3| Mus musculus chromosome 8, clone wi1-1251L9, complete sequence
          Length = 36339

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 13   cttcttcttcttcctcttcccc 34
            ||||||||||||||||||||||
Sbjct: 2372 cttcttcttcttcctcttcccc 2351

to top

>gb|AC116136.9| Mus musculus chromosome 5, clone RP23-116G17, complete sequence
          Length = 212184

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 49875 tcttcttcttcttcctcttcc 49855

to top

>gb|AC138358.12| Mus musculus chromosome 1, clone RP24-147G10, complete sequence
          Length = 180227

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 167778 tcttcttcttcttcctcttcc 167798

to top

>gb|AC105976.13| Mus musculus chromosome 5, clone RP24-315H14, complete sequence
          Length = 188130

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 88724 tcttcttcttcttcctcttcc 88704

to top

>gb|AC115795.11| Mus musculus chromosome 5, clone RP23-400O10, complete sequence
          Length = 207103

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 198835 tcttcttcttcttcctcttcc 198855



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 196694 tcttcttcttcttcctcttc 196713

to top

>gb|AY825246.1| Tetrahymena pyriformis translation elongation factor 1B gamma
           subunit mRNA, partial cds
          Length = 1197

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 758 tcttcttcttcttcctcttcc 738

to top

>gb|AC126598.13| Mus musculus chromosome 5, clone RP24-486L9, complete sequence
          Length = 168471

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 125723 tcttcttcttcttcctcttcc 125703

to top

>gb|AC153729.1| Mus musculus  BAC RP23-88C11 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 250801

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 34162 tcttcttcttcttcctcttcc 34182

to top

>ref|NM_199713.1| Danio rerio calreticulin, like 2 (calrl2), mRNA
          Length = 2532

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 1315 tcttcttcttcttcctcttcc 1295

to top

>ref|NM_123795.2| Arabidopsis thaliana protein binding / ubiquitin-protein ligase/
           zinc ion binding AT5G44280 mRNA, complete cds
          Length = 1853

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 433 tcttcttcttcttcctcttcc 413



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 12  tcttcttcttcttcctcttc 31
           ||||||||||||||||||||
Sbjct: 448 tcttcttcttcttcctcttc 429

to top

>ref|NM_115090.3| Arabidopsis thaliana unknown protein AT3G52300 transcript variant
          AT3G52300.1 mRNA, complete cds
          Length = 889

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 11 atcttcttcttcttcctcttc 31
          |||||||||||||||||||||
Sbjct: 49 atcttcttcttcttcctcttc 69

to top

>ref|NM_001035768.1| Arabidopsis thaliana unknown protein AT3G52300 transcript variant
          AT3G52300.2 mRNA, complete cds
          Length = 893

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 11 atcttcttcttcttcctcttc 31
          |||||||||||||||||||||
Sbjct: 49 atcttcttcttcttcctcttc 69

to top

>ref|NM_113022.3| Arabidopsis thaliana ADOF2; DNA binding / transcription factor
          AT3G21270 (ADOF2) mRNA, complete cds
          Length = 1078

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 12 tcttcttcttcttcctcttcc 32
          |||||||||||||||||||||
Sbjct: 17 tcttcttcttcttcctcttcc 37

to top

>ref|NM_129386.2| Arabidopsis thaliana DNA binding / transcription factor AT2G38300
           mRNA, complete cds
          Length = 1551

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 387 tcttcttcttcttcctcttcc 367

to top

>ref|NM_111567.2| Arabidopsis thaliana unknown protein AT3G06870 mRNA, complete cds
          Length = 931

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 11  atcttcttcttcttcctcttc 31
           |||||||||||||||||||||
Sbjct: 595 atcttcttcttcttcctcttc 575

to top

>ref|NM_128940.2| Arabidopsis thaliana SPL3 (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE
           3); transcription factor AT2G33810 (SPL3) mRNA, complete
           cds
          Length = 981

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 418 tcttcttcttcttcctcttcc 398

to top

>ref|NM_101752.2| Arabidopsis thaliana tRNA ligase AT1G18950 mRNA, complete cds
          Length = 2779

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 11   atcttcttcttcttcctcttc 31
            |||||||||||||||||||||
Sbjct: 1913 atcttcttcttcttcctcttc 1893

to top

>ref|NM_129781.2| Arabidopsis thaliana unknown protein AT2G42190 mRNA, complete cds
          Length = 883

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 11  atcttcttcttcttcctcttc 31
           |||||||||||||||||||||
Sbjct: 466 atcttcttcttcttcctcttc 446

to top

>ref|NM_113643.1| Arabidopsis thaliana unknown protein AT3G27290 mRNA, complete cds
          Length = 1895

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 89  tcttcttcttcttcctcttcc 109

to top

>ref|NM_124527.3| Arabidopsis thaliana copper ion binding AT5G51480 mRNA, complete
          cds
          Length = 2263

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 11 atcttcttcttcttcctcttc 31
          |||||||||||||||||||||
Sbjct: 52 atcttcttcttcttcctcttc 72

to top

>ref|NM_104228.3| Arabidopsis thaliana MUM4 (MUCILAGE-MODIFIED 4); catalytic
           AT1G53500 (MUM4) mRNA, complete cds
          Length = 2526

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 153 tcttcttcttcttcctcttcc 173

to top

>ref|NM_105349.2| Arabidopsis thaliana antiporter/ drug transporter/ transporter
          AT1G66780 mRNA, complete cds
          Length = 1458

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 11 atcttcttcttcttcctcttc 31
          |||||||||||||||||||||
Sbjct: 51 atcttcttcttcttcctcttc 31

to top

>ref|NM_127534.2| Arabidopsis thaliana PRF1 (PROFILIN 1); actin binding AT2G19760
           (PRF1) mRNA, complete cds
          Length = 783

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 11  atcttcttcttcttcctcttc 31
           |||||||||||||||||||||
Sbjct: 102 atcttcttcttcttcctcttc 82

to top

>gb|AC152960.1| Mus musculus 6 BAC RP23-38B21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 222030

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 134959 tcttcttcttcttcctcttcc 134979

to top

>gb|AC114617.16| Mus musculus chromosome 5, clone RP24-84E3, complete sequence
          Length = 200977

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 105038 tcttcttcttcttcctcttcc 105018

to top

>ref|NM_126303.2| Arabidopsis thaliana STI (STICHEL) AT2G02480 (STI) mRNA, complete
           cds
          Length = 4163

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 11  atcttcttcttcttcctcttc 31
           |||||||||||||||||||||
Sbjct: 541 atcttcttcttcttcctcttc 521

to top

>ref|NM_113468.3| Arabidopsis thaliana CHUP1 (CHLOROPLAST UNUSUAL POSITIONING 1)
           AT3G25690 (CHUP1) mRNA, complete cds
          Length = 3379

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 416 tcttcttcttcttcctcttcc 396

to top

>ref|NM_112968.3| Arabidopsis thaliana EIN3 (ETHYLENE-INSENSITIVE3); transcription
          factor AT3G20770 (EIN3) mRNA, complete cds
          Length = 2413

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 12 tcttcttcttcttcctcttcc 32
          |||||||||||||||||||||
Sbjct: 79 tcttcttcttcttcctcttcc 99

to top

>gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, complete sequence
          Length = 186266

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 58264 tcttcttcttcttcctcttcc 58284

to top

>gb|AC165256.2| Mus musculus BAC clone RP23-216O10 from chromosome 9, complete sequence
          Length = 231728

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 208575 tcttcttcttcttcctcttcc 208555



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 208554 tcttcttcttcttcctcttcc 208534



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 192755 tcttcttcttcttcctcttcc 192735

to top

>gb|AC131995.14| Mus musculus chromosome 1, clone RP24-338G10, complete sequence
          Length = 153731

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 22383 tcttcttcttcttcctcttcc 22403

to top

>gb|AC102311.10| Mus musculus chromosome 1, clone RP24-426M1, complete sequence
          Length = 175758

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 161253 tcttcttcttcttcctcttcc 161273

to top

>gb|BC043352.2| Homo sapiens zinc finger and BTB domain containing 4, mRNA (cDNA
           clone MGC:49935 IMAGE:6175382), complete cds
          Length = 5888

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 579 tcttcttcttcttcctcttcc 599

to top

>gb|AC152957.1| Mus musculus 6 BAC RP23-353I5 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 203225

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 66094 tcttcttcttcttcctcttcc 66114



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 65841 tcttcttcttcttcctcttcc 65861

to top

>gb|AC154808.2| Mus musculus BAC clone RP24-512K19 from chromosome 13, complete
            sequence
          Length = 187080

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 7365 tcttcttcttcttcctcttcc 7345



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 155172 tcttcttcttcttcctcttc 155191

to top

>gb|AC166709.9| Mus musculus chromosome 1, clone RP23-406B10, complete sequence
          Length = 175924

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 129779 tcttcttcttcttcctcttcc 129799

to top

>gb|AC141887.5| Mus musculus BAC clone RP23-478L20 from chromosome 7, complete sequence
          Length = 163916

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 133837 tcttcttcttcttcctcttcc 133817

to top

>gb|AC102130.7| Mus musculus chromosome 3, clone RP23-223I2, complete sequence
          Length = 176409

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 44789 tcttcttcttcttcctcttcc 44769

to top

>gb|AC154516.2| Mus musculus BAC clone RP24-83D23 from chromosome 14, complete sequence
          Length = 216566

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 158993 tcttcttcttcttcctcttcc 159013

to top

>gb|AC157992.7| Mus musculus chromosome 8, clone RP23-302J17, complete sequence
          Length = 196519

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 83562 tcttcttcttcttcctcttcc 83582



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   tcttcttcttcttcctcttc 31
            ||||||||||||||||||||
Sbjct: 3565 tcttcttcttcttcctcttc 3546



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   tcttcttcttcttcctcttc 31
            ||||||||||||||||||||
Sbjct: 3547 tcttcttcttcttcctcttc 3528

to top

>gb|AC164397.6| Mus musculus chromosome 1, clone RP23-276M15, complete sequence
          Length = 196086

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 179342 tcttcttcttcttcctcttcc 179322

to top

>gb|AY421967.1| Cryptococcus gattii strain ATCC 32609 MAT-alpha mating locus, fragment
             IV
          Length = 34039

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 21475 tcttcttcttcttcctcttcc 21495

to top

>gb|AC099884.12| Mus musculus chromosome 15, clone RP23-11F24, complete sequence
          Length = 265797

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 12150 tcttcttcttcttcctcttcc 12130

to top

>gb|AC102739.7| Mus musculus chromosome 5, clone RP24-309H3, complete sequence
          Length = 191542

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 51666 tcttcttcttcttcctcttcc 51686

to top

>gb|AC117757.23| Mus musculus chromosome 1, clone RP24-420I4, complete sequence
          Length = 183087

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 133496 tcttcttcttcttcctcttcc 133476

to top

>gb|AC158551.5| Mus musculus chromosome 8, clone RP23-466C10, complete sequence
          Length = 177561

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 38507 tcttcttcttcttcctcttcc 38487



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 118522 tcttcttcttcttcctcttc 118541



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 118504 tcttcttcttcttcctcttc 118523

to top

>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence
          Length = 175318

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 47087 tcttcttcttcttcctcttcc 47107



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 46955 tcttcttcttcttcctcttcc 46975

to top

>ref|XM_633564.1| Dictyostelium discoideum hypothetical protein (DDB0218589), partial
           mRNA
          Length = 900

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 11  atcttcttcttcttcctcttc 31
           |||||||||||||||||||||
Sbjct: 579 atcttcttcttcttcctcttc 559

to top

>ref|XM_631860.1| Dictyostelium discoideum hypothetical protein (DDB0187751), partial
            mRNA
          Length = 8853

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 2309 tcttcttcttcttcctcttcc 2289

to top

>gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome 16, complete sequence
          Length = 182658

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 41261 tcttcttcttcttcctcttcc 41241



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 41105 tcttcttcttcttcctcttcc 41085

to top

>gb|AC160389.4| Mus musculus chromosome 7, clone RP23-257G13, complete sequence
          Length = 237741

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 100373 tcttcttcttcttcctcttcc 100353

to top

>gb|AC115006.12| Mus musculus chromosome 8, clone RP24-184D21, complete sequence
          Length = 163874

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 27427 tcttcttcttcttcctcttcc 27407

to top

>gb|AC114667.12| Mus musculus chromosome 1, clone RP24-175L10, complete sequence
          Length = 171306

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 27814 tcttcttcttcttcctcttcc 27834

to top

>gb|AY337613.1| Vitis vinifera 9-cis-epoxycarotenoid dioxygenase 1 (NCED1) mRNA,
           complete cds
          Length = 2273

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 161 tcttcttcttcttcctcttcc 181

to top

>ref|XM_639032.1| Dictyostelium discoideum hypothetical protein (DDB0167703), partial
            mRNA
          Length = 3579

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 11   atcttcttcttcttcctcttc 31
            |||||||||||||||||||||
Sbjct: 1440 atcttcttcttcttcctcttc 1420

to top

>ref|XM_639017.1| Dictyostelium discoideum hypothetical protein (DDB0217536), partial
            mRNA
          Length = 2733

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 11   atcttcttcttcttcctcttc 31
            |||||||||||||||||||||
Sbjct: 1704 atcttcttcttcttcctcttc 1724

to top

>gb|AC115749.12| Mus musculus chromosome 3, clone RP23-14C17, complete sequence
          Length = 230988

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 109372 tcttcttcttcttcctcttcc 109352

to top

>ref|XM_642353.1| Dictyostelium discoideum SMAD/FHA domain-containing protein
            (DDB0220692), partial mRNA
          Length = 2190

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 1019 tcttcttcttcttcctcttcc 999

to top

>ref|XM_641631.1| Dictyostelium discoideum hypothetical protein (DDB0190983),
          partial mRNA
          Length = 4644

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 12 tcttcttcttcttcctcttcc 32
          |||||||||||||||||||||
Sbjct: 71 tcttcttcttcttcctcttcc 51

to top

>ref|XM_641118.1| Dictyostelium discoideum hypothetical protein (DDB0216685), partial
            mRNA
          Length = 3339

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 1904 tcttcttcttcttcctcttcc 1884

to top

>gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, complete sequence
          Length = 172348

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 21578 tcttcttcttcttcctcttcc 21598

to top

>gb|AC121851.4| Mus musculus chromosome 8 clone RP24-92F5, complete sequence
          Length = 184603

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 134945 tcttcttcttcttcctcttcc 134925



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 160635 tcttcttcttcttcctcttc 160654

to top

>ref|XM_640458.1| Dictyostelium discoideum putative RNA polymerase III subunit
           (DDB0216316), partial mRNA
          Length = 1974

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 11  atcttcttcttcttcctcttc 31
           |||||||||||||||||||||
Sbjct: 240 atcttcttcttcttcctcttc 220

to top

>ref|XM_640188.1| Dictyostelium discoideum hypothetical protein (DDB0168788), partial
            mRNA
          Length = 5340

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 11   atcttcttcttcttcctcttc 31
            |||||||||||||||||||||
Sbjct: 2262 atcttcttcttcttcctcttc 2242

to top

>ref|XM_639141.1| Dictyostelium discoideum hypothetical protein (DDB0217574),
          partial mRNA
          Length = 1467

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 11 atcttcttcttcttcctcttc 31
          |||||||||||||||||||||
Sbjct: 66 atcttcttcttcttcctcttc 86

to top

>ref|XM_638977.1| Dictyostelium discoideum hypothetical protein (DDB0167752), partial
           mRNA
          Length = 4317

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 236 tcttcttcttcttcctcttcc 216

to top

>gb|AC109498.10| Mus musculus chromosome 5, clone RP23-22K24, complete sequence
          Length = 218246

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 3410 tcttcttcttcttcctcttcc 3430



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 213714 tcttcttcttcttcctcttc 213733

to top

>ref|XM_637292.1| Dictyostelium discoideum SMAD/FHA domain-containing protein
            (DDB0220703), partial mRNA
          Length = 2148

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 1064 tcttcttcttcttcctcttcc 1044

to top

>ref|XM_636969.1| Dictyostelium discoideum hypothetical protein (DDB0204358), partial
            mRNA
          Length = 9849

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 11   atcttcttcttcttcctcttc 31
            |||||||||||||||||||||
Sbjct: 1359 atcttcttcttcttcctcttc 1339

to top

>ref|XM_636657.1| Dictyostelium discoideum hypothetical protein (DDB0205674), partial
           mRNA
          Length = 2298

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 656 tcttcttcttcttcctcttcc 636

to top

>ref|XM_634285.1| Dictyostelium discoideum hypothetical protein (DDB0218412), partial
           mRNA
          Length = 711

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 350 tcttcttcttcttcctcttcc 330

to top

>ref|XM_629681.1| Dictyostelium discoideum hypothetical protein (DDB0184310), partial
            mRNA
          Length = 2937

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 1403 tcttcttcttcttcctcttcc 1383

to top

>ref|XM_629430.1| Dictyostelium discoideum hypothetical protein (DDB0215535), partial
            mRNA
          Length = 3666

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 3602 tcttcttcttcttcctcttcc 3582



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 13   cttcttcttcttcctcttcc 32
            ||||||||||||||||||||
Sbjct: 3631 cttcttcttcttcctcttcc 3612

to top

>ref|XM_629371.1| Dictyostelium discoideum hypothetical protein (DDB0185172), partial
           mRNA
          Length = 2103

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 434 tcttcttcttcttcctcttcc 414



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 12  tcttcttcttcttcctcttc 31
           ||||||||||||||||||||
Sbjct: 401 tcttcttcttcttcctcttc 382

to top

>ref|XM_629057.1| Dictyostelium discoideum hypothetical protein (DDB0192055), partial
            mRNA
          Length = 4926

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 1490 tcttcttcttcttcctcttcc 1470



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 12   tcttcttcttcttcctcttc 31
            ||||||||||||||||||||
Sbjct: 1436 tcttcttcttcttcctcttc 1417

to top

>ref|XM_511977.1| PREDICTED: Pan troglodytes LOC455235 (LOC455235), mRNA
          Length = 1062

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 632 tcttcttcttcttcctcttcc 612

to top

>gb|AC166826.4| Mus musculus BAC clone RP23-370K22 from chromosome 16, complete sequence
          Length = 180840

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 137772 tcttcttcttcttcctcttcc 137792

to top

>gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosome 16, complete
             sequence
          Length = 186202

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 10778 tcttcttcttcttcctcttcc 10758

to top

>gb|AC163351.2| Mus musculus BAC clone RP23-150D4 from chromosome 13, complete
            sequence
          Length = 214062

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 5450 tcttcttcttcttcctcttcc 5470

to top

>gb|AC165426.3| Mus musculus BAC clone RP23-157G2 from chromosome 5, complete sequence
          Length = 245594

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 231590 tcttcttcttcttcctcttcc 231570

to top

>gb|AC154400.2| Mus musculus BAC clone RP23-163P4 from chromosome 16, complete sequence
          Length = 180951

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 95477 tcttcttcttcttcctcttcc 95457

to top

>gb|AC164550.2| Mus musculus BAC clone RP23-469K15 from chromosome 12, complete
             sequence
          Length = 161775

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 37814 tcttcttcttcttcctcttcc 37794

to top

>gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosome 13, complete
             sequence
          Length = 162597

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 28400 tcttcttcttcttcctcttcc 28420



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 28286 tcttcttcttcttcctcttcc 28306



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 28101 tcttcttcttcttcctcttcc 28121



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 7613 tcttcttcttcttcctcttcc 7633



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 28244 tcttcttcttcttcctcttc 28263



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 28229 tcttcttcttcttcctcttc 28248



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 28196 tcttcttcttcttcctcttc 28215



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 28086 tcttcttcttcttcctcttc 28105



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   tcttcttcttcttcctcttc 31
            ||||||||||||||||||||
Sbjct: 8309 tcttcttcttcttcctcttc 8328



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 12   tcttcttcttcttcctcttc 31
            ||||||||||||||||||||
Sbjct: 8069 tcttcttcttcttcctcttc 8088

to top

>gb|AC159627.2| Mus musculus BAC clone RP24-202P24 from chromosome 12, complete
           sequence
          Length = 168305

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 239 tcttcttcttcttcctcttcc 259

to top

>gb|AC159245.2| Mus musculus BAC clone RP24-260B5 from chromosome 12, complete sequence
          Length = 168773

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 92457 tcttcttcttcttcctcttcc 92477

to top

>gb|AC167814.4| Mus musculus BAC clone RP24-248O12 from chromosome 17, complete sequence
          Length = 177174

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 121279 tcttcttcttcttcctcttcc 121299

to top

>gb|AC127565.5| Mus musculus BAC clone RP24-292K9 from chromosome 7, complete sequence
          Length = 188650

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 130805 tcttcttcttcttcctcttcc 130785

to top

>gb|AC164302.2| Mus musculus BAC clone RP23-286N12 from chromosome 16, complete
             sequence
          Length = 192765

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 82277 tcttcttcttcttcctcttcc 82257

to top

>gb|AC163660.4| Mus musculus BAC clone RP23-283J16 from chromosome 13, complete
             sequence
          Length = 198752

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 88438 tcttcttcttcttcctcttcc 88418

to top

>gb|AC166364.2| Mus musculus BAC clone RP24-394E6 from chromosome 3, complete sequence
          Length = 227070

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 140688 tcttcttcttcttcctcttcc 140708

to top

>gb|AC162799.4| Mus musculus BAC clone RP24-392E13 from chromosome 3, complete sequence
          Length = 177586

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 98712 tcttcttcttcttcctcttcc 98732



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 29514 tcttcttcttcttcctcttc 29533

to top

>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence
          Length = 196951

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 164279 tcttcttcttcttcctcttcc 164299



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 164207 tcttcttcttcttcctcttcc 164227



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 164546 tcttcttcttcttcctcttc 164565

to top

>gb|AC168054.4| Mus musculus BAC clone RP24-571H12 from chromosome 9, complete
            sequence
          Length = 136974

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 4885 tcttcttcttcttcctcttcc 4905



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 12     tcttcttcttcttcctcttc 31
              ||||||||||||||||||||
Sbjct: 128065 tcttcttcttcttcctcttc 128084

to top

>gb|AC168217.2| Mus musculus BAC clone RP24-498P8 from chromosome 9, complete sequence
          Length = 171426

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 152148 tcttcttcttcttcctcttcc 152128

to top

>gb|AC160986.5| Mus musculus BAC clone RP23-258K21 from chromosome 6, complete sequence
          Length = 209886

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 112400 tcttcttcttcttcctcttcc 112380

to top

>gb|AC166832.2| Mus musculus BAC clone RP23-220N17 from chromosome 16, complete
             sequence
          Length = 172644

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 16294 tcttcttcttcttcctcttcc 16314

to top

>gb|AC154510.2| Mus musculus BAC clone RP23-210I20 from chromosome 13, complete sequence
          Length = 186169

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 12     tcttcttcttcttcctcttcc 32
              |||||||||||||||||||||
Sbjct: 131078 tcttcttcttcttcctcttcc 131058

to top

>gb|AC161342.10| Mus musculus chromosome 1, clone RP23-313K17, complete sequence
          Length = 181572

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 84894 tcttcttcttcttcctcttcc 84914



 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tcttcttcttcttcctcttc 31
             ||||||||||||||||||||
Sbjct: 84843 tcttcttcttcttcctcttc 84862

to top

>gb|AC154039.17| Mus musculus 10 BAC RP23-282M20 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 210923

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 8993 tcttcttcttcttcctcttcc 8973

to top

>ref|XM_509959.1| PREDICTED: Pan troglodytes WD repeat and HMG-box DNA binding protein
            1 (LOC452918), mRNA
          Length = 5040

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 3707 tcttcttcttcttcctcttcc 3687

to top

>ref|XM_522538.1| PREDICTED: Pan troglodytes similar to Probable RNA-binding protein
            KIAA0682 (LOC467138), mRNA
          Length = 5937

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 2684 tcttcttcttcttcctcttcc 2664

to top

>ref|XM_479680.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 5502

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 9   ctatcttcttcttcttcctcttccc 33
           ||||||||||||||||| |||||||
Sbjct: 186 ctatcttcttcttcttcttcttccc 210

to top

>ref|XM_466864.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 592

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 12 tcttcttcttcttcctcttcc 32
          |||||||||||||||||||||
Sbjct: 99 tcttcttcttcttcctcttcc 79

to top

>gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, complete sequence
          Length = 190857

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 12    tcttcttcttcttcctcttcc 32
             |||||||||||||||||||||
Sbjct: 55257 tcttcttcttcttcctcttcc 55237

to top

>ref|XM_463777.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 682

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 12  tcttcttcttcttcctcttcc 32
           |||||||||||||||||||||
Sbjct: 398 tcttcttcttcttcctcttcc 378

to top

>ref|NM_197238.1| Oryza sativa (japonica cultivar-group) putative myosin-related
            protein (OSJNBa0062C05.4), mRNA
          Length = 3392

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 12   tcttcttcttcttcctcttcc 32
            |||||||||||||||||||||
Sbjct: 3235 tcttcttcttcttcctcttcc 3255


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,133,931
Number of Sequences: 3902068
Number of extensions: 4133931
Number of successful extensions: 747182
Number of sequences better than 10.0: 4396
Number of HSP's better than 10.0 without gapping: 4441
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 584353
Number of HSP's gapped (non-prelim): 150623
length of query: 328
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 306
effective length of database: 17,147,199,772
effective search space: 5247043130232
effective search space used: 5247043130232
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result