ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart57e09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete... 40 0.30
2emb|AL008634.1|HS396D17 Human DNA sequence from clone RP3-396D17... 40 0.30
3emb|AL450321.15| Mouse DNA sequence from clone RP23-232M10 on ch... 40 0.30
4emb|AL391239.6| Human DNA sequence from clone RP5-1068A11 on chr... 38 1.2
5emb|CR859759.1| Pongo pygmaeus mRNA; cDNA DKFZp469D1426 (from cl... 38 1.2
6emb|CR602292.1| full-length cDNA clone CS0DI063YL19 of Placenta ... 38 1.2
7dbj|AK096376.1| Homo sapiens cDNA FLJ39057 fis, clone NT2RP70133... 38 1.2
8gb|AC090420.6| Homo sapiens chromosome 8, clone RP11-346L6, comp... 38 1.2
9gb|AC125435.8| Homo sapiens chromosome 15, clone CTD-2235H24, co... 38 1.2
10gb|AC091230.23| Homo sapiens chromosome 15, clone RP11-414J4, co... 38 1.2
11gb|AC102273.9| Mus musculus chromosome 3, clone RP24-285I22, com... 36 4.6
12gb|AC122309.5| Mus musculus BAC clone RP23-293G2 from chromosome... 36 4.6
13gb|AC136987.11| Mus musculus chromosome 16, clone RP24-129J16, c... 36 4.6
14emb|AL359983.7| Human DNA sequence from clone RP11-139L21 on chr... 36 4.6
15emb|CR848038.1| Chlamydophila abortus strain S26/3, complete genome 36 4.6
16emb|AL596172.1| Listeria innocua Clip11262 complete genome, segm... 36 4.6
17gb|AC106755.2| Homo sapiens chromosome 5 clone RP11-188E14, comp... 36 4.6
18gb|AF430146.1|AF430146 Mus musculus DACH (Dach1) gene, promoter ... 36 4.6
19gb|AC040165.6| Homo sapiens chromosome 16 clone RP11-420O6, comp... 36 4.6
20gb|AC099497.2| Homo sapiens chromosome 5 clone RP11-139A10, comp... 36 4.6
21gb|AC011758.6|AC011758 Drosophila melanogaster, chromosome X, re... 36 4.6
22gb|AC099554.2| Homo sapiens chromosome 5 clone RP11-61G23, compl... 36 4.6
23gb|AE003571.4| Drosophila melanogaster chromosome X, section 68 ... 36 4.6
24emb|AL928812.11| Mouse DNA sequence from clone RP23-321B23 on ch... 36 4.6
25emb|AL591983.1| Listeria monocytogenes strain EGD, complete geno... 36 4.6
26gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete ge... 36 4.6
27emb|AL928942.8| Mouse DNA sequence from clone RP23-97B2 on chrom... 36 4.6

>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome
          Length = 2201561

 Score = 40.1 bits (20), Expect = 0.30
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 21      caactacaaaaagagcagtt 40
               ||||||||||||||||||||
Sbjct: 1769459 caactacaaaaagagcagtt 1769478



to top

>emb|AL008634.1|HS396D17 Human DNA sequence from clone RP3-396D17 on chromosome 1p33-35.3 Contains
              EST, STS, GSS, complete sequence
          Length = 152592

 Score = 40.1 bits (20), Expect = 0.30
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      agtccccaaatcccaactac 27
              ||||||||||||||||||||
Sbjct: 101666 agtccccaaatcccaactac 101647



to top

>emb|AL450321.15| Mouse DNA sequence from clone RP23-232M10 on chromosome 13 Contains a
             novel gene, a non-POU domain containing octamer-binding
             protein (Nono) pseudogene, a Sin3-associated polypeptide
             18 (Sap18) pseudogene, the 5' end of a novel gene and a
             CpG island, complete sequence
          Length = 209175

 Score = 40.1 bits (20), Expect = 0.30
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     gtccccaaatcccaactaca 28
             ||||||||||||||||||||
Sbjct: 88184 gtccccaaatcccaactaca 88203



to top

>emb|AL391239.6| Human DNA sequence from clone RP5-1068A11 on chromosome 1 Contains part
             of the NEGR1 gene for neuronal growth regulator 1,
             complete sequence
          Length = 74368

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 12    cccaaatcccaactacaaaaaga 34
             |||||||||||| ||||||||||
Sbjct: 41917 cccaaatcccaaatacaaaaaga 41895



to top

>emb|CR859759.1| Pongo pygmaeus mRNA; cDNA DKFZp469D1426 (from clone DKFZp469D1426)
          Length = 2437

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 6    ccagtccccaaatcccaac 24
            |||||||||||||||||||
Sbjct: 1837 ccagtccccaaatcccaac 1819



to top

>emb|CR602292.1| full-length cDNA clone CS0DI063YL19 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1787

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 6    ccagtccccaaatcccaac 24
            |||||||||||||||||||
Sbjct: 1225 ccagtccccaaatcccaac 1207



to top

>dbj|AK096376.1| Homo sapiens cDNA FLJ39057 fis, clone NT2RP7013374, highly similar to
            SECRETORY CARRIER-ASSOCIATED MEMBRANE PROTEIN 2
          Length = 2610

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 6    ccagtccccaaatcccaac 24
            |||||||||||||||||||
Sbjct: 2017 ccagtccccaaatcccaac 1999



to top

>gb|AC090420.6| Homo sapiens chromosome 8, clone RP11-346L6, complete sequence
          Length = 216706

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 15     aaatcccaactacaaaaagagca 37
              |||||| ||||||||||||||||
Sbjct: 160583 aaatccaaactacaaaaagagca 160605



to top

>gb|AC125435.8| Homo sapiens chromosome 15, clone CTD-2235H24, complete sequence
          Length = 124255

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 6      ccagtccccaaatcccaac 24
              |||||||||||||||||||
Sbjct: 109788 ccagtccccaaatcccaac 109770



to top

>gb|AC091230.23| Homo sapiens chromosome 15, clone RP11-414J4, complete sequence
          Length = 206482

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 6     ccagtccccaaatcccaac 24
             |||||||||||||||||||
Sbjct: 29641 ccagtccccaaatcccaac 29623



to top

>gb|AC102273.9| Mus musculus chromosome 3, clone RP24-285I22, complete sequence
          Length = 162779

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 3     aagccagtccccaaatcc 20
             ||||||||||||||||||
Sbjct: 70355 aagccagtccccaaatcc 70338



to top

>gb|AC122309.5| Mus musculus BAC clone RP23-293G2 from chromosome 14, complete sequence
          Length = 208443

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 13     ccaaatcccaactacaaa 30
              ||||||||||||||||||
Sbjct: 128129 ccaaatcccaactacaaa 128146



to top

>gb|AC136987.11| Mus musculus chromosome 16, clone RP24-129J16, complete sequence
          Length = 155372

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 6      ccagtccccaaatcccaa 23
              ||||||||||||||||||
Sbjct: 101582 ccagtccccaaatcccaa 101599



to top

>emb|AL359983.7| Human DNA sequence from clone RP11-139L21 on chromosome 1 Contains part
             of a novel gene (FLJ10157), complete sequence
          Length = 166254

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 15    aaatcccaactacaaaaa 32
             ||||||||||||||||||
Sbjct: 54414 aaatcccaactacaaaaa 54397



to top

>emb|CR848038.1| Chlamydophila abortus strain S26/3, complete genome
          Length = 1144377

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 15     aaatcccaactacaaaaa 32
              ||||||||||||||||||
Sbjct: 749756 aaatcccaactacaaaaa 749773



to top

>emb|AL596172.1| Listeria innocua Clip11262 complete genome, segment 10/12
          Length = 248050

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    atcccaactacaaaaaga 34
             ||||||||||||||||||
Sbjct: 91428 atcccaactacaaaaaga 91411



to top

>gb|AC106755.2| Homo sapiens chromosome 5 clone RP11-188E14, complete sequence
          Length = 86871

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    tccccaaatcccaactac 27
             ||||||||||||||||||
Sbjct: 49345 tccccaaatcccaactac 49328



to top

>gb|AF430146.1|AF430146 Mus musculus DACH (Dach1) gene, promoter region and partial cds
          Length = 5938

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 13   ccaaatcccaactacaaa 30
            ||||||||||||||||||
Sbjct: 2202 ccaaatcccaactacaaa 2219



to top

>gb|AC040165.6| Homo sapiens chromosome 16 clone RP11-420O6, complete sequence
          Length = 209756

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 15     aaatcccaactacaaaaa 32
              ||||||||||||||||||
Sbjct: 126607 aaatcccaactacaaaaa 126590



to top

>gb|AC099497.2| Homo sapiens chromosome 5 clone RP11-139A10, complete sequence
          Length = 165884

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 10     tccccaaatcccaactacaaaa 31
              |||||||||||||||| |||||
Sbjct: 100053 tccccaaatcccaacttcaaaa 100032



to top

>gb|AC011758.6|AC011758 Drosophila melanogaster, chromosome X, region 19C-19E, BAC clone
             BACR25I22, complete sequence
          Length = 164942

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                   
Query: 2     caagccagtccccaaatcccaa 23
             ||||||| ||||||||||||||
Sbjct: 84428 caagccaatccccaaatcccaa 84449



to top

>gb|AC099554.2| Homo sapiens chromosome 5 clone RP11-61G23, complete sequence
          Length = 164920

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 10    tccccaaatcccaactacaaaa 31
             |||||||||||||||| |||||
Sbjct: 70067 tccccaaatcccaacttcaaaa 70046



to top

>gb|AE003571.4| Drosophila melanogaster chromosome X, section 68 of 74 of the complete
              sequence
          Length = 302538

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 2      caagccagtccccaaatcccaa 23
              ||||||| ||||||||||||||
Sbjct: 186620 caagccaatccccaaatcccaa 186641



to top

>emb|AL928812.11| Mouse DNA sequence from clone RP23-321B23 on chromosome 2, complete
             sequence
          Length = 199019

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     gcaagccagtccccaaat 18
             ||||||||||||||||||
Sbjct: 60465 gcaagccagtccccaaat 60448



to top

>emb|AL591983.1| Listeria monocytogenes strain EGD, complete genome segment 11/12
          Length = 324050

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 17    atcccaactacaaaaaga 34
             ||||||||||||||||||
Sbjct: 14911 atcccaactacaaaaaga 14894



to top

>gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete genome
          Length = 2905187

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 17      atcccaactacaaaaaga 34
               ||||||||||||||||||
Sbjct: 2363246 atcccaactacaaaaaga 2363229



to top

>emb|AL928942.8| Mouse DNA sequence from clone RP23-97B2 on chromosome 2, complete
             sequence
          Length = 119463

 Score = 36.2 bits (18), Expect = 4.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 1     gcaagccagtccccaaat 18
             ||||||||||||||||||
Sbjct: 55269 gcaagccagtccccaaat 55286


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 423,402
Number of Sequences: 3902068
Number of extensions: 423402
Number of successful extensions: 125331
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 125175
Number of HSP's gapped (non-prelim): 156
length of query: 41
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 21
effective length of database: 17,155,003,908
effective search space: 360255082068
effective search space used: 360255082068
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top