ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart57f08 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DQ307168.1| Glossina morsitans morsitans clone TC433 scavenger receptor protein mRNA, complete cds Length = 2419 Score = 48.1 bits (24), Expect = 0.034 Identities = 24/24 (100%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||||||||||| Sbjct: 555 gctgctgatgctgatgttgatgtt 532
>gb|AF161269.1| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0034K24, complete sequence Length = 142852 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Plus Query: 382 gaggaggttgggaacctgatgc 403 |||||||||||||||||||||| Sbjct: 106565 gaggaggttgggaacctgatgc 106586
>emb|BX908808.1| Neurospora crassa DNA linkage group IV Cosmid contig G21B4 Length = 177225 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatg 596 |||||||||||||||||||||| Sbjct: 163554 gctgctgatgctgatgttgatg 163533
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 382 gaggaggttgggaacctgatgc 403 |||||||||||||||||||||| Sbjct: 23280410 gaggaggttgggaacctgatgc 23280389
>gb|AF459639.1| Triticum monococcum BAC clones 116F2 and 115G1 gene sequence Length = 215241 Score = 44.1 bits (22), Expect = 0.53 Identities = 34/38 (89%) Strand = Plus / Minus Query: 159 gatgaggacccgatgcccctcaatggcaaccctcatcc 196 ||||||||| ||||||| ||||||||||||| ||||| Sbjct: 155957 gatgaggactggatgcccatcaatggcaacccccatcc 155920
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.53 Identities = 22/22 (100%) Strand = Plus / Minus Query: 382 gaggaggttgggaacctgatgc 403 |||||||||||||||||||||| Sbjct: 23590320 gaggaggttgggaacctgatgc 23590299
>ref|XM_369438.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein (MG06026.4) partial mRNA Length = 1905 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgat 595 ||||||||||||||||||||| Sbjct: 1636 gctgctgatgctgatgttgat 1616
>gb|AC160248.6| Pan troglodytes BAC clone CH251-541A22 from chromosome unknown, complete sequence Length = 182426 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 290 tcctgggcctgctgttgctgctgacgacg 318 ||||||| |||||| |||||||||||||| Sbjct: 177795 tcctggggctgctgctgctgctgacgacg 177823
>gb|DQ356948.1| Crocodilepox virus, complete genome Length = 190054 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 569 cctgacgctgctgatgctgat 589 ||||||||||||||||||||| Sbjct: 88927 cctgacgctgctgatgctgat 88907
>ref|XM_753356.1| Ustilago maydis 521 hypothetical protein (UM02302.1) partial mRNA Length = 2895 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 2769 ctgggcctgctgttgctgctg 2749
>ref|XM_863447.1| PREDICTED: Canis familiaris similar to TATA-box binding protein (TATA-box factor) (TATA binding factor) (TATA sequence-binding protein) (Transcription initiation factor TFIID TBP subunit), transcript variant 2 (LOC611193), mRNA Length = 1023 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 456 ctgggcctgctgttgctgctg 436
>ref|XM_849432.1| PREDICTED: Canis familiaris similar to TATA-box binding protein (TATA-box factor) (TATA binding factor) (TATA sequence-binding protein) (Transcription initiation factor TFIID TBP subunit), transcript variant 1 (LOC611193), mRNA Length = 1191 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 456 ctgggcctgctgttgctgctg 436
>emb|AJ009797.1|SRE9797 Streptomyces reticuli ceb gene cluster including cebE, cebF, cebG, bglC genes, partial Length = 4308 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 294 gggcctgctgttgctgctgac 314 ||||||||||||||||||||| Sbjct: 2960 gggcctgctgttgctgctgac 2980
>gb|AC097725.2| Drosophila melanogaster 3L BAC RP98-48E19 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 176521 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 93597 ctgggcctgctgttgctgctg 93577
>gb|AE005839.1| Caulobacter crescentus CB15 section 165 of 359 of the complete genome Length = 13036 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 517 tgcagggtgatatggaggcgg 537 ||||||||||||||||||||| Sbjct: 8359 tgcagggtgatatggaggcgg 8339
>ref|NM_167990.1| Drosophila melanogaster BTB-protein-VII CG11494-RA, transcript variant A (BtbVII), mRNA Length = 3884 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 923 ctgggcctgctgttgctgctg 903
>ref|NM_079172.2| Drosophila melanogaster BTB-protein-VII CG11494-RB, transcript variant B (BtbVII), mRNA Length = 3789 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 828 ctgggcctgctgttgctgctg 808
>ref|NM_078717.2| Drosophila melanogaster kismet CG3696-RA, transcript variant A (kis), mRNA Length = 17918 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 1468 ctgggcctgctgttgctgctg 1448
>gb|AF269441.1|AF269441 Staphylococcus epidermidis strain SR1 clone step.1003h02 genomic sequence Length = 3073 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 406 caccagctgcacctgctgctg 426 ||||||||||||||||||||| Sbjct: 2847 caccagctgcacctgctgctg 2867
>gb|AC008371.4| Drosophila melanogaster, chromosome 2L, region 21D-21D, BAC clone BACR22C14, complete sequence Length = 163461 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 65238 ctgggcctgctgttgctgctg 65258
>dbj|AK003689.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110014F02 product:lysophospholipase 2, full insert sequence Length = 1552 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 50 ctgggcctgctgttgctgctg 30
>gb|AY051895.1| Drosophila melanogaster LD38452 full length cDNA Length = 3310 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 923 ctgggcctgctgttgctgctg 903
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 382 gaggaggttgggaacctgatg 402 ||||||||||||||||||||| Sbjct: 4400368 gaggaggttgggaacctgatg 4400348
>gb|AF215703.1|AF215703 Drosophila melanogaster KISMET-L long isoform (kis) mRNA, complete cds Length = 17424 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 1468 ctgggcctgctgttgctgctg 1448
>gb|AF270229.1|AF270229 Staphylococcus epidermidis strain SR1 clone step.1055d10 genomic sequence Length = 3432 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 406 caccagctgcacctgctgctg 426 ||||||||||||||||||||| Sbjct: 558 caccagctgcacctgctgctg 578
>gb|CP000029.1| Staphylococcus epidermidis RP62A, complete genome Length = 2616530 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 406 caccagctgcacctgctgctg 426 ||||||||||||||||||||| Sbjct: 184680 caccagctgcacctgctgctg 184660
>gb|AE003590.3| Drosophila melanogaster chromosome 2L, section 1 of 83 of the complete sequence Length = 305900 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 241216 ctgggcctgctgttgctgctg 241236
>gb|AE003477.3| Drosophila melanogaster chromosome 3L, section 11 of 83 of the complete sequence Length = 297894 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 79719 ctgggcctgctgttgctgctg 79699
>gb|AE015929.1| Staphylococcus epidermidis ATCC 12228, complete genome Length = 2499279 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 406 caccagctgcacctgctgctg 426 ||||||||||||||||||||| Sbjct: 300429 caccagctgcacctgctgctg 300409
>emb|CT033775.6| Mouse DNA sequence from clone RP24-145H15 on chromosome 13, complete sequence Length = 168176 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 101 ttcctggtctgctcctgtgta 121 ||||||||||||||||||||| Sbjct: 19879 ttcctggtctgctcctgtgta 19899
>emb|AJ555613.1|HVU555613 Hordeum vulgare subsp. vulgare mRNA for metallothionein-like protein type 3 (mt-3a gene) Length = 334 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 401 tgcggcaccagctgcacctgc 421 ||||||||||||||||||||| Sbjct: 185 tgcggcaccagctgcacctgc 205
>gb|AC004274.1|AC004274 Drosophila melanogaster DNA sequence (P1 DS07049 (D133)), complete sequence Length = 65196 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 38538 ctgggcctgctgttgctgctg 38518
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 382 gaggaggttgggaacctgatg 402 ||||||||||||||||||||| Sbjct: 4400349 gaggaggttgggaacctgatg 4400329
>emb|AL954157.3|CNS08CCV Oryza sativa chromosome 12, . BAC OSJNBa0042N11 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 168699 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 382 gaggaggttgggaacctgatg 402 ||||||||||||||||||||| Sbjct: 104128 gaggaggttgggaacctgatg 104148
>emb|BX001060.3|CNS08CE8 Oryza sativa chromosome 12, . BAC OSJNBa0056M17 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 178147 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 382 gaggaggttgggaacctgatg 402 ||||||||||||||||||||| Sbjct: 51343 gaggaggttgggaacctgatg 51363
>gb|L47973.1|DOGTBPR Canis familiaris TATA-box binding protein (TBP) gene, partial cds Length = 178 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 292 ctgggcctgctgttgctgctg 312 ||||||||||||||||||||| Sbjct: 97 ctgggcctgctgttgctgctg 77
>ref|XM_636546.1| Dictyostelium discoideum hypothetical protein (DDB0205778), partial mRNA Length = 3060 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 ||||||||||||||||||| |||| Sbjct: 1928 gctgctgatgctgatgttgttgtt 1905
>gb|AY702979.1| Capsicum annuum clone YAC YCA22D8 genomic sequence Length = 103975 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 579 ctgatgctgatgttgatgtt 598 |||||||||||||||||||| Sbjct: 65933 ctgatgctgatgttgatgtt 65914
>gb|AE017132.1| Yersinia pestis biovar Medievalis str. 91001 section 6 of 16 of the complete genome Length = 290155 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 ataatcctgacgctgctgat 583 |||||||||||||||||||| Sbjct: 142100 ataatcctgacgctgctgat 142081
>gb|AC115718.14| Mus musculus chromosome 8, clone RP23-247P3, complete sequence Length = 232751 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 196037 tgctgatgctgatgttgatg 196018
>gb|AC146440.5| Pan troglodytes BAC clone RP43-11P11 from 7, complete sequence Length = 181369 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 278 cgcacctggagatcctgggcctgc 301 ||||||||||| |||||||||||| Sbjct: 5287 cgcacctggaggtcctgggcctgc 5264
>ref|XM_363644.1| Magnaporthe grisea 70-15 hypothetical protein (MG01570.4) partial mRNA Length = 3912 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 ||||||| |||||||||||||||| Sbjct: 271 gctgctgctgctgatgttgatgtt 248
>ref|XM_363897.1| Magnaporthe grisea 70-15 hypothetical protein (MG01823.4) partial mRNA Length = 2415 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 289 atcctgggcctgctgttgctgctg 312 ||||| |||||||||||||||||| Sbjct: 1620 atccttggcctgctgttgctgctg 1597
>ref|XM_959204.1| Neurospora crassa OR74A hypothetical protein (NCU02139.1) partial mRNA Length = 2313 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 574 cgctgctgatgctgatgttg 593 |||||||||||||||||||| Sbjct: 760 cgctgctgatgctgatgttg 741
>ref|XM_329328.1| Neurospora crassa OR74A hypothetical protein (NCU02139.1) partial mRNA Length = 2313 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 574 cgctgctgatgctgatgttg 593 |||||||||||||||||||| Sbjct: 760 cgctgctgatgctgatgttg 741
>ref|XM_706666.1| Candida albicans SC5314 hypothetical protein (CaO19.10310), mRNA Length = 2859 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||| ||||||||||||| Sbjct: 2435 gctgctgatgttgatgttgatgtt 2412
>ref|XM_706642.1| Candida albicans SC5314 hypothetical protein (CaO19.2792), mRNA Length = 2859 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||| ||||||||||||| Sbjct: 2435 gctgctgatgttgatgttgatgtt 2412
>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome Length = 6397126 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 300 gctgttgctgctgacgacgg 319 |||||||||||||||||||| Sbjct: 6284810 gctgttgctgctgacgacgg 6284791
>gb|AE009952.1| Yersinia pestis KIM, complete genome Length = 4600755 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 564 ataatcctgacgctgctgat 583 |||||||||||||||||||| Sbjct: 2881502 ataatcctgacgctgctgat 2881521
>ref|XM_455838.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F16885g predicted mRNA Length = 1590 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||| ||||||||||||| Sbjct: 295 gctgctgatgttgatgttgatgtt 272
>gb|AY816173.1| Schistosoma japonicum SJCHGC01171 protein mRNA, complete cds Length = 1212 Score = 40.1 bits (20), Expect = 8.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 tgacgctgctgatgctgatgttgatgtt 598 ||||| |||||||||||||| ||||||| Sbjct: 212 tgacgatgctgatgctgatgctgatgtt 239
>ref|XM_001004420.1| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 4 (Ankrd11), mRNA Length = 8387 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 3777 tcctgacgctgctgatgctg 3758
>ref|XM_001004426.1| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 5 (Ankrd11), mRNA Length = 9837 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 5227 tcctgacgctgctgatgctg 5208
>ref|XM_001004428.1| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 7 (Ankrd11), mRNA Length = 17059 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 12449 tcctgacgctgctgatgctg 12430
>ref|XM_001004417.1| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 3 (Ankrd11), mRNA Length = 8997 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 4387 tcctgacgctgctgatgctg 4368
>ref|XM_001004427.1| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 6 (Ankrd11), mRNA Length = 8961 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 4351 tcctgacgctgctgatgctg 4332
>ref|XM_917591.2| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 11 (Ankrd11), mRNA Length = 8885 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 4276 tcctgacgctgctgatgctg 4257
>ref|XM_902609.2| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 4 (Ankrd11), mRNA Length = 8386 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 3777 tcctgacgctgctgatgctg 3758
>ref|XM_902607.2| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 3 (Ankrd11), mRNA Length = 9836 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 5227 tcctgacgctgctgatgctg 5208
>ref|XM_902605.2| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 2 (Ankrd11), mRNA Length = 17058 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 12449 tcctgacgctgctgatgctg 12430
>ref|XM_902618.2| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 9 (Ankrd11), mRNA Length = 8996 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 4387 tcctgacgctgctgatgctg 4368
>ref|XM_134514.6| PREDICTED: Mus musculus ankyrin repeat domain 11, transcript variant 1 (Ankrd11), mRNA Length = 9197 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 4588 tcctgacgctgctgatgctg 4569
>ref|XM_883510.1| Leishmania major strain Friedlin hypothetical protein (L7610.06) partial mRNA Length = 1800 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 293 tgggcctgctgttgctgctg 312 |||||||||||||||||||| Sbjct: 608 tgggcctgctgttgctgctg 589
>ref|XM_755306.1| Ustilago maydis 521 hypothetical protein (UM04252.1) partial mRNA Length = 11682 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 571 tgacgctgctgatgctgatg 590 |||||||||||||||||||| Sbjct: 2225 tgacgctgctgatgctgatg 2206
>emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end Length = 247462 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 tgggcctgctgttgctgctg 312 |||||||||||||||||||| Sbjct: 138054 tgggcctgctgttgctgctg 138073
>ref|XM_384093.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03917.1) partial mRNA Length = 846 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 574 cgctgctgatgctgatgttg 593 |||||||||||||||||||| Sbjct: 189 cgctgctgatgctgatgttg 208
>ref|XM_448483.1| Candida glabrata CBS138, CAGL0K05995g partial mRNA Length = 2385 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 885 tgctgatgctgatgttgatg 866
>gb|AC127235.3| Mus musculus BAC clone RP24-570A23 from chromosome 10, complete sequence Length = 189180 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 125472 tgctgatgctgatgttgatg 125491
>gb|AC107862.10| Mus musculus chromosome 7, clone RP23-378D16, complete sequence Length = 188701 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 63531 gctgctgatgctgatgctgatgtt 63554
>emb|AL663070.15| Human DNA sequence from clone RP3-342P20 on chromosome 1 Contains the gene for a novel protein (FLJ90702, FLJ14997 and FLJ35904), a ribosomal protein S2 (RPS2) pseudogene and two CpG islands, complete sequence Length = 115043 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 289 atcctgggcctgctgttgct 308 |||||||||||||||||||| Sbjct: 42489 atcctgggcctgctgttgct 42470
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 293 tgggcctgctgttgctgctg 312 |||||||||||||||||||| Sbjct: 3405238 tgggcctgctgttgctgctg 3405219
>ref|XM_784184.1| PREDICTED: Strongylocentrotus purpuratus similar to cytoplasmic polyadenylation element binding protein 2 isoform A (LOC584322), mRNA Length = 2339 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 ||||||||||||| |||||||||| Sbjct: 567 gctgctgatgctgctgttgatgtt 544
>ref|XM_791628.1| PREDICTED: Strongylocentrotus purpuratus similar to Fras1 related extracellular matrix protein 1 (LOC592088), mRNA Length = 1847 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 96 aaggtttcctggtctgctcc 115 |||||||||||||||||||| Sbjct: 1569 aaggtttcctggtctgctcc 1550
>ref|XM_782849.1| PREDICTED: Strongylocentrotus purpuratus similar to nuclear protein, ataxia-telangiectasia locus (LOC582916), mRNA Length = 2562 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||| ||||||||| Sbjct: 499 gctgctgatgctgaggttgatgtt 476
>emb|X73901.1|DBPMA1 D.bioculata mRNA for plasma-membrane ATPase Length = 4624 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 207 catcttgttcatgacaatctgcag 230 |||||||||||||||| ||||||| Sbjct: 817 catcttgttcatgacagtctgcag 794
>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y-1140 of Kluyveromyces lactis Length = 2602197 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||| ||||||||||||| Sbjct: 1553812 gctgctgatgttgatgttgatgtt 1553789
>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence Length = 1302002 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 584000 tgctgatgctgatgttgatg 583981
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence Length = 4744671 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 ataatcctgacgctgctgat 583 |||||||||||||||||||| Sbjct: 1885418 ataatcctgacgctgctgat 1885399
>emb|AJ414149.1| Yersinia pestis strain CO92 complete genome; segment 9/20 Length = 193050 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 564 ataatcctgacgctgctgat 583 |||||||||||||||||||| Sbjct: 30080 ataatcctgacgctgctgat 30061
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 tgggcctgctgttgctgctg 312 |||||||||||||||||||| Sbjct: 4647793 tgggcctgctgttgctgctg 4647812 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 291 cctgggcctgctgttgctgctgac 314 ||||||||||||| |||||||||| Sbjct: 848778 cctgggcctgctggtgctgctgac 848755
>emb|X92403.1|HVGTRNAR1 H.vulgare mRNA for glutamyl-tRNA reductase, 1st isoform Length = 1938 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 574 cgctgctgatgctgatgttg 593 |||||||||||||||||||| Sbjct: 1017 cgctgctgatgctgatgttg 1036
>emb|X86101.1|HVHEMA1IS H.vulgare mRNA for glutamyl-tRNA reductase (1st isoform) Length = 1997 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 574 cgctgctgatgctgatgttg 593 |||||||||||||||||||| Sbjct: 1292 cgctgctgatgctgatgttg 1311
>gb|AC104511.5| Drosophila melanogaster X BAC RP98-39D14 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 166000 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 406 caccagctgcacctgctgct 425 |||||||||||||||||||| Sbjct: 139498 caccagctgcacctgctgct 139479
>gb|AC091206.3| Drosophila melanogaster 3L BAC RP98-19M9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 178019 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 12194 gctgctgatgctgatgctgatgtt 12171
>gb|AC010018.6| Drosophila melanogaster 3L BAC RP98-17M19 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 172284 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 114015 gctgctgatgctgatgctgatgtt 114038
>gb|AC023706.4| Drosophila melanogaster X BAC RP98-4D11 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 172854 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 573 acgctgctgatgctgatgttgatg 596 |||||||||||||||||| ||||| Sbjct: 79343 acgctgctgatgctgatgctgatg 79320
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 3477727 tcctgacgctgctgatgctg 3477708
>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 Length = 2324132 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 290 tcctgggcctgctgttgctgctga 313 ||||||| |||||||||||||||| Sbjct: 2226413 tcctggggctgctgttgctgctga 2226436
>ref|NM_164727.1| Drosophila melanogaster CG31908-RB, transcript variant B (CG31908), mRNA Length = 1871 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 1158 gctgctgatgctgatgctgatgtt 1135
>ref|NM_164726.1| Drosophila melanogaster CG31908-RA, transcript variant A (CG31908), mRNA Length = 2041 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 1332 gctgctgatgctgatgctgatgtt 1309
>ref|NM_141240.1| Drosophila melanogaster CG14656-RA (CG14656), mRNA Length = 2805 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 2030 tgctgatgctgatgttgatg 2011
>ref|NM_132613.2| Drosophila melanogaster CG4645-RA (CG4645), mRNA Length = 1539 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 406 caccagctgcacctgctgct 425 |||||||||||||||||||| Sbjct: 1248 caccagctgcacctgctgct 1267
>gb|AC027104.6| Homo sapiens chromosome 15, clone RP11-326L17, complete sequence Length = 180202 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 341 tgatgctgatgatggaggctgggg 364 ||||||||||||||| |||||||| Sbjct: 121873 tgatgctgatgatgggggctgggg 121896
>gb|AY072885.1| Simian immunodeficiency virus isolate 232.S12 surface glycoprotein gene, partial cds Length = 1575 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 579 ctgatgctgatgttgatgtt 598 |||||||||||||||||||| Sbjct: 424 ctgatgctgatgttgatgtt 405
>gb|AY072883.1| Simian immunodeficiency virus isolate 232.S2 surface glycoprotein gene, partial cds Length = 1575 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 579 ctgatgctgatgttgatgtt 598 |||||||||||||||||||| Sbjct: 424 ctgatgctgatgttgatgtt 405
>gb|AC019294.7| Homo sapiens chromosome , clone RP11-24M17, complete sequence Length = 164310 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 341 tgatgctgatgatggaggctgggg 364 ||||||||||||||| |||||||| Sbjct: 34075 tgatgctgatgatgggggctgggg 34098
>gb|AY069287.1| Drosophila melanogaster GM14337 full length cDNA Length = 2029 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 1301 gctgctgatgctgatgctgatgtt 1278
>gb|AF269439.1|AF269439 Staphylococcus epidermidis strain SR1 clone step.1003g08 genomic sequence Length = 3353 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 406 caccagctgcacctgctgct 425 |||||||||||||||||||| Sbjct: 3334 caccagctgcacctgctgct 3353
>gb|AY058677.1| Drosophila melanogaster LD38670 full length cDNA Length = 1369 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 406 caccagctgcacctgctgct 425 |||||||||||||||||||| Sbjct: 1078 caccagctgcacctgctgct 1097
>emb|BX323882.7| Zebrafish DNA sequence from clone DKEYP-123G3 in linkage group 12, complete sequence Length = 127667 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 gtttttctgaatattctgct 83 |||||||||||||||||||| Sbjct: 86038 gtttttctgaatattctgct 86057 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 gtttttctgaatattctgct 83 |||||||||||||||||||| Sbjct: 83059 gtttttctgaatattctgct 83040
>gb|AC008326.9| Drosophila melanogaster, chromosome 2L, region 27C-27C, BAC clone BACR39J17, complete sequence Length = 148780 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 75698 gctgctgatgctgatgctgatgtt 75721
>gb|AC132390.4| Mus musculus BAC clone RP23-453P1 from chromosome 8, complete sequence Length = 200323 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 120804 tgctgatgctgatgttgatg 120785
>dbj|AK019393.1| Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched library, clone:3010027A04 product:hypothetical Lysine-rich region containing protein, full insert sequence Length = 1458 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 1251 tcctgacgctgctgatgctg 1232
>dbj|AK033707.1| Mus musculus adult male cecum cDNA, RIKEN full-length enriched library, clone:9130227N12 product:interleukin-1 receptor-associated kinase 2, full insert sequence Length = 1811 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 282 cctggagatcctgggcctgc 301 |||||||||||||||||||| Sbjct: 1245 cctggagatcctgggcctgc 1226
>emb|AJ507214.1|HVU507214 Hordeum vulgare bbr gene for barley B recombinant Length = 4946 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 2369 tgctgatgctgatgttgatg 2350
>gb|AC007977.12|AC007977 Drosophila melanogaster, chromosome 2L, region 27C-27C, BAC clone BACR13J07, complete sequence Length = 174287 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 132400 gctgctgatgctgatgctgatgtt 132423
>gb|AC008189.3|AC008189 Drosophila melanogaster, chromosome 3R, region 82C-82D, BAC clone BACR02C19, complete sequence Length = 188359 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 141616 tgctgatgctgatgttgatg 141635
>gb|AC009173.9| Homo sapiens chromosome 16 clone RP11-99H5, complete sequence Length = 149842 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 70719 tgctgatgctgatgttgatg 70738
>gb|AE004826.1| Pseudomonas aeruginosa PAO1, section 387 of 529 of the complete genome Length = 10458 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 295 ggcctgctgttgctgctgac 314 |||||||||||||||||||| Sbjct: 999 ggcctgctgttgctgctgac 1018
>gb|AC006343.3| Homo sapiens PAC clone RP4-548K24 from 7q34-q36, complete sequence Length = 124877 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 278 cgcacctggagatcctgggcctgc 301 ||||||||||| |||||||||||| Sbjct: 62820 cgcacctggaggtcctgggcctgc 62843
>dbj|AB179989.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: MN43J Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179987.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: OD14J Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179986.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: OD11J Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179985.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: ND10J Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179984.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: FD21J Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179983.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: SD3J Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179982.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: STD8J Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179980.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: NPL5 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179977.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: RHS1 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179969.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: CHZJ26 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179968.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: CHZJ25 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179967.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: CHZJ23 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179951.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: CHL14 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179950.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: CHL13 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179947.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: CHK16 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179943.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: CHBJ2 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>dbj|AB179939.1| Turnip mosaic virus gene for polyprotein, partial cds, isolate: CH6 Length = 1527 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 1333 tttgctgccttcccagatga 1352
>gb|AC153987.4| Mus musculus 6 BAC RP24-430K15 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 133371 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 282 cctggagatcctgggcctgc 301 |||||||||||||||||||| Sbjct: 98406 cctggagatcctgggcctgc 98387
>emb|X13134.1|SOPSI4 Spinach mRNA for photosystem I subunit V Length = 659 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 575 gctgctgatgctgatgttgatgtt 598 ||||||||||||||||||| |||| Sbjct: 109 gctgctgatgctgatgttgctgtt 86
>emb|X93587.1|LLP0 L.luteus mRNA for P0 ribosomal protein Length = 1393 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 411 gctgcacctgctgctgattc 430 |||||||||||||||||||| Sbjct: 1009 gctgcacctgctgctgattc 1028
>gb|AY809387.1| Schistosoma japonicum clone SJCHGC01172 unknown mRNA Length = 516 Score = 40.1 bits (20), Expect = 8.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 tgacgctgctgatgctgatgttgatgtt 598 ||||| |||||||||||||| ||||||| Sbjct: 20 tgacgatgctgatgctgatgctgatgtt 47
>dbj|AB093626.1| Turnip mosaic virus gene for polyprotein, complete cds, isolate:CHN1 Length = 9798 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 6977 tttgctgccttcccagatga 6996
>dbj|AB093621.1| Turnip mosaic virus gene for polyprotein, complete cds, isolate:KD32J Length = 9798 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 6977 tttgctgccttcccagatga 6996
>dbj|AB093620.1| Turnip mosaic virus gene for polyprotein, complete cds, isolate:59J Length = 9798 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 6977 tttgctgccttcccagatga 6996
>dbj|AB093619.1| Turnip mosaic virus gene for polyprotein, complete cds, isolate:SGD311J Length = 9798 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 6977 tttgctgccttcccagatga 6996
>dbj|AB093618.1| Turnip mosaic virus gene for polyprotein, complete cds, isolate:FD27J Length = 9798 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 6977 tttgctgccttcccagatga 6996
>dbj|AB093614.1| Turnip mosaic virus gene for polyprotein, complete cds, isolate:CP845J Length = 9798 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 6977 tttgctgccttcccagatga 6996
>dbj|AB093613.1| Turnip mosaic virus gene for polyprotein, complete cds, isolate:KYD81J Length = 9798 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 6977 tttgctgccttcccagatga 6996
>dbj|AB093600.1| Turnip mosaic virus gene for polyprotein, complete cds, isolate:ITA7 Length = 9798 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 6977 tttgctgccttcccagatga 6996
>dbj|AB093598.1| Turnip mosaic virus gene for polyprotein, complete cds, isolate:Al Length = 9797 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tttgctgccttcccagatga 40 |||||||||||||||||||| Sbjct: 6977 tttgctgccttcccagatga 6996
>gb|AF114254.1|AF114254 Gossypium hirsutum FS18A (FS18A) gene, complete cds Length = 797 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 236 tgctgatgctgatgttgatg 255
>gb|AE003615.3| Drosophila melanogaster chromosome 2L, section 24 of 83 of the complete sequence Length = 270751 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 268894 gctgctgatgctgatgctgatgtt 268917
>gb|AE003490.3| Drosophila melanogaster chromosome X, section 42 of 74 of the complete sequence Length = 302665 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 406 caccagctgcacctgctgct 425 |||||||||||||||||||| Sbjct: 287669 caccagctgcacctgctgct 287688
>gb|AE003478.3| Drosophila melanogaster chromosome 3L, section 12 of 83 of the complete sequence Length = 317354 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 575 gctgctgatgctgatgttgatgtt 598 |||||||||||||||| ||||||| Sbjct: 25273 gctgctgatgctgatgctgatgtt 25296
>gb|AE003439.3| Drosophila melanogaster chromosome X, section 23 of 74 of the complete sequence Length = 331952 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 573 acgctgctgatgctgatgttgatg 596 |||||||||||||||||| ||||| Sbjct: 51315 acgctgctgatgctgatgctgatg 51292
>gb|AE003605.3| Drosophila melanogaster chromosome 3R, section 3 of 118 of the complete sequence Length = 273418 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 228517 tgctgatgctgatgttgatg 228536
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 333 ccgcctgctgatgctgatga 352 |||||||||||||||||||| Sbjct: 1352292 ccgcctgctgatgctgatga 1352273
>emb|BX000474.13| Mouse DNA sequence from clone RP24-80C21 on chromosome 2, complete sequence Length = 205184 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 577 tgctgatgctgatgttgatg 596 |||||||||||||||||||| Sbjct: 112681 tgctgatgctgatgttgatg 112700
>gb|AC132287.3| Mus musculus BAC clone RP24-302M13 from 8, complete sequence Length = 195405 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 568 tcctgacgctgctgatgctg 587 |||||||||||||||||||| Sbjct: 70423 tcctgacgctgctgatgctg 70442
>dbj|D88382.1| Hordeum vulgare hemA1 mRNA for glutamyl-tRNA reductase, complete cds Length = 1864 Score = 40.1 bits (20), Expect = 8.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 574 cgctgctgatgctgatgttg 593 |||||||||||||||||||| Sbjct: 972 cgctgctgatgctgatgttg 991 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,643,393 Number of Sequences: 3902068 Number of extensions: 5643393 Number of successful extensions: 150815 Number of sequences better than 10.0: 150 Number of HSP's better than 10.0 without gapping: 150 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 149785 Number of HSP's gapped (non-prelim): 1024 length of query: 603 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 580 effective length of database: 17,143,297,704 effective search space: 9943112668320 effective search space used: 9943112668320 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
