ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart56d02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF123608.1|AF123608 Triticum aestivum clone CYP73-TA cytochro... 944 0.0
2gb|AY034143.1| Sorghum bicolor cinnamic acid 4-hydroxylase (C4H)... 603 e-169
3gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome... 587 e-164
4dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 587 e-164
5dbj|AK104994.2| Oryza sativa (japonica cultivar-group) cDNA clon... 587 e-164
6dbj|AK100598.1| Oryza sativa (japonica cultivar-group) cDNA clon... 587 e-164
7gb|AY104175.1| Zea mays PCO098406 mRNA sequence 535 e-149
8gb|L07634.1|PHVC4HYDRO Vigna radiata var. radiata cinnamate 4-hy... 307 2e-80
9dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 274 3e-70
10dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic D... 274 3e-70
11dbj|AP003302.2| Oryza sativa (japonica cultivar-group) genomic D... 274 3e-70
12dbj|AB234902.1| Verbena x hybrida mRNA for Cinnamic acid 4-hydro... 258 2e-65
13emb|X92437.1|GMCYP73 Glycine max mRNA for cinnamic acid 4-hydrox... 250 5e-63
14gb|AY616436.1| Agastache rugosa cinnamic acid 4-hydroxylase mRNA... 210 4e-51
15gb|DQ075002.1| Malus x domestica cinnamic acid hydroxylase (C4H1... 210 4e-51
16dbj|D87520.1| Glycyrrhiza echinata suspension-cultured cells mRN... 202 1e-48
17gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (TC4H) ... 170 3e-39
18gb|AF255014.2|AF255014 Citrus sinensis cinnamate 4-hydroxylase C... 157 5e-35
19gb|DQ211885.1| Parthenocissus henryana cinnamate-4-hydroxylse mR... 149 1e-32
20gb|AF378333.1|AF378333 Citrus x paradisi cinnamate 4-hydroxylase... 149 1e-32
21gb|AF175275.1|AF175275 Pisum sativum trans-cinnamic acid hydroxy... 149 1e-32
22gb|U29243.2|PSU29243 Pisum sativum wound-inducible trans-cinnami... 149 1e-32
23gb|AY764925.1|AY764925S1 Pinus taeda isolate 27 cinnamate 4-hydr... 147 5e-32
24gb|AY764921.1|AY764921S1 Pinus taeda isolate 29 cinnamate 4-hydr... 147 5e-32
25gb|AY764917.1|AY764917S1 Pinus taeda isolate 1 cinnamate 4-hydro... 147 5e-32
26gb|AY764913.1|AY764913S1 Pinus taeda isolate 17 cinnamate 4-hydr... 147 5e-32
27gb|AY764909.1|AY764909S1 Pinus taeda isolate 8 cinnamate 4-hydro... 147 5e-32
28gb|AY764905.1|AY764905S1 Pinus taeda isolate 28 cinnamate 4-hydr... 147 5e-32
29gb|AY764901.1|AY764901S1 Pinus taeda isolate 19 cinnamate 4-hydr... 147 5e-32
30gb|AY764897.1|AY764897S1 Pinus taeda isolate 3 cinnamate 4-hydro... 147 5e-32
31gb|AY764893.1|AY764893S1 Pinus taeda isolate 2 cinnamate 4-hydro... 147 5e-32
32gb|AY764889.1|AY764889S1 Pinus taeda isolate 10 cinnamate 4-hydr... 147 5e-32
33gb|AY764885.1|AY764885S1 Pinus taeda isolate 14 cinnamate 4-hydr... 147 5e-32
34gb|AY764881.1|AY764881S1 Pinus taeda isolate 30 cinnamate 4-hydr... 147 5e-32
35gb|AY764877.1|AY764877S1 Pinus taeda isolate 13 cinnamate 4-hydr... 147 5e-32
36gb|AY764873.1|AY764873S1 Pinus taeda isolate 25 cinnamate 4-hydr... 147 5e-32
37gb|AY764869.1|AY764869S1 Pinus taeda isolate 7 cinnamate 4-hydro... 147 5e-32
38gb|AY764865.1|AY764865S1 Pinus taeda isolate 11 cinnamate 4-hydr... 147 5e-32
39gb|AY764861.1|AY764861S1 Pinus taeda isolate 24 cinnamate 4-hydr... 147 5e-32
40gb|AY764857.1|AY764857S1 Pinus taeda isolate 12 cinnamate 4-hydr... 147 5e-32
41gb|AY764853.1|AY764853S1 Pinus taeda isolate 20 cinnamate 4-hydr... 147 5e-32
42gb|AY764849.1|AY764849S1 Pinus taeda isolate 15 cinnamate 4-hydr... 147 5e-32
43gb|AY764845.1|AY764845S1 Pinus taeda isolate 5 exon 1 ; and cinn... 147 5e-32
44gb|AY764841.1|AY764841S1 Pinus taeda isolate 31 cinnamate 4-hydr... 147 5e-32
45gb|AY764837.1|AY764837S1 Pinus taeda isolate 21 exon 1 ; and cin... 147 5e-32
46gb|AY764833.1|AY764833S1 Pinus taeda isolate 18 exon 1 ; and cin... 147 5e-32
47gb|AY764829.1|AY764829S1 Pinus taeda isolate 32 exon 1 ; and cin... 147 5e-32
48gb|AY764825.1|AY764825S1 Pinus taeda isolate 22 cinnamate 4-hydr... 147 5e-32
49gb|AY764821.1|AY764821S1 Pinus taeda isolate 23 cinnamate 4-hydr... 147 5e-32
50gb|AY764817.1|AY764817S1 Pinus taeda isolate 9 cinnamate 4-hydro... 147 5e-32
51gb|AY764813.1|AY764813S1 Pinus taeda isolate 26 cinnamate 4-hydr... 147 5e-32
52gb|AY764809.1|AY764809S1 Pinus taeda isolate 4 cinnamate 4-hydro... 147 5e-32
53gb|AY764805.1|AY764805S1 Pinus taeda isolate 6 cinnamate 4-hydro... 147 5e-32
54gb|AY764801.1|AY764801S1 Pinus taeda isolate 16 cinnamate 4-hydr... 147 5e-32
55emb|AJ309127.1|RGR309127 Ruta graveolens mRNA for putative cinna... 127 5e-26
56ref|XM_465542.1| Oryza sativa (japonica cultivar-group), mRNA 125 2e-25
57ref|XM_465538.1| Oryza sativa (japonica cultivar-group), mRNA 125 2e-25
58dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
59dbj|AP004850.3| Oryza sativa (japonica cultivar-group) genomic D... 125 2e-25
60dbj|AK072588.1| Oryza sativa (japonica cultivar-group) cDNA clon... 125 2e-25
61gb|AF548370.1| Ruta graveolens cinnamate 4-hydroxylase (C4H) mRN... 119 1e-23
62gb|AF097664.1|AF097664 Mesembryanthemum crystallinum cinnamate 4... 113 7e-22
63gb|AY621152.1| Camptotheca acuminata cinnamate-4-hydroxylase mRN... 109 1e-20
64dbj|AB055507.1| Lithospermum erythrorhizon C4H-1 mRNA for cinnam... 101 3e-18
65dbj|AB232856.1| Lactuca sativa mRNA for cinnamate 4-hydroxylase,... 100 1e-17
66gb|AF286648.1|AF286648 Gossypium arboreum cinnamate-4-hydroxylas... 92 3e-15
67gb|AF286647.1|AF286647 Gossypium arboreum cinnamate-4-hydroxylas... 90 1e-14
68gb|AY219918.1| Ammi majus cinnamate 4-hydroxylase mRNA, complete... 78 4e-11
69gb|U19922.1|ZEU19922 Zinnia elegans cinnamic acid 4-hydroxylase ... 76 1e-10
70ref|NM_128601.2| Arabidopsis thaliana ATC4H (CINNAMATE-4-HYDROXY... 74 6e-10
71gb|BT008875.1| Arabidopsis thaliana At2g30490 mRNA, complete cds 74 6e-10
72gb|U93215.3| Arabidopsis thaliana chromosome 2 BAC T6B20 genomic... 74 6e-10
73gb|AY065145.1| Arabidopsis thaliana cinnamate-4-hydroxylase (At2... 74 6e-10
74emb|BX819707.1|CNS0AA1Q Arabidopsis thaliana Full-length cDNA Co... 74 6e-10
75emb|BX820902.1|CNS0A9NW Arabidopsis thaliana Full-length cDNA Co... 74 6e-10
76dbj|D78596.1| Arabidopsis thaliana mRNA for trans-cinnamate 4-hy... 74 6e-10
77gb|U37235.1|ATU37235 Arabidopsis thaliana cinnamate 4-hydroxylas... 74 6e-10
78gb|U71081.1|ATU71081 Arabidopsis thaliana cinnamate-4-hydroxylas... 74 6e-10
79gb|U71080.1|ATU71080 Arabidopsis thaliana cinnamate-4-hydroxylas... 74 6e-10
80gb|AF255013.1|AF255013 Citrus sinensis cinnamate 4-hydroxylase C... 72 2e-09
81gb|L38898.1|PUMC4H Petroselinum crispum trans-cinnamate 4-monoox... 72 2e-09
82gb|AC141923.27| Medicago truncatula clone mth2-7f19, complete se... 68 4e-08
83gb|DQ335792.1| Medicago truncatula cytochrome P450 monooxygenase... 68 4e-08
84gb|L11046.1|ALFEICA4HA Medicago sativa elicitor-inducible cinnam... 68 4e-08
85gb|AY641731.2| Camellia sinensis trans-cinnamate 4-hydroxylase (... 66 1e-07
86gb|AY541032.1| Allium cepa cinammate 4-hydroxylase mRNA, complet... 60 9e-06
87emb|AJ007449.2|CAR7449 Cicer arietinum mRNA for Trans-Cinnamate ... 58 3e-05
88gb|AY748324.1| Ginkgo biloba cinnamic acid 4-hydroxylase mRNA, c... 56 1e-04
89gb|AF029856.1|AF029856 Sorghum bicolor cytochrome P450 CYP98A1 (... 54 5e-04
90emb|Z17369.1|HTTC4MMR H.tuberosus mRNA for trans-cinnamate 4-mon... 52 0.002
91gb|AF302495.1|AF302495 Populus trichocarpa X Populus deltoides c... 50 0.009
92gb|AF368378.1| Nicotiana tabacum elicitor-inducible cytochrome P... 48 0.034
93ref|XM_543057.2| PREDICTED: Canis familiaris similar to serologi... 46 0.13
94gb|DQ371297.1| Astragalus membranaceus var. mongholicus trans-ci... 46 0.13
95gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 46 0.13
96gb|AC121849.3| Mus musculus BAC clone RP24-90K18 from chromosome... 44 0.53
97gb|AC124425.3| Mus musculus BAC clone RP24-230N16 from chromosom... 44 0.53
98ref|XM_811087.1| Trypanosoma cruzi strain CL Brener mucin-associ... 44 0.53
99ref|XM_816925.1| Trypanosoma cruzi strain CL Brener mucin-associ... 44 0.53
100gb|AC105305.8| Mus musculus strain C57BL/6J clone rp23-80n4 map ... 44 0.53
101gb|AC105302.27| Mus musculus strain C57BL/6J clone rp23-45h18 ma... 44 0.53
102gb|AC109609.12| Mus musculus strain C57BL/6J clone rp23-167h1 ma... 44 0.53
103emb|AL939106.1|SCO939106 Streptomyces coelicolor A3(2) complete ... 44 0.53
104emb|AL603925.20| Mouse DNA sequence from clone RP23-175K24 on ch... 44 0.53
105gb|AC147632.3| Mus musculus BAC clone RP23-326H18 from chromosom... 44 0.53
106dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 44 0.53
107emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 44 0.53
108gb|AF009336.1|AF009336 Streptomyces coelicolor lipase (lipA), an... 44 0.53
109dbj|AP000439.6| Homo sapiens genomic DNA, chromosome 11 clone:CM... 44 0.53
110gb|AC093319.18| Mus musculus strain C57BL/6J chromosome 17 clone... 44 0.53
111gb|AC132431.3| Mus musculus BAC clone RP23-211M23 from 6, comple... 44 0.53
112emb|AL844895.6| Mouse DNA sequence from clone RP23-359N12 on chr... 44 0.53
113emb|AL844865.6| Mouse DNA sequence from clone RP23-350L23 on chr... 44 0.53
114gb|AC107725.10| Mus musculus chromosome 5, clone RP23-477O15, co... 42 2.1
115gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, comp... 42 2.1
116gb|DP000012.1| Macropus eugenii target 1 genomic scaffold 42 2.1
117gb|AC165965.3| Mus musculus BAC clone RP23-307L24 from chromosom... 42 2.1
118gb|AC099948.9| Mus musculus chromosome 10, clone RP23-19D21, com... 42 2.1
119gb|AC127594.3| Mus musculus BAC clone RP23-44G8 from chromosome ... 42 2.1
120gb|AC110379.3| Mus musculus BAC clone RP24-193N24 from 15, compl... 42 2.1
121gb|AC116659.3| Mus musculus BAC clone RP24-147E15 from 7, comple... 42 2.1
122gb|AC135230.8| Medicago truncatula clone mth2-23e14, complete se... 42 2.1
123gb|AC137829.23| Medicago truncatula clone mth2-34j5, complete se... 42 2.1
124gb|AC158217.4| Mus musculus chromosome 5, clone RP24-377B20, com... 42 2.1
125ref|XM_780739.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.1
126emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete ... 42 2.1
127emb|BX640427.1| Bordetella parapertussis strain 12822, complete ... 42 2.1
128emb|BX640415.1| Bordetella pertussis strain Tohama I, complete g... 42 2.1
129gb|AC106707.9| Homo sapiens 3 BAC RP11-538P18 (Roswell Park Canc... 42 2.1
130gb|AC023715.4| Drosophila melanogaster X BAC RP98-17H6 (Roswell ... 42 2.1
131gb|AC151548.3| Macropus eugenii clone ME_KBa-603H10, complete se... 42 2.1
132gb|AC154811.2| Mus musculus BAC clone RP24-531D17 from chromosom... 42 2.1
133gb|AC011510.7|AC011510 Homo sapiens chromosome 19 clone CTD-2195... 42 2.1
134dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 42 2.1
135dbj|AK110548.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
136emb|AL672107.5| Zebrafish DNA sequence from clone BUSM1-84N18 in... 42 2.1
137gb|AE003432.5| Drosophila melanogaster chromosome X, section 16 ... 42 2.1
138gb|AY664418.1| Zea mays cultivar Mo17 locus 9008, complete sequence 42 2.1
139gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence 42 2.1
140gb|AC146616.3| Mus musculus BAC clone RP23-9A18 from 7, complete... 42 2.1
141gb|U47293.1|PTU47293 Populus tremuloides trans-cinnamate 4-hydro... 42 2.1
142gb|AC120163.10| Mus musculus chromosome 15, clone RP24-466O11, c... 42 2.1
143dbj|AP006142.1| Lotus japonicus genomic DNA, chromosome 2, clone... 42 2.1
144dbj|D82815.1|POPPCYP73D Populus kitakamiensis cyp73a mRNA for ci... 42 2.1
145dbj|D82813.1|POPCYP73BB Populus kitakamiensis cyp73b gene for ci... 42 2.1
146dbj|D82812.1|POPCYP73AA Populus kitakamiensis cyp73a gene for ci... 42 2.1
147gb|AC123684.8| Mus musculus chromosome 3, clone RP23-297F14, com... 40 8.2
148ref|XM_480310.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.2
149gb|AC132347.4| Mus musculus BAC clone RP24-186F6 from chromosome... 40 8.2
150gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 40 8.2
151ref|NM_191387.1| Oryza sativa (japonica cultivar-group), predic... 40 8.2
152ref|XM_514338.1| PREDICTED: Pan troglodytes similar to espin (LO... 40 8.2
153ref|NM_031475.1| Homo sapiens espin (ESPN), mRNA 40 8.2
154gb|AC162037.2| Mus musculus chromosome 8, clone RP23-35K23, comp... 40 8.2
155gb|AY644468.1| Saccharum officinarum mitochondrial alternative o... 40 8.2
156gb|BT015224.1| Drosophila melanogaster RE33368 full insert cDNA 40 8.2
157gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome 40 8.2
158gb|AY881693.1| Baboon herpesvirus 2 strain 860 ICP22 (US1), US2 ... 40 8.2
159gb|AC159902.2| Pan troglodytes BAC clone CH251-493H22 from chrom... 40 8.2
160gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 40 8.2
161ref|XM_582601.2| PREDICTED: Bos taurus similar to Centaurin-beta... 40 8.2
162gb|AE006713.1| Sulfolobus solfataricus P2 section 72 of 272 of t... 40 8.2
163gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 40 8.2
164gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, com... 40 8.2
165gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 8.2
166gb|AY203958.1| Homo sapiens LP2654 mRNA, complete cds 40 8.2
167ref|XM_570147.1| Cryptococcus neoformans var. neoformans JEC21 i... 40 8.2
168gb|AC121999.3| Mus musculus BAC clone RP24-318P16 from chromosom... 40 8.2
169gb|AC135907.1| Genomic sequence for Oryza sativa, Nipponbare str... 40 8.2
170gb|AC126265.3| Mus musculus BAC clone RP23-383O12 from chromosom... 40 8.2
171gb|AC122806.4| Mus musculus BAC clone RP23-297C11 from 8, comple... 40 8.2
172emb|AL606458.5| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 8.2
173ref|XM_537009.2| PREDICTED: Canis familiaris similar to Na(+)/H(... 40 8.2
174ref|XM_848159.1| PREDICTED: Canis familiaris similar to transmem... 40 8.2
175ref|XM_500654.1| Yarrowia lipolytica CLIB122, YALI0B08778g predi... 40 8.2
176emb|AL158217.25| Human DNA sequence from clone RP4-650H14 on chr... 40 8.2
177emb|AL157886.13| Human DNA sequence from clone RP11-59M22 on chr... 40 8.2
178emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chr... 40 8.2
179gb|AC063952.15| Homo sapiens 3 BAC RP11-174O3 (Roswell Park Canc... 40 8.2
180emb|AL049695.20|HSJ236J16 Human DNA sequence from clone RP1-236J... 40 8.2
181emb|AL021920.1|HS163M9 Human DNA sequence from clone RP1-163M9 o... 40 8.2
182gb|AF461424.2| Oryza sativa chromosome 3 clone OSJNBa0016B07, co... 40 8.2
183emb|BX070349.1|CNS09QG1 Single read from an extremity of a full-... 40 8.2
184emb|BX069760.1|CNS09PZO Single read from an extremity of a full-... 40 8.2
185emb|BX069759.1|CNS09PZN Single read from an extremity of a full-... 40 8.2
186emb|BX065533.1|CNS09MQ9 Single read from an extremity of a full-... 40 8.2
187emb|BX065532.1|CNS09MQ8 Single read from an extremity of a full-... 40 8.2
188emb|BX062970.1|CNS09KR2 Single read from an extremity of a full-... 40 8.2
189emb|BX062969.1|CNS09KR1 Single read from an extremity of a full-... 40 8.2
190emb|BX061234.1|CNS09JEU Single read from an extremity of a full-... 40 8.2
191emb|BX061233.1|CNS09JET Single read from an extremity of a full-... 40 8.2
192emb|BX054603.1|CNS09EAN Single read from an extremity of a full-... 40 8.2
193emb|BX031008.1|CNS08W38 Single read from an extremity of a full-... 40 8.2
194emb|BX031007.1|CNS08W37 Single read from an extremity of a full-... 40 8.2
195emb|BX048479.1|CNS099KJ Single read from an extremity of a full-... 40 8.2
196emb|BX046617.1|CNS0984T Single read from an extremity of a full-... 40 8.2
197emb|BX042901.1|CNS0959L Single read from an extremity of a full-... 40 8.2
198emb|BX044684.1|CNS096N4 Single read from an extremity of a full-... 40 8.2
199emb|BX044683.1|CNS096N3 Single read from an extremity of a full-... 40 8.2
200emb|BX036938.1|CNS090NY Single read from an extremity of a full-... 40 8.2
201emb|BX036809.1|CNS090KD Single read from an extremity of a full-... 40 8.2
202emb|BX034667.1|CNS08YWV Single read from an extremity of a full-... 40 8.2
203emb|BX034666.1|CNS08YWU Single read from an extremity of a full-... 40 8.2
204emb|BX033329.1|CNS08XVP Single read from an extremity of a full-... 40 8.2
205emb|BX033328.1|CNS08XVO Single read from an extremity of a full-... 40 8.2
206emb|BX030845.1|CNS08VYP Single read from an extremity of a full-... 40 8.2
207emb|BX030844.1|CNS08VYO Single read from an extremity of a full-... 40 8.2
208emb|BX029157.1|CNS08UNT Single read from an extremity of a full-... 40 8.2
209emb|BX029156.1|CNS08UNS Single read from an extremity of a full-... 40 8.2
210emb|BX027684.1|CNS08TIW Single read from an extremity of a full-... 40 8.2
211emb|BX026573.1|CNS08SO1 Single read from an extremity of a full-... 40 8.2
212emb|BX026572.1|CNS08SO0 Single read from an extremity of a full-... 40 8.2
213emb|BX025408.1|CNS08RRO Single read from an extremity of a full-... 40 8.2
214emb|BX024323.1|CNS08QXJ Single read from an extremity of a full-... 40 8.2
215emb|BX023872.1|CNS08QL0 Single read from an extremity of a full-... 40 8.2
216emb|BX021457.1|CNS08OPX Single read from an extremity of a full-... 40 8.2
217emb|BX021456.1|CNS08OPW Single read from an extremity of a full-... 40 8.2
218emb|BX017857.1|CNS08LXX Single read from an extremity of a full-... 40 8.2
219emb|BX018286.1|CNS08M9U Single read from an extremity of a full-... 40 8.2
220emb|BX018285.1|CNS08M9T Single read from an extremity of a full-... 40 8.2
221emb|BX017607.1|CNS08LQZ Single read from an extremity of a full-... 40 8.2
222emb|BX015877.1|CNS08KEX Single read from an extremity of a full-... 40 8.2
223emb|BX015876.1|CNS08KEW Single read from an extremity of a full-... 40 8.2
224emb|BX015847.1|CNS08KE3 Single read from an extremity of a full-... 40 8.2
225emb|BX013968.1|CNS08IXW Single read from an extremity of a full-... 40 8.2
226emb|BX012987.1|CNS08I6N Single read from an extremity of a full-... 40 8.2
227emb|BX009423.1|CNS08FFN Single read from an extremity of a full-... 40 8.2
228emb|BX009422.1|CNS08FFM Single read from an extremity of a full-... 40 8.2
229emb|BX009321.1|CNS08FCT Single read from an extremity of a full-... 40 8.2
230emb|BX008798.1|CNS08EYA Single read from an extremity of a full-... 40 8.2
231emb|BX008797.1|CNS08EY9 Single read from an extremity of a full-... 40 8.2
232emb|BX008255.1|CNS08EJ7 Single read from an extremity of a full-... 40 8.2
233emb|BX008254.1|CNS08EJ6 Single read from an extremity of a full-... 40 8.2
234emb|BX006970.1|CNS08DJI Single read from an extremity of a full-... 40 8.2
235emb|BX006969.1|CNS08DJH Single read from an extremity of a full-... 40 8.2
236emb|BX005839.1|CNS08CO3 Single read from an extremity of a full-... 40 8.2
237emb|BX005838.1|CNS08CO2 Single read from an extremity of a full-... 40 8.2
238emb|BX842573.1| Mycobacterium tuberculosis H37Rv complete genome... 40 8.2
239emb|BX572607.1| Rhodopseudomonas palustris CGA009 complete genom... 40 8.2
240emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 40 8.2
241emb|BX248335.1| Mycobacterium bovis subsp. bovis AF2122/97 compl... 40 8.2
242emb|AL136880.1|HSM801848 Homo sapiens mRNA; cDNA DKFZp434A196 (f... 40 8.2
243emb|AL035288.1|HS163M094 H.sapiens gene from PAC 163M9, similar ... 40 8.2
244emb|AL596103.22| Mouse DNA sequence from clone RP23-309E16 on ch... 40 8.2
245emb|AL954256.1| Pan troglodytes chromosome 22 clone PTB-129I16 m... 40 8.2
246gb|AC154796.2| Mus musculus BAC clone RP24-490B17 from chromosom... 40 8.2
247dbj|AB110205.1| Oryza sativa (japonica cultivar-group) mRNA for ... 40 8.2
248gb|AE005954.1| Caulobacter crescentus CB15 section 280 of 359 of... 40 8.2
249dbj|AB226196.1| Aspergillus oryzae cDNA, contig sequence: AoEST3055 40 8.2
250gb|AC084429.5| Mus Musculus Chromosome 2 Clone RP23-291P1, compl... 40 8.2
251ref|NM_170166.2| Drosophila melanogaster CG13627-RB, transcript ... 40 8.2
252dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 40 8.2
253dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 8.2
254ref|NM_143022.2| Drosophila melanogaster CG13627-RA, transcript ... 40 8.2
255gb|AE009815.1|AE009815 Pyrobaculum aerophilum strain IM2 section... 40 8.2
256gb|AC160940.2| Pan troglodytes BAC clone CH251-503N14 from chrom... 40 8.2
257ref|XM_928757.1| PREDICTED: Homo sapiens espin pseudogene (ESPNP... 40 8.2
258gb|CP000264.1| Jannaschia sp. CCS1, complete genome 40 8.2
259gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome 40 8.2
260dbj|AB179173.1| Macaca fascicularis testis cDNA clone: QtsA-1411... 40 8.2
261emb|AJ586737.2| Drosophila virilis partial mod(mdg4) gene 40 8.2
262gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 8.2
263gb|AC092221.1|AC092221 Drosophila melanogaster, chromosome 2L, r... 40 8.2
264gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 40 8.2
265dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
266dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
267dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
268gb|AC010708.10|AC010708 Drosophila melanogaster, chromosome X, r... 40 8.2
269gb|AC022348.2|AC022348 Drosophila melanogaster, chromosome X, re... 40 8.2
270gb|AC008205.7|AC008205 Drosophila melanogaster, chromosome 3R, r... 40 8.2
271gb|AC104650.2| Homo sapiens BAC clone RP11-117J13 from 4, comple... 40 8.2
272gb|AC009916.5|AC009916 Drosophila melanogaster, chromosome 3R, r... 40 8.2
273gb|AC093110.4| Homo sapiens BAC clone RP11-564H16 from 2, comple... 40 8.2
274gb|AC119271.11| Mus musculus chromosome 7, clone RP24-373F15, co... 40 8.2
275gb|AC012456.10| Homo sapiens BAC clone RP11-484O9 from 2, comple... 40 8.2
276dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 8.2
277gb|AC006985.2| Homo sapiens BAC clone RP11-154L24 from 2, comple... 40 8.2
278gb|AE004751.1| Pseudomonas aeruginosa PAO1, section 312 of 529 o... 40 8.2
279gb|AC008738.7| Homo sapiens chromosome 19 clone CTD-2540B15, com... 40 8.2
280ref|XM_576398.1| PREDICTED: Rattus norvegicus transmembrane prot... 40 8.2
281gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 8.2
282dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete ge... 40 8.2
283dbj|AP005164.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
284dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g... 40 8.2
285emb|AJ583531.1| Triticum aestivum mRNA for cytochrome P450 (CYP9... 40 8.2
286emb|AJ583530.1| Triticum aestivum mRNA for cytochrome P450 (CYP9... 40 8.2
287dbj|AP003371.5| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
288dbj|AP003377.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
289gb|AC153382.1| Mus musculus 10 BAC RP23-9F3 (Roswell Park Cancer... 40 8.2
290dbj|AK120364.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.2
291dbj|AK109731.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.2
292ref|XM_564212.1| Anopheles gambiae str. PEST ENSANGP00000015032 ... 40 8.2
293ref|XM_564213.1| Anopheles gambiae str. PEST ENSANGP00000026665 ... 40 8.2
294emb|AJ334473.1|HSA334473 Homo sapiens genomic sequence surroundi... 40 8.2
295gb|DQ149153.1| Cercopithecine herpesvirus 16 strain X313, comple... 40 8.2
296gb|AC120162.6| Mus musculus chromosome 8, clone RP24-456M18, com... 40 8.2
297gb|AF134401.1|AF134401 Homo sapiens putative espin mRNA, partial... 40 8.2
298gb|AE003749.3| Drosophila melanogaster chromosome 3R, section 87... 40 8.2
299gb|AE003586.3| Drosophila melanogaster chromosome 2L, section 5 ... 40 8.2
300gb|AE003508.4| Drosophila melanogaster chromosome X, section 60 ... 40 8.2
301dbj|AP006247.1| Homo sapiens genomic DNA, chromosome 8, clone:RP... 40 8.2
302dbj|AP006245.1| Homo sapiens genomic DNA, chromosome 8, clone:RP... 40 8.2
303gb|BC085925.1| Rattus norvegicus transmembrane protein 24, mRNA ... 40 8.2
304gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 40 8.2
305gb|BT001611.1| Drosophila melanogaster RE32656 full insert cDNA 40 8.2
306gb|AC137071.3| Genomic sequence for Oryza sativa, Nipponbare str... 40 8.2
307gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome 40 8.2
308gb|AC137947.12| Mus musculus chromosome 5, clone RP23-362I3, com... 40 8.2
309gb|AC151998.6| Mus musculus BAC clone RP23-98L16 from chromosome... 40 8.2
310ref|NM_001011996.1| Rattus norvegicus transmembrane protein 24 (... 40 8.2
311gb|AE017221.1| Thermus thermophilus HB27, complete genome 40 8.2
312gb|AC004440.1|AC004440 Drosophila melanogaster (P1 DS04892 (D66)... 40 8.2
313gb|AC146603.3| Mus musculus BAC clone RP23-304P17 from 8, comple... 40 8.2
314emb|AL772324.5| Mouse DNA sequence from clone RP23-440O7 on chro... 40 8.2
315emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 40 8.2
316gb|AC087556.30| Mus musculus strain C57BL/6J chromosome 16 clone... 40 8.2
317gb|DQ149730.1| Uncultured soil bacterium clone CT0.35 ribulose-1... 40 8.2
318emb|AL606974.9| Mouse DNA sequence from clone RP23-39E21 on chro... 40 8.2
319dbj|AP000080.1| Homo sapiens genomic DNA, chromosome 8p11.2, sen... 40 8.2
320emb|AL645466.12| Mouse DNA sequence from clone RP23-162P18 on ch... 40 8.2

>gb|AF123608.1|AF123608 Triticum aestivum clone CYP73-TA cytochrome P450 mRNA, complete cds
          Length = 1506

 Score =  944 bits (476), Expect = 0.0
 Identities = 509/520 (97%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggacgtcctcctcctggagaaggccctgctgggcctcttcgccgcggcggtgctggcc 143
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1   atggacgtcctcctcctggagaaggccctcctgggcctcttcgccgcggcggtgctggcc 60

                                                                       
Query: 144 atcgccgtagccaagctcgccggcaagcgcttccgcctcccacccggcccctccggcgcc 203
           |||||||| ||||||||| |||||||||||||||||||||| || |||||||||||||||
Sbjct: 61  atcgccgtcgccaagctcaccggcaagcgcttccgcctcccccctggcccctccggcgcc 120

                                                                       
Query: 204 cccatcgtcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggac 263
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 121 cccatcgtcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatgggc 180

                                                                       
Query: 264 ctggccaagcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtc 323
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 ctggccaagcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtc 240

                                                                       
Query: 324 gtctccagccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcc 383
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 gtctccagccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcc 300

                                                                       
Query: 384 cgcacccgcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacg 443
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 cgcacccgcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacg 360

                                                                       
Query: 444 gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 503
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 420

                                                                       
Query: 504 aaggtggtggcgcaaaaccgcgtggggtgggaggaggaggcccggctggtggtggaggac 563
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 aaggtggtggcgcagaaccgcgtggggtgggaggaggaggcccggctggtggtggaggac 480

                                                   
Query: 564 ctcagggccgacccggcggcggcgaccaagggcgtggtgg 603
           |||| |||||||||||||||||||||   |||||||||||
Sbjct: 481 ctcaaggccgacccggcggcggcgacggcgggcgtggtgg 520



to top

>gb|AY034143.1| Sorghum bicolor cinnamic acid 4-hydroxylase (C4H) mRNA, complete
           cds
          Length = 1762

 Score =  603 bits (304), Expect = e-169
 Identities = 427/468 (91%)
 Strand = Plus / Plus

                                                                       
Query: 96  ctcctggagaaggccctgctgggcctcttcgccgcggcggtgctggccatcgccgtagcc 155
           |||||||||||||||||||||||||| ||||| ||||||||||| ||  ||||||| || 
Sbjct: 79  ctcctggagaaggccctgctgggcctgttcgcggcggcggtgctcgctgtcgccgtggcg 138

                                                                       
Query: 156 aagctcgccggcaagcgcttccgcctcccacccggcccctccggcgcccccatcgtcggc 215
           |||||  |||||||||||| |||||| || || |||||| | ||||||||| | || |||
Sbjct: 139 aagctaaccggcaagcgctaccgcctgccccctggccccgcgggcgcccccgtggtgggc 198

                                                                       
Query: 216 aactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggccaagcgg 275
           |||||||||||||||||||||||||||||||||||||||||||||  ||| |||||||||
Sbjct: 199 aactggctgcaggtcggcgacgacctcaaccaccgcaacctgatgtccctcgccaagcgg 258

                                                                       
Query: 276 ttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctccagcccc 335
           ||||||||  | ||||||||||| ||||||||||||||||||||||| ||||||| ||| 
Sbjct: 259 ttcggcgacatcttcctcctccggatgggcgtccgcaacctggtggtggtctccaccccg 318

                                                                       
Query: 336 gagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaac 395
           ||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 319 gagctcgccaaggaggtgctccacacgcagggcgtggagttcggctcccgcacccgcaac 378

                                                                       
Query: 396 gtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgac 455
           |||||||||||||||||||| || || || ||||||||||||||||| ||||||||||||
Sbjct: 379 gtcgtcttcgacatcttcacggggaaaggccaggacatggtgttcaccgtgtacggcgac 438

                                                                       
Query: 456 cactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggtggtggcg 515
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 439 cactggcggaagatgcggcggatcatgacggtgcccttcttcaccaacaaggtggtggcg 498

                                                           
Query: 516 caaaaccgcgtggggtgggaggaggaggcccggctggtggtggaggac 563
           || |||||||| |||||||||||||||||||| || ||||||||||||
Sbjct: 499 cagaaccgcgtcgggtgggaggaggaggcccgcctcgtggtggaggac 546



to top

>gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0006B22,
              complete sequence
          Length = 166052

 Score =  587 bits (296), Expect = e-164
 Identities = 434/480 (90%)
 Strand = Plus / Minus

                                                                          
Query: 84     atggacgtcctcctcctggagaaggccctgctgggcctcttcgccgcggcggtgctggcc 143
              ||||||| ||||||| ||||||||| ||| |||||||| ||||  |||||||||||||||
Sbjct: 106429 atggacgccctcctcgtggagaaggtcctcctgggcctgttcgtggcggcggtgctggcc 106370

                                                                          
Query: 144    atcgccgtagccaagctcgccggcaagcgcttccgcctcccacccggcccctccggcgcc 203
               | |  || ||||||||| |||| ||| |  |||||||||| ||||||||| ||||||| 
Sbjct: 106369 ctagtggtggccaagctcaccgggaagaggctccgcctcccgcccggccccgccggcgcg 106310

                                                                          
Query: 204    cccatcgtcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggac 263
              |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||  
Sbjct: 106309 cccatcgtcggcaactggctccaggtcggcgacgacctcaaccaccgcaacctgatggcg 106250

                                                                          
Query: 264    ctggccaagcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtc 323
              |||||   ||||||||||||  |  |||||||||||||||||||||||||||||||||| 
Sbjct: 106249 ctggcgcggcggttcggcgacatcctcctcctccgcatgggcgtccgcaacctggtggtg 106190

                                                                          
Query: 324    gtctccagccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcc 383
              || |||||||| || |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 106189 gtgtccagcccggacctcgccaaggaggtgctccacacccagggcgtcgagttcggctcc 106130

                                                                          
Query: 384    cgcacccgcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacg 443
              |||||||||||||| || ||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 106129 cgcacccgcaacgtggtgttcgacatcttcaccgggaaggggcaggacatggtgttcacc 106070

                                                                          
Query: 444    gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 503
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106069 gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 106010

                                                                          
Query: 504    aaggtggtggcgcaaaaccgcgtggggtgggaggaggaggcccggctggtggtggaggac 563
              ||||||||||| || ||||||| ||| ||||||||||||||  |||||||||||||||||
Sbjct: 106009 aaggtggtggcccagaaccgcgcgggttgggaggaggaggcgaggctggtggtggaggac 105950



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  587 bits (296), Expect = e-164
 Identities = 434/480 (90%)
 Strand = Plus / Minus

                                                                            
Query: 84       atggacgtcctcctcctggagaaggccctgctgggcctcttcgccgcggcggtgctggcc 143
                ||||||| ||||||| ||||||||| ||| |||||||| ||||  |||||||||||||||
Sbjct: 14771015 atggacgccctcctcgtggagaaggtcctcctgggcctgttcgtggcggcggtgctggcc 14770956

                                                                            
Query: 144      atcgccgtagccaagctcgccggcaagcgcttccgcctcccacccggcccctccggcgcc 203
                 | |  || ||||||||| |||| ||| |  |||||||||| ||||||||| ||||||| 
Sbjct: 14770955 ctagtggtggccaagctcaccgggaagaggctccgcctcccgcccggccccgccggcgcg 14770896

                                                                            
Query: 204      cccatcgtcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggac 263
                |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||  
Sbjct: 14770895 cccatcgtcggcaactggctccaggtcggcgacgacctcaaccaccgcaacctgatggcg 14770836

                                                                            
Query: 264      ctggccaagcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtc 323
                |||||   ||||||||||||  |  |||||||||||||||||||||||||||||||||| 
Sbjct: 14770835 ctggcgcggcggttcggcgacatcctcctcctccgcatgggcgtccgcaacctggtggtg 14770776

                                                                            
Query: 324      gtctccagccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcc 383
                || |||||||| || |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 14770775 gtgtccagcccggacctcgccaaggaggtgctccacacccagggcgtcgagttcggctcc 14770716

                                                                            
Query: 384      cgcacccgcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacg 443
                |||||||||||||| || ||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 14770715 cgcacccgcaacgtggtgttcgacatcttcaccgggaaggggcaggacatggtgttcacc 14770656

                                                                            
Query: 444      gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 503
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14770655 gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 14770596

                                                                            
Query: 504      aaggtggtggcgcaaaaccgcgtggggtgggaggaggaggcccggctggtggtggaggac 563
                ||||||||||| || ||||||| ||| ||||||||||||||  |||||||||||||||||
Sbjct: 14770595 aaggtggtggcccagaaccgcgcgggttgggaggaggaggcgaggctggtggtggaggac 14770536



to top

>dbj|AK104994.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-002-H11, full
           insert sequence
          Length = 1796

 Score =  587 bits (296), Expect = e-164
 Identities = 434/480 (90%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggacgtcctcctcctggagaaggccctgctgggcctcttcgccgcggcggtgctggcc 143
           ||||||| ||||||| ||||||||| ||| |||||||| ||||  |||||||||||||||
Sbjct: 80  atggacgccctcctcgtggagaaggtcctcctgggcctgttcgtggcggcggtgctggcc 139

                                                                       
Query: 144 atcgccgtagccaagctcgccggcaagcgcttccgcctcccacccggcccctccggcgcc 203
            | |  || ||||||||| |||| ||| |  |||||||||| ||||||||| ||||||| 
Sbjct: 140 ctagtggtggccaagctcaccgggaagaggctccgcctcccgcccggccccgccggcgcg 199

                                                                       
Query: 204 cccatcgtcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggac 263
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||  
Sbjct: 200 cccatcgtcggcaactggctccaggtcggcgacgacctcaaccaccgcaacctgatggcg 259

                                                                       
Query: 264 ctggccaagcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtc 323
           |||||   ||||||||||||  |  |||||||||||||||||||||||||||||||||| 
Sbjct: 260 ctggcgcggcggttcggcgacatcctcctcctccgcatgggcgtccgcaacctggtggtg 319

                                                                       
Query: 324 gtctccagccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcc 383
           || |||||||| || |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 320 gtgtccagcccggacctcgccaaggaggtgctccacacccagggcgtcgagttcggctcc 379

                                                                       
Query: 384 cgcacccgcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacg 443
           |||||||||||||| || ||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 380 cgcacccgcaacgtggtgttcgacatcttcaccgggaaggggcaggacatggtgttcacc 439

                                                                       
Query: 444 gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 503
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 440 gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 499

                                                                       
Query: 504 aaggtggtggcgcaaaaccgcgtggggtgggaggaggaggcccggctggtggtggaggac 563
           ||||||||||| || ||||||| ||| ||||||||||||||  |||||||||||||||||
Sbjct: 500 aaggtggtggcccagaaccgcgcgggttgggaggaggaggcgaggctggtggtggaggac 559



to top

>dbj|AK100598.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023107C01, full
           insert sequence
          Length = 1838

 Score =  587 bits (296), Expect = e-164
 Identities = 434/480 (90%)
 Strand = Plus / Plus

                                                                       
Query: 84  atggacgtcctcctcctggagaaggccctgctgggcctcttcgccgcggcggtgctggcc 143
           ||||||| ||||||| ||||||||| ||| |||||||| ||||  |||||||||||||||
Sbjct: 78  atggacgccctcctcgtggagaaggtcctcctgggcctgttcgtggcggcggtgctggcc 137

                                                                       
Query: 144 atcgccgtagccaagctcgccggcaagcgcttccgcctcccacccggcccctccggcgcc 203
            | |  || ||||||||| |||| ||| |  |||||||||| ||||||||| ||||||| 
Sbjct: 138 ctagtggtggccaagctcaccgggaagaggctccgcctcccgcccggccccgccggcgcg 197

                                                                       
Query: 204 cccatcgtcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggac 263
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||  
Sbjct: 198 cccatcgtcggcaactggctccaggtcggcgacgacctcaaccaccgcaacctgatggcg 257

                                                                       
Query: 264 ctggccaagcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtc 323
           |||||   ||||||||||||  |  |||||||||||||||||||||||||||||||||| 
Sbjct: 258 ctggcgcggcggttcggcgacatcctcctcctccgcatgggcgtccgcaacctggtggtg 317

                                                                       
Query: 324 gtctccagccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcc 383
           || |||||||| || |||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 318 gtgtccagcccggacctcgccaaggaggtgctccacacccagggcgtcgagttcggctcc 377

                                                                       
Query: 384 cgcacccgcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacg 443
           |||||||||||||| || ||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 378 cgcacccgcaacgtggtgttcgacatcttcaccgggaaggggcaggacatggtgttcacc 437

                                                                       
Query: 444 gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 503
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 438 gtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaac 497

                                                                       
Query: 504 aaggtggtggcgcaaaaccgcgtggggtgggaggaggaggcccggctggtggtggaggac 563
           ||||||||||| || ||||||| ||| ||||||||||||||  |||||||||||||||||
Sbjct: 498 aaggtggtggcccagaaccgcgcgggttgggaggaggaggcgaggctggtggtggaggac 557



to top

>gb|AY104175.1| Zea mays PCO098406 mRNA sequence
          Length = 1755

 Score =  535 bits (270), Expect = e-149
 Identities = 421/470 (89%), Gaps = 1/470 (0%)
 Strand = Plus / Plus

                                                                       
Query: 95  cctcctggagaaggccctgctgggcctcttcgccgcggcggtgctggccatcgccgtagc 154
           |||||| |||||||||||||||||||| ||||||||||| ||| ||||||||||||| ||
Sbjct: 74  cctcctagagaaggccctgctgggcctgttcgccgcggctgtggtggccatcgccgtggc 133

                                                                       
Query: 155 caagctcgccggcaagcgcttccgcctcccacccggcccctccggcgcccccatcgtcgg 214
           ||||||  |||||||||| | |||||||||||| || ||| | ||||||||| | || ||
Sbjct: 134 caagctgaccggcaagcggtaccgcctcccaccggggcccccgggcgcccccgtggtggg 193

                                                                       
Query: 215 caactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggccaagcg 274
            |||||||||||||| ||||||||||| ||||||||||||||||||| | |||| |||||
Sbjct: 194 aaactggctgcaggtgggcgacgacctgaaccaccgcaacctgatggccatggcgaagcg 253

                                                                       
Query: 275 gttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctccagccc 334
           |||||||||  | ||||| || ||||||||||| |||||||||||||| || || | |||
Sbjct: 254 gttcggcgacatcttcctgctgcgcatgggcgtgcgcaacctggtggtggtgtcgacccc 313

                                                                       
Query: 335 cgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaa 394
            ||||| ||||||||||| |||||||| |||||||| |||||||||||||||||||||||
Sbjct: 314 ggagctggccaaggaggtgctccacacgcagggcgtggagttcggctcccgcacccgcaa 373

                                                                       
Query: 395 cgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcga 454
           ||| || |||||||||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 374 cgtggtgttcgacatcttcacgggcaaggggcaggacatggtgttcacggtgtacggcga 433

                                                                       
Query: 455 ccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggtggtggc 514
           ||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||
Sbjct: 434 ccactggcgcaagatgcggcgcatcatgaccgtccccttcttcaccaacaaggtggtggc 493

                                                             
Query: 515 gcaaaaccgcgtggggtgggaggaggaggccc-ggctggtggtggaggac 563
            || |||||||  ||||||||||||||||||| |||||||||||||||||
Sbjct: 494 ccagaaccgcgccgggtgggaggaggaggcccgggctggtggtggaggac 543



to top

>gb|L07634.1|PHVC4HYDRO Vigna radiata var. radiata cinnamate 4-hydroxylase mRNA, complete
           cds
          Length = 1766

 Score =  307 bits (155), Expect = 2e-80
 Identities = 355/419 (84%), Gaps = 2/419 (0%)
 Strand = Plus / Plus

                                                                       
Query: 91  tcctcctcctggagaaggccctgctgggcctcttcgccgcggcggtgctggccatcgccg 150
           ||||||||||||||||| |||| || |||||||||   ||||||||| | ||||| |  |
Sbjct: 33  tcctcctcctggagaagaccctcctcggcctcttcctagcggcggtggtagccattgttg 92

                                                                       
Query: 151 tagccaagctcgccggcaagcgcttccgcctcccacccggccc-ctccggcgcccccatc 209
           |  ||||||||  ||||||||| |||   ||||| || ||||| ||||  || |||||||
Sbjct: 93  tctccaagctccgcggcaagcgtttcaagctcccgccgggcccactccc-cgtccccatc 151

                                                                       
Query: 210 gtcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcc 269
            ||||||||||||| ||||| |||||||||||||||||||||||||| |   | || |||
Sbjct: 152 ttcggcaactggctccaggttggcgacgacctcaaccaccgcaacctcactcaactcgcc 211

                                                                       
Query: 270 aagcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcc 329
           ||||| ||||||||  | |||||||||||||||||    ||||||||||| || || |||
Sbjct: 212 aagcgcttcggcgacatcttcctcctccgcatggggcagcgcaacctggtcgtggtttcc 271

                                                                       
Query: 330 agccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacc 389
              || || |||||||||||||| || ||||| |||||||| ||||||||||||||||||
Sbjct: 272 tcgccggacctcgccaaggaggtgctgcacacgcagggcgtggagttcggctcccgcacc 331

                                                                       
Query: 390 cgcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtac 449
           |||||||| ||||||||||||||||||||| |||| ||||||||||| ||||| || |||
Sbjct: 332 cgcaacgttgtcttcgacatcttcaccggcgagggccaggacatggtcttcaccgtctac 391

                                                                      
Query: 450 ggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggt 508
           ||||| ||||||||||||||||| || |||||||| |||||||||||||||||||||||
Sbjct: 392 ggcgagcactggcgcaagatgcgacgcatcatgaccgtgcccttcttcaccaacaaggt 450



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  274 bits (138), Expect = 3e-70
 Identities = 261/302 (86%)
 Strand = Plus / Minus

                                                                            
Query: 211      tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
                |||||||||||||||||||||||||||||||||||||||||||||||  ||  |||||  
Sbjct: 34956774 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctggcggcgctggcgc 34956715

                                                                            
Query: 271      agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
                 | ||||||||||  | ||||||||||| |||||    |||||||||||||| |||||| 
Sbjct: 34956714 ggaggttcggcgacatcttcctcctccggatggggcagcgcaacctggtggtggtctcct 34956655

                                                                            
Query: 331      gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
                  ||   ||| ||   |||||| |||||||| ||||| || |||||||| || |||||||
Sbjct: 34956654 cgccgccgctggcgcgggaggtgctccacacgcagggggtggagttcgggtcgcgcaccc 34956595

                                                                            
Query: 391      gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
                ||||||| || ||||||||||||||||||||||| ||||||||||||||||| |||||||
Sbjct: 34956594 gcaacgtggtgttcgacatcttcaccggcaaggggcaggacatggtgttcaccgtgtacg 34956535

                                                                            
Query: 451      gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggtgg 510
                ||||||||||||| |||||||||||||||||||||||||| |||||||||  ||||||||
Sbjct: 34956534 gcgaccactggcgaaagatgcggcggatcatgacggtgccgttcttcaccggcaaggtgg 34956475

                  
Query: 511      tg 512
                ||
Sbjct: 34956474 tg 34956473



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 525      gtggggtgggaggaggaggc 544
                ||||||||||||||||||||
Sbjct: 32326002 gtggggtgggaggaggaggc 32325983



to top

>dbj|AP003446.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1529_G03
          Length = 100635

 Score =  274 bits (138), Expect = 3e-70
 Identities = 261/302 (86%)
 Strand = Plus / Minus

                                                                         
Query: 211   tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
             |||||||||||||||||||||||||||||||||||||||||||||||  ||  |||||  
Sbjct: 86138 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctggcggcgctggcgc 86079

                                                                         
Query: 271   agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
              | ||||||||||  | ||||||||||| |||||    |||||||||||||| |||||| 
Sbjct: 86078 ggaggttcggcgacatcttcctcctccggatggggcagcgcaacctggtggtggtctcct 86019

                                                                         
Query: 331   gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
               ||   ||| ||   |||||| |||||||| ||||| || |||||||| || |||||||
Sbjct: 86018 cgccgccgctggcgcgggaggtgctccacacgcagggggtggagttcgggtcgcgcaccc 85959

                                                                         
Query: 391   gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
             ||||||| || ||||||||||||||||||||||| ||||||||||||||||| |||||||
Sbjct: 85958 gcaacgtggtgttcgacatcttcaccggcaaggggcaggacatggtgttcaccgtgtacg 85899

                                                                         
Query: 451   gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggtgg 510
             ||||||||||||| |||||||||||||||||||||||||| |||||||||  ||||||||
Sbjct: 85898 gcgaccactggcgaaagatgcggcggatcatgacggtgccgttcttcaccggcaaggtgg 85839

               
Query: 511   tg 512
             ||
Sbjct: 85838 tg 85837



to top

>dbj|AP003302.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0703B11
          Length = 144074

 Score =  274 bits (138), Expect = 3e-70
 Identities = 261/302 (86%)
 Strand = Plus / Minus

                                                                        
Query: 211  tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
            |||||||||||||||||||||||||||||||||||||||||||||||  ||  |||||  
Sbjct: 1002 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctggcggcgctggcgc 943

                                                                        
Query: 271  agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
             | ||||||||||  | ||||||||||| |||||    |||||||||||||| |||||| 
Sbjct: 942  ggaggttcggcgacatcttcctcctccggatggggcagcgcaacctggtggtggtctcct 883

                                                                        
Query: 331  gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
              ||   ||| ||   |||||| |||||||| ||||| || |||||||| || |||||||
Sbjct: 882  cgccgccgctggcgcgggaggtgctccacacgcagggggtggagttcgggtcgcgcaccc 823

                                                                        
Query: 391  gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
            ||||||| || ||||||||||||||||||||||| ||||||||||||||||| |||||||
Sbjct: 822  gcaacgtggtgttcgacatcttcaccggcaaggggcaggacatggtgttcaccgtgtacg 763

                                                                        
Query: 451  gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggtgg 510
            ||||||||||||| |||||||||||||||||||||||||| |||||||||  ||||||||
Sbjct: 762  gcgaccactggcgaaagatgcggcggatcatgacggtgccgttcttcaccggcaaggtgg 703

              
Query: 511  tg 512
            ||
Sbjct: 702  tg 701



to top

>dbj|AB234902.1| Verbena x hybrida mRNA for Cinnamic acid 4-hydroxylase, complete
           cds, cultivar: Tapien Pink
          Length = 1768

 Score =  258 bits (130), Expect = 2e-65
 Identities = 256/298 (85%)
 Strand = Plus / Plus

                                                                       
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
           |||| |||||||| ||||||||||||||| | |||||||| ||||| |  |||   || |
Sbjct: 183 tcgggaactggctccaggtcggcgacgacttgaaccaccgaaacctcaccgactacgcga 242

                                                                       
Query: 271 agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
           ||   ||||||||  |||||||||||||||||||    |||||||| || ||||||||| 
Sbjct: 243 agaaattcggcgacctgttcctcctccgcatggggcagcgcaacctcgtcgtcgtctcct 302

                                                                       
Query: 331 gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
            ||| || ||||||| ||| ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 303 ccccggacctcgccagggacgtcctccacacgcagggcgttgagttcgggtcccgcaccc 362

                                                                       
Query: 391 gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
           | |||||||| |||||||| |||||||| ||||||||||||||||||||||| |||||||
Sbjct: 363 ggaacgtcgtgttcgacattttcaccggaaagggacaggacatggtgttcaccgtgtacg 422

                                                                     
Query: 451 gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggt 508
           |||| |||||||| |||||||| ||||||||||| ||||| |||||||||||||||||
Sbjct: 423 gcgagcactggcggaagatgcgccggatcatgaccgtgccgttcttcaccaacaaggt 480



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 93  ctcctcctggagaaggccctgctgggcctcttcgccgc 130
           |||||||||||||||||||| || || |||||| ||||
Sbjct: 65  ctcctcctggagaaggccctcctagggctcttctccgc 102



to top

>emb|X92437.1|GMCYP73 Glycine max mRNA for cinnamic acid 4-hydroxylase (CYP73)
          Length = 1787

 Score =  250 bits (126), Expect = 5e-63
 Identities = 255/298 (85%)
 Strand = Plus / Plus

                                                                       
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
           ||||||||||||| || ||||||||||||||||||||||||||||| |  ||  ||||||
Sbjct: 178 tcggcaactggctccaagtcggcgacgacctcaaccaccgcaacctcaccgatttggcca 237

                                                                       
Query: 271 agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
           |    ||||| ||  | |||||||||||||||||    |||||||| || || || ||  
Sbjct: 238 aaaaattcggtgacatcttcctcctccgcatggggcagcgcaacctcgtcgtggtttctt 297

                                                                       
Query: 331 gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
            ||| ||||||||||| ||||| |||||||| |||||||| |||||||||||||||||||
Sbjct: 298 cccctgagctcgccaaagaggttctccacacgcagggcgtggagttcggctcccgcaccc 357

                                                                       
Query: 391 gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
           |||||||||||||||||||||||||||| ||||| || |||||||| ||||| || ||||
Sbjct: 358 gcaacgtcgtcttcgacatcttcaccggaaagggccaagacatggtcttcaccgtctacg 417

                                                                     
Query: 451 gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggt 508
           |||| ||||||||||| ||||| || |||||||| || ||||||||||||||||||||
Sbjct: 418 gcgagcactggcgcaaaatgcgccgcatcatgaccgtccccttcttcaccaacaaggt 475



to top

>gb|AY616436.1| Agastache rugosa cinnamic acid 4-hydroxylase mRNA, complete cds.~~
          Length = 1676

 Score =  210 bits (106), Expect = 4e-51
 Identities = 253/302 (83%)
 Strand = Plus / Plus

                                                                       
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
           |||| |||||||| || |||||||||||||||||||||||||| || |  |||   ||||
Sbjct: 184 tcggaaactggcttcaagtcggcgacgacctcaaccaccgcaatctcaccgactacgcca 243

                                                                       
Query: 271 agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
           ||  |||||||||  | ||||| || || |||||    |||||||| || ||||||||  
Sbjct: 244 agaagttcggcgacatcttcctgctgcggatggggcagcgcaacctcgtcgtcgtctcgt 303

                                                                       
Query: 331 gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
             || ||||| || ||||| || |||||||| ||||| || ||||||||||||||||| |
Sbjct: 304 cgccggagctggcgaaggacgtgctccacacgcagggggtggagttcggctcccgcacgc 363

                                                                       
Query: 391 gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
           ||||||||||||| |||||||||||||| ||||| ||||||||||| ||||| || ||||
Sbjct: 364 gcaacgtcgtctttgacatcttcaccggaaagggccaggacatggtcttcaccgtctacg 423

                                                                       
Query: 451 gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggtgg 510
           |||| |||||||| |||||||| || ||||||||||| || |||||||||||||||||||
Sbjct: 424 gcgagcactggcggaagatgcgccgcatcatgacggtaccgttcttcaccaacaaggtgg 483

             
Query: 511 tg 512
           ||
Sbjct: 484 tg 485



to top

>gb|DQ075002.1| Malus x domestica cinnamic acid hydroxylase (C4H1) mRNA, complete
           cds
          Length = 1946

 Score =  210 bits (106), Expect = 4e-51
 Identities = 250/298 (83%)
 Strand = Plus / Plus

                                                                       
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
           |||| |||||||| |||||||| ||||||||||||||||||||||| |  ||| ||||||
Sbjct: 422 tcggaaactggctccaggtcggtgacgacctcaaccaccgcaacctcaccgacatggcca 481

                                                                       
Query: 271 agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
           ||   || |||||    |||||||||||||||||    |||||||| || ||||||||| 
Sbjct: 482 agaaatttggcgactgcttcctcctccgcatggggcagcgcaacctcgtcgtcgtctcct 541

                                                                       
Query: 331 gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
             || ||||| |||||||||||||||||||||||||| ||||| ||||| ||  | ||||
Sbjct: 542 cgccggagctggccaaggaggtcctccacacccagggagtcgaattcgggtcgaggaccc 601

                                                                       
Query: 391 gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
           | ||||||||||| || || ||||||||  | || ||||||||||||||||| || ||||
Sbjct: 602 gaaacgtcgtctttgatattttcaccggtgaaggccaggacatggtgttcaccgtctacg 661

                                                                     
Query: 451 gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggt 508
           |||| |||||||| || |||||||| |||||||| || ||||||||||||||||||||
Sbjct: 662 gcgagcactggcggaaaatgcggcgtatcatgaccgtccccttcttcaccaacaaggt 719



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 84  atggacgtcctcctcctggagaaggccctgctgggcctcttcg 126
           |||||| ||||||||||||| ||| |||| ||||| |||||||
Sbjct: 295 atggacctcctcctcctggaaaagacccttctgggtctcttcg 337



to top

>dbj|D87520.1| Glycyrrhiza echinata suspension-cultured cells mRNA for cytochrome
           P450 (CYP73A14), complete cds
          Length = 1796

 Score =  202 bits (102), Expect = 1e-48
 Identities = 249/298 (83%)
 Strand = Plus / Plus

                                                                       
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
           |||| |||||||| || ||||||||||||||||||||||||||||| |  ||||| || |
Sbjct: 170 tcggtaactggctccaagtcggcgacgacctcaaccaccgcaacctcaccgacctagcga 229

                                                                       
Query: 271 agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
           | || ||||||||  | ||||||||||| |||||    || ||||| || ||||| ||  
Sbjct: 230 aacgcttcggcgacatcttcctcctccgaatgggacagcgaaacctcgtcgtcgtttcat 289

                                                                       
Query: 331 gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
             || ||| | |||||||||||||||||||| |||||||| || ||||| ||||| || |
Sbjct: 290 cgccggagttagccaaggaggtcctccacacacagggcgtggaattcggatcccgaacac 349

                                                                       
Query: 391 gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
           | |||||||| ||||||||||||||||| |||||||| || ||||||||||| || ||||
Sbjct: 350 gaaacgtcgtattcgacatcttcaccggaaagggacaagatatggtgttcaccgtttacg 409

                                                                     
Query: 451 gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggt 508
           |||| |||||||| || ||||| |||||||||||||| || || ||||||||||||||
Sbjct: 410 gcgaacactggcggaaaatgcgacggatcatgacggttccgtttttcaccaacaaggt 467



to top

>gb|AF096998.1| Pinus taeda trans-cinnamate 4-hydroxylase (TC4H) mRNA, complete cds
          Length = 1996

 Score =  170 bits (86), Expect = 3e-39
 Identities = 149/170 (87%)
 Strand = Plus / Plus

                                                                       
Query: 339 ctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtc 398
           |||||||||||||| || ||||| ||||| || |||||||| || || || || ||||| 
Sbjct: 336 ctcgccaaggaggttctgcacacgcagggggtggagttcgggtcgcggactcggaacgtg 395

                                                                       
Query: 399 gtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccac 458
           || ||||| || ||||| || ||||| ||||||||||||||||||||||||||||| || 
Sbjct: 396 gtgttcgatatattcacggggaaggggcaggacatggtgttcacggtgtacggcgagcat 455

                                                             
Query: 459 tggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggt 508
           ||||| |||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 456 tggcggaagatgcggcggatcatgacggtgcccttctttaccaacaaggt 505



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 204 cccatcgtcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctg 257
           |||||| |||| |||||||||||||| || ||||| ||||| ||| | ||||||
Sbjct: 201 cccatcttcgggaactggctgcaggtgggggacgatctcaatcacaggaacctg 254



to top

>gb|AF255014.2|AF255014 Citrus sinensis cinnamate 4-hydroxylase CYP73 (C4H2) mRNA, complete
           cds
          Length = 1871

 Score =  157 bits (79), Expect = 5e-35
 Identities = 187/223 (83%)
 Strand = Plus / Plus

                                                                       
Query: 289 tcctcctccgcatgggcgtccgcaacctggtggtcgtctccagccccgagctcgccaagg 348
           |||||||||||||||||   |||||||| || ||||||||    || || | ||||||||
Sbjct: 359 tcctcctccgcatgggccagcgcaacctcgtcgtcgtctcgtcgccggaccacgccaagg 418

                                                                       
Query: 349 aggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgaca 408
           ||||||| ||||| ||||| || |||||||| || || ||  | |||||||| ||||| |
Sbjct: 419 aggtcctgcacacgcagggagtggagttcggatcacgaacgaggaacgtcgtgttcgata 478

                                                                       
Query: 409 tcttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccactggcgcaaga 468
           ||||||| || ||||| ||||||||||||||||| ||||||||||| |||||||| ||||
Sbjct: 479 tcttcactgggaagggtcaggacatggtgttcacagtgtacggcgagcactggcgaaaga 538

                                                      
Query: 469 tgcggcggatcatgacggtgcccttcttcaccaacaaggtggt 511
           ||||| |||||||||| || || |||||||| ||||| |||||
Sbjct: 539 tgcggaggatcatgaccgtccctttcttcacgaacaaagtggt 581



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacct 256
           ||||||||||||| ||||||||||| ||| | ||||| || |||||
Sbjct: 281 tcggcaactggctccaggtcggcgatgacttgaaccatcggaacct 326



to top

>gb|DQ211885.1| Parthenocissus henryana cinnamate-4-hydroxylse mRNA, complete cds
          Length = 1518

 Score =  149 bits (75), Expect = 1e-32
 Identities = 135/155 (87%)
 Strand = Plus / Plus

                                                                       
Query: 357 cacacccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcacc 416
           ||||| ||||| || ||||| || || |||||| | ||||| || ||||| |||||||||
Sbjct: 274 cacactcagggagtggagtttggatcacgcaccagaaacgtggtgttcgatatcttcacc 333

                                                                       
Query: 417 ggcaagggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcgg 476
           || ||||| |||||||||||||||||||||||||| || || ||||| ||||||||||| 
Sbjct: 334 ggtaagggccaggacatggtgttcacggtgtacggagagcattggcggaagatgcggcga 393

                                              
Query: 477 atcatgacggtgcccttcttcaccaacaaggtggt 511
           ||||||||||| || ||||||||||||||||||||
Sbjct: 394 atcatgacggtccctttcttcaccaacaaggtggt 428



to top

>gb|AF378333.1|AF378333 Citrus x paradisi cinnamate 4-hydroxylase mRNA, complete cds
          Length = 1745

 Score =  149 bits (75), Expect = 1e-32
 Identities = 186/223 (83%)
 Strand = Plus / Plus

                                                                       
Query: 289 tcctcctccgcatgggcgtccgcaacctggtggtcgtctccagccccgagctcgccaagg 348
           |||||||||||||||||   |||||||| || ||||||||    || || | ||||||||
Sbjct: 220 tcctcctccgcatgggccagcgcaacctcgtcgtcgtctcgtcgccggaccacgccaagg 279

                                                                       
Query: 349 aggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgaca 408
           ||||||| ||||| ||||| || |||||||| || || ||  | |||||||| ||||| |
Sbjct: 280 aggtcctgcacacgcagggagtggagttcggatcacgaacgaggaacgtcgtgttcgata 339

                                                                       
Query: 409 tcttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccactggcgcaaga 468
           ||||||| || ||||| ||||||||||||||||| |||||||| || |||||||| ||||
Sbjct: 340 tcttcactgggaagggccaggacatggtgttcacagtgtacggagagcactggcgaaaga 399

                                                      
Query: 469 tgcggcggatcatgacggtgcccttcttcaccaacaaggtggt 511
           ||||| |||||||||| || || |||||||| ||||| |||||
Sbjct: 400 tgcggaggatcatgaccgtccctttcttcacgaacaaagtggt 442



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacct 256
           ||||||||||||| ||||||||||| ||| | ||||| || |||||
Sbjct: 142 tcggcaactggctccaggtcggcgatgacttgaaccatcggaacct 187



to top

>gb|AF175275.1|AF175275 Pisum sativum trans-cinnamic acid hydroxylase (CYP73A9) gene,
            CYP73A9-v1 allele, partial cds
          Length = 4090

 Score =  149 bits (75), Expect = 1e-32
 Identities = 240/295 (81%)
 Strand = Plus / Plus

                                                                        
Query: 211  tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
            ||||||||||||| || |||||||| || ||||||||||||||||| |  ||  | ||||
Sbjct: 839  tcggcaactggctccaagtcggcgatgatctcaaccaccgcaacctcaccgatttagcca 898

                                                                        
Query: 271  agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
            | || ||||  ||  |  |||||||||||||||     |||||||| || ||| ||||| 
Sbjct: 899  aacgcttcgcggaaatcctcctcctccgcatggaacaacgcaacctcgtcgtcatctcct 958

                                                                        
Query: 331  gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
             ||| || |||||||| || || ||||| ||||| || ||||||||||||||||| || |
Sbjct: 959  ccccggaactcgccaaagaagttctccatacccaaggagtcgagttcggctcccgaacac 1018

                                                                        
Query: 391  gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
            | |||||||||||||||||||||||||| || || |||||||| || ||||| || ||||
Sbjct: 1019 gaaacgtcgtcttcgacatcttcaccggaaaaggccaggacattgttttcactgtctacg 1078

                                                                   
Query: 451  gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
            |||| |||||||| || |||||  | |||||||| || || ||||||||||||||
Sbjct: 1079 gcgaacactggcggaaaatgcgaagaatcatgaccgtcccgttcttcaccaacaa 1133



to top

>gb|U29243.2|PSU29243 Pisum sativum wound-inducible trans-cinnamic acid hydroxylase
           (CYP73A9) mRNA, partial cds
          Length = 1733

 Score =  149 bits (75), Expect = 1e-32
 Identities = 240/295 (81%)
 Strand = Plus / Plus

                                                                       
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacctgatggacctggcca 270
           ||||||||||||| || |||||||| || ||||||||||||||||| |  ||  | ||||
Sbjct: 123 tcggcaactggctccaagtcggcgatgatctcaaccaccgcaacctcaccgatttagcca 182

                                                                       
Query: 271 agcggttcggcgaggtgttcctcctccgcatgggcgtccgcaacctggtggtcgtctcca 330
           | || ||||  ||  |  |||||||||||||||     |||||||| || ||| ||||| 
Sbjct: 183 aacgcttcgcggaaatcctcctcctccgcatggaacaacgcaacctcgtcgtcatctcct 242

                                                                       
Query: 331 gccccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcaccc 390
            ||| || |||||||| || || ||||| ||||| || ||||||||||||||||| || |
Sbjct: 243 ccccggaactcgccaaagaagttctccatacccaaggagtcgagttcggctcccgaacac 302

                                                                       
Query: 391 gcaacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacg 450
           | |||||||||||||||||||||||||| || || |||||||| || ||||| || ||||
Sbjct: 303 gaaacgtcgtcttcgacatcttcaccggaaaaggccaggacattgttttcactgtctacg 362

                                                                  
Query: 451 gcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           |||| |||||||| || |||||  | |||||||| || || ||||||||||||||
Sbjct: 363 gcgaacactggcggaaaatgcgaagaatcatgaccgtcccgttcttcaccaacaa 417



to top

>gb|AY764925.1|AY764925S1 Pinus taeda isolate 27 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764921.1|AY764921S1 Pinus taeda isolate 29 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764917.1|AY764917S1 Pinus taeda isolate 1 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764913.1|AY764913S1 Pinus taeda isolate 17 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764909.1|AY764909S1 Pinus taeda isolate 8 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764905.1|AY764905S1 Pinus taeda isolate 28 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764901.1|AY764901S1 Pinus taeda isolate 19 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764897.1|AY764897S1 Pinus taeda isolate 3 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764893.1|AY764893S1 Pinus taeda isolate 2 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764889.1|AY764889S1 Pinus taeda isolate 10 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764885.1|AY764885S1 Pinus taeda isolate 14 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764881.1|AY764881S1 Pinus taeda isolate 30 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764877.1|AY764877S1 Pinus taeda isolate 13 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764873.1|AY764873S1 Pinus taeda isolate 25 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764869.1|AY764869S1 Pinus taeda isolate 7 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764865.1|AY764865S1 Pinus taeda isolate 11 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764861.1|AY764861S1 Pinus taeda isolate 24 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764857.1|AY764857S1 Pinus taeda isolate 12 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764853.1|AY764853S1 Pinus taeda isolate 20 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764849.1|AY764849S1 Pinus taeda isolate 15 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764845.1|AY764845S1 Pinus taeda isolate 5 exon 1 ; and cinnamate 4-hydroxylase gene,
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764841.1|AY764841S1 Pinus taeda isolate 31 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764837.1|AY764837S1 Pinus taeda isolate 21 exon 1 ; and cinnamate 4-hydroxylase gene,
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764833.1|AY764833S1 Pinus taeda isolate 18 exon 1 ; and cinnamate 4-hydroxylase gene,
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764829.1|AY764829S1 Pinus taeda isolate 32 exon 1 ; and cinnamate 4-hydroxylase gene,
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764825.1|AY764825S1 Pinus taeda isolate 22 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764821.1|AY764821S1 Pinus taeda isolate 23 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764817.1|AY764817S1 Pinus taeda isolate 9 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764813.1|AY764813S1 Pinus taeda isolate 26 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764809.1|AY764809S1 Pinus taeda isolate 4 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764805.1|AY764805S1 Pinus taeda isolate 6 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>gb|AY764801.1|AY764801S1 Pinus taeda isolate 16 cinnamate 4-hydroxylase gene, exon 1 and
           partial cds
          Length = 437

 Score =  147 bits (74), Expect = 5e-32
 Identities = 137/158 (86%)
 Strand = Plus / Plus

                                                                       
Query: 333 cccgagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgc 392
           ||||| ||||||||||||||||| ||||||||||||||||||||||| || || ||||| 
Sbjct: 276 cccgatctcgccaaggaggtcctgcacacccagggcgtcgagttcgggtctcgaacccgg 335

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| || ||||| |||||||| |||||||| ||||||||||||||||| || || || 
Sbjct: 336 aacgtggtgttcgatatcttcacgggcaaggggcaggacatggtgttcaccgtctatgga 395

                                                 
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcc 490
           || |||||| | ||||||||  |||||||||| |||||
Sbjct: 396 gatcactggagaaagatgcgcaggatcatgactgtgcc 433



to top

>emb|AJ309127.1|RGR309127 Ruta graveolens mRNA for putative cinnamate 4-hydroxylase (cyp73A32
           gene)
          Length = 1799

 Score =  127 bits (64), Expect = 5e-26
 Identities = 139/164 (84%)
 Strand = Plus / Plus

                                                                       
Query: 342 gccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtcgtc 401
           |||||||||||  | ||||| ||||| || ||||||||||| || ||  | |||||||||
Sbjct: 334 gccaaggaggtgttgcacactcagggagtggagttcggctctcggacgagaaacgtcgtc 393

                                                                       
Query: 402 ttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccactgg 461
           ||||| ||||||||||| || || |||||||||||||||||||| ||| | || ||||||
Sbjct: 394 ttcgatatcttcaccgggaaaggccaggacatggtgttcacggtttacagtgagcactgg 453

                                                       
Query: 462 cgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || ||||||||| |||||||||| || || |||||||| |||||
Sbjct: 454 cggaagatgcggaggatcatgaccgtccctttcttcacaaacaa 497



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 99  ctggagaaggccctgctgggcctcttcgccgcggcggt 136
           |||||||||||||| || |||||||||||||| |||||
Sbjct: 91  ctggagaaggccctcctaggcctcttcgccgccgcggt 128



to top

>ref|XM_465542.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1910

 Score =  125 bits (63), Expect = 2e-25
 Identities = 138/163 (84%)
 Strand = Plus / Plus

                                                                       
Query: 301 tgggcgtccgcaacctggtggtcgtctccagccccgagctcgccaaggaggtcctccaca 360
           ||||||| |||||||||||||| || ||   |||  |||| || | |||||| || ||||
Sbjct: 401 tgggcgtgcgcaacctggtggtggtgtcggacccgaagctggcgacggaggtgctgcaca 460

                                                                       
Query: 361 cccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggca 420
           | |||||||| ||||||||||||||| | |||||||||||||||||||||||||||| ||
Sbjct: 461 cgcagggcgtggagttcggctcccgcccgcgcaacgtcgtcttcgacatcttcaccgcca 520

                                                      
Query: 421 agggacaggacatggtgttcacggtgtacggcgaccactggcg 463
           | ||    |||||||||||||| | ||||||||||||||||||
Sbjct: 521 acggcgccgacatggtgttcaccgagtacggcgaccactggcg 563



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccg 250
           ||||||||||||||||||| ||| ||||||| ||||||||
Sbjct: 311 tcggcaactggctgcaggtgggcaacgacctgaaccaccg 350



to top

>ref|XM_465538.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1602

 Score =  125 bits (63), Expect = 2e-25
 Identities = 138/163 (84%)
 Strand = Plus / Plus

                                                                       
Query: 301 tgggcgtccgcaacctggtggtcgtctccagccccgagctcgccaaggaggtcctccaca 360
           ||||||| |||||||||||||| || ||   |||  |||| || | |||||| || ||||
Sbjct: 296 tgggcgtgcgcaacctggtggtggtgtcggacccgaagctggcgacggaggtgctgcaca 355

                                                                       
Query: 361 cccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggca 420
           | |||||||| ||||||||||||||| | |||||||||||||||||||||||||||| ||
Sbjct: 356 cgcagggcgtggagttcggctcccgcccgcgcaacgtcgtcttcgacatcttcaccgcca 415

                                                      
Query: 421 agggacaggacatggtgttcacggtgtacggcgaccactggcg 463
           | ||    |||||||||||||| | ||||||||||||||||||
Sbjct: 416 acggcgccgacatggtgttcaccgagtacggcgaccactggcg 458



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccac 248
           |||||||||||||||| |||||  ||||||| ||||||
Sbjct: 206 tcggcaactggctgcacgtcgggaacgacctgaaccac 243



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  125 bits (63), Expect = 2e-25
 Identities = 138/163 (84%)
 Strand = Plus / Plus

                                                                            
Query: 301      tgggcgtccgcaacctggtggtcgtctccagccccgagctcgccaaggaggtcctccaca 360
                ||||||| |||||||||||||| || ||   |||  |||| || | |||||| || ||||
Sbjct: 15835009 tgggcgtgcgcaacctggtggtggtgtcggacccgaagctggcgacggaggtgctgcaca 15835068

                                                                            
Query: 361      cccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggca 420
                | |||||||| ||||||||||||||| | |||||||||||||||||||||||||||| ||
Sbjct: 15835069 cgcagggcgtggagttcggctcccgcccgcgcaacgtcgtcttcgacatcttcaccgcca 15835128

                                                           
Query: 421      agggacaggacatggtgttcacggtgtacggcgaccactggcg 463
                | ||    |||||||||||||| | ||||||||||||||||||
Sbjct: 15835129 acggcgccgacatggtgttcaccgagtacggcgaccactggcg 15835171



 Score =  125 bits (63), Expect = 2e-25
 Identities = 138/163 (84%)
 Strand = Plus / Minus

                                                                            
Query: 301      tgggcgtccgcaacctggtggtcgtctccagccccgagctcgccaaggaggtcctccaca 360
                ||||||| |||||||||||||| || ||   |||  |||| || | |||||| || ||||
Sbjct: 15818257 tgggcgtgcgcaacctggtggtggtgtcggacccgaagctggcgacggaggtgctgcaca 15818198

                                                                            
Query: 361      cccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggca 420
                | |||||||| ||||||||||||||| | |||||||||||||||||||||||||||| ||
Sbjct: 15818197 cgcagggcgtggagttcggctcccgcccgcgcaacgtcgtcttcgacatcttcaccgcca 15818138

                                                           
Query: 421      agggacaggacatggtgttcacggtgtacggcgaccactggcg 463
                | ||    |||||||||||||| | ||||||||||||||||||
Sbjct: 15818137 acggcgccgacatggtgttcaccgagtacggcgaccactggcg 15818095



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                        
Query: 211      tcggcaactggctgcaggtcggcgacgacctcaaccaccg 250
                ||||||||||||||||||| ||| ||||||| ||||||||
Sbjct: 15834919 tcggcaactggctgcaggtgggcaacgacctgaaccaccg 15834958



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                      
Query: 211      tcggcaactggctgcaggtcggcgacgacctcaaccac 248
                |||||||||||||||| |||||  ||||||| ||||||
Sbjct: 15818347 tcggcaactggctgcacgtcgggaacgacctgaaccac 15818310



to top

>dbj|AP004850.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1342_D02
          Length = 125460

 Score =  125 bits (63), Expect = 2e-25
 Identities = 138/163 (84%)
 Strand = Plus / Plus

                                                                         
Query: 301   tgggcgtccgcaacctggtggtcgtctccagccccgagctcgccaaggaggtcctccaca 360
             ||||||| |||||||||||||| || ||   |||  |||| || | |||||| || ||||
Sbjct: 92949 tgggcgtgcgcaacctggtggtggtgtcggacccgaagctggcgacggaggtgctgcaca 93008

                                                                         
Query: 361   cccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggca 420
             | |||||||| ||||||||||||||| | |||||||||||||||||||||||||||| ||
Sbjct: 93009 cgcagggcgtggagttcggctcccgcccgcgcaacgtcgtcttcgacatcttcaccgcca 93068

                                                        
Query: 421   agggacaggacatggtgttcacggtgtacggcgaccactggcg 463
             | ||    |||||||||||||| | ||||||||||||||||||
Sbjct: 93069 acggcgccgacatggtgttcaccgagtacggcgaccactggcg 93111



 Score =  125 bits (63), Expect = 2e-25
 Identities = 138/163 (84%)
 Strand = Plus / Minus

                                                                         
Query: 301   tgggcgtccgcaacctggtggtcgtctccagccccgagctcgccaaggaggtcctccaca 360
             ||||||| |||||||||||||| || ||   |||  |||| || | |||||| || ||||
Sbjct: 76197 tgggcgtgcgcaacctggtggtggtgtcggacccgaagctggcgacggaggtgctgcaca 76138

                                                                         
Query: 361   cccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggca 420
             | |||||||| ||||||||||||||| | |||||||||||||||||||||||||||| ||
Sbjct: 76137 cgcagggcgtggagttcggctcccgcccgcgcaacgtcgtcttcgacatcttcaccgcca 76078

                                                        
Query: 421   agggacaggacatggtgttcacggtgtacggcgaccactggcg 463
             | ||    |||||||||||||| | ||||||||||||||||||
Sbjct: 76077 acggcgccgacatggtgttcaccgagtacggcgaccactggcg 76035



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 211   tcggcaactggctgcaggtcggcgacgacctcaaccaccg 250
             ||||||||||||||||||| ||| ||||||| ||||||||
Sbjct: 92859 tcggcaactggctgcaggtgggcaacgacctgaaccaccg 92898



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 211   tcggcaactggctgcaggtcggcgacgacctcaaccac 248
             |||||||||||||||| |||||  ||||||| ||||||
Sbjct: 76287 tcggcaactggctgcacgtcgggaacgacctgaaccac 76250



to top

>dbj|AK072588.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023132G16, full
           insert sequence
          Length = 1910

 Score =  125 bits (63), Expect = 2e-25
 Identities = 138/163 (84%)
 Strand = Plus / Plus

                                                                       
Query: 301 tgggcgtccgcaacctggtggtcgtctccagccccgagctcgccaaggaggtcctccaca 360
           ||||||| |||||||||||||| || ||   |||  |||| || | |||||| || ||||
Sbjct: 401 tgggcgtgcgcaacctggtggtggtgtcggacccgaagctggcgacggaggtgctgcaca 460

                                                                       
Query: 361 cccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggca 420
           | |||||||| ||||||||||||||| | |||||||||||||||||||||||||||| ||
Sbjct: 461 cgcagggcgtggagttcggctcccgcccgcgcaacgtcgtcttcgacatcttcaccgcca 520

                                                      
Query: 421 agggacaggacatggtgttcacggtgtacggcgaccactggcg 463
           | ||    |||||||||||||| | ||||||||||||||||||
Sbjct: 521 acggcgccgacatggtgttcaccgagtacggcgaccactggcg 563



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccg 250
           ||||||||||||||||||| ||| ||||||| ||||||||
Sbjct: 311 tcggcaactggctgcaggtgggcaacgacctgaaccaccg 350



to top

>gb|AF548370.1| Ruta graveolens cinnamate 4-hydroxylase (C4H) mRNA, C4H-v2 allele,
           complete cds
          Length = 1751

 Score =  119 bits (60), Expect = 1e-23
 Identities = 138/164 (84%)
 Strand = Plus / Plus

                                                                       
Query: 342 gccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtcgtc 401
           |||||||||||  | || || ||||| || ||||||||||| || ||  | |||||||||
Sbjct: 334 gccaaggaggtgttgcatactcagggagtggagttcggctctcggacgagaaacgtcgtc 393

                                                                       
Query: 402 ttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccactgg 461
           ||||| ||||||||||| || || |||||||||||||||||||| ||| | || ||||||
Sbjct: 394 ttcgatatcttcaccgggaaaggccaggacatggtgttcacggtttacagtgagcactgg 453

                                                       
Query: 462 cgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || ||||||||| |||||||||| || || |||||||| |||||
Sbjct: 454 cggaagatgcggaggatcatgaccgtccctttcttcacaaacaa 497



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 99  ctggagaaggccctgctgggcctcttcgccgcggcggt 136
           |||||||||||||| || |||||||||||||| |||||
Sbjct: 91  ctggagaaggccctcctaggcctcttcgccgccgcggt 128



to top

>gb|AF097664.1|AF097664 Mesembryanthemum crystallinum cinnamate 4-hydroxylase mRNA,
           complete cds
          Length = 1750

 Score =  113 bits (57), Expect = 7e-22
 Identities = 102/117 (87%)
 Strand = Plus / Plus

                                                                       
Query: 396 gtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgac 455
           |||||||| ||||||||||||||    || ||||||||||||||||| | |||||| |||
Sbjct: 476 gtcgtctttgacatcttcaccgggggcggccaggacatggtgttcaccgagtacggggac 535

                                                                    
Query: 456 cactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggtggtg 512
           || ||| | |||||| ||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 536 cattggaggaagatgaggcggatcatgaccgtgcctttcttcaccaacaaggtggtg 592



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 203 ccccatcgtcggcaactggctgcaggtcggcgacgacctcaaccaccgc 251
           ||||||| |||| |||||||||||||| ||  |||| || |||||||||
Sbjct: 283 ccccatcttcgggaactggctgcaggttgggaacgatctaaaccaccgc 331



to top

>gb|AY621152.1| Camptotheca acuminata cinnamate-4-hydroxylase mRNA, complete cds
          Length = 1518

 Score =  109 bits (55), Expect = 1e-20
 Identities = 130/155 (83%)
 Strand = Plus / Plus

                                                                       
Query: 357 cacacccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcacc 416
           ||||| ||||| ||||||||||| ||||| ||||| ||||| || ||||| || ||||||
Sbjct: 274 cacactcagggtgtcgagttcgggtcccgaacccgaaacgttgtattcgatattttcacc 333

                                                                       
Query: 417 ggcaagggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcgg 476
           || ||||| ||||||||||||||||| || || || || |||||| | || ||| | || 
Sbjct: 334 ggaaaggggcaggacatggtgttcaccgtttatggtgagcactggaggaaaatgagacgc 393

                                              
Query: 477 atcatgacggtgcccttcttcaccaacaaggtggt 511
           |||||||| || || ||||||||||||||||||||
Sbjct: 394 atcatgaccgtccctttcttcaccaacaaggtggt 428



to top

>dbj|AB055507.1| Lithospermum erythrorhizon C4H-1 mRNA for cinnamic acid
           4-hydroxylase, complete cds
          Length = 1676

 Score =  101 bits (51), Expect = 3e-18
 Identities = 129/155 (83%)
 Strand = Plus / Plus

                                                                       
Query: 351 gtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatc 410
           ||||||||||| ||||| ||||| |||||||| || ||  | |||||||| || || |||
Sbjct: 305 gtcctccacactcagggggtcgaattcggctctcgtactaggaacgtcgtttttgatatc 364

                                                                       
Query: 411 ttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatg 470
           ||||| || || |||||||||||||||||||| || || || || |||||||| || |||
Sbjct: 365 ttcacaggtaaaggacaggacatggtgttcaccgtctatggagagcactggcgtaaaatg 424

                                              
Query: 471 cggcggatcatgacggtgcccttcttcaccaacaa 505
            || |||||||||| || ||||||||||| |||||
Sbjct: 425 aggaggatcatgacagtccccttcttcacaaacaa 459



to top

>dbj|AB232856.1| Lactuca sativa mRNA for cinnamate 4-hydroxylase, partial cds,
           clone: C4H1
          Length = 833

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 62/66 (93%)
 Strand = Plus / Plus

                                                                       
Query: 447 tacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaag 506
           |||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||| 
Sbjct: 5   tacggcgagcactggcgcaagatgcgacggatcatgacggtgccgttcttcaccaacaaa 64

                 
Query: 507 gtggtg 512
           ||||||
Sbjct: 65  gtggtg 70



to top

>gb|AF286648.1|AF286648 Gossypium arboreum cinnamate-4-hydroxylase mRNA, complete cds
          Length = 1758

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 423 ggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatcatg 482
           |||||||||||||| ||||| |||||||| || ||||||||||||||| |  ||||||||
Sbjct: 354 ggacaggacatggttttcaccgtgtacggtgagcactggcgcaagatgagaaggatcatg 413

                                     
Query: 483 acggtgcccttcttcaccaacaaggt 508
           || || || |||||||||||||||||
Sbjct: 414 accgtccctttcttcaccaacaaggt 439



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacct 256
           ||||||||||||| || |||||||| ||| | ||||||||||||||
Sbjct: 142 tcggcaactggctccaagtcggcgatgacttgaaccaccgcaacct 187



to top

>gb|AF286647.1|AF286647 Gossypium arboreum cinnamate-4-hydroxylase (LP89) mRNA, complete
           cds
          Length = 1706

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 141/173 (81%)
 Strand = Plus / Plus

                                                                       
Query: 336 gagctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaac 395
           ||||| ||||| ||||| |||||||| ||||| || |||||||||||  | ||  | |||
Sbjct: 283 gagctagccaaagaggtgctccacacgcagggagtggagttcggctcaagaactaggaac 342

                                                                       
Query: 396 gtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgac 455
           || || || || || ||||| || ||||| || |||||||| |||||||||||||| || 
Sbjct: 343 gtagtgtttgatatattcacgggtaagggtcaagacatggttttcacggtgtacggagag 402

                                                                
Query: 456 cactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggt 508
           |||||| | || ||| |||||||||||||||| || || || |||||||||||
Sbjct: 403 cactggaggaaaatgaggcggatcatgacggtaccattttttaccaacaaggt 455



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 91  tcctcctcctggagaaggccctgctgggcctcttcg 126
           ||||| || ||||||||||||| |||||||| ||||
Sbjct: 38  tcctcttcttggagaaggccctcctgggccttttcg 73



to top

>gb|AY219918.1| Ammi majus cinnamate 4-hydroxylase mRNA, complete cds
          Length = 1623

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 363 cagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggcaag 422
           ||||| || ||||| || || ||||| || ||||| || ||||| |||||||| ||||||
Sbjct: 320 cagggtgttgagtttggttcacgcactcgtaacgttgttttcgatatcttcactggcaag 379

                                                                       
Query: 423 ggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatcatg 482
           |||||||||||||| |||||||| ||| | || || ||| | |||||| || | ||||||
Sbjct: 380 ggacaggacatggttttcacggtctacagtgagcattggaggaagatgaggagaatcatg 439

                                  
Query: 483 acggtgcccttcttcaccaacaa 505
           || || || ||||| ||||||||
Sbjct: 440 acagtacctttctttaccaacaa 462



to top

>gb|U19922.1|ZEU19922 Zinnia elegans cinnamic acid 4-hydroxylase mRNA, complete cds
          Length = 1648

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 372 gagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggcaagggacaggac 431
           |||||||| || || || || ||||| || |||||||| ||||| || || || || |||
Sbjct: 308 gagttcggatcacggacacgaaacgttgtgttcgacatattcacaggaaaaggtcaagac 367

                                                                       
Query: 432 atggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgccc 491
           ||||||||||| |||||||| || || ||||| |||||| | ||||||||||| || || 
Sbjct: 368 atggtgttcacagtgtacggtgagcattggcgaaagatgagacggatcatgaccgtccca 427

                         
Query: 492 ttcttcaccaacaa 505
           |||||||| |||||
Sbjct: 428 ttcttcacaaacaa 441



to top

>ref|NM_128601.2| Arabidopsis thaliana ATC4H (CINNAMATE-4-HYDROXYLASE) AT2G30490
           (ATC4H) mRNA, complete cds
          Length = 1803

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 397 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 456

                                                                
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 457 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 509



to top

>gb|BT008875.1| Arabidopsis thaliana At2g30490 mRNA, complete cds
          Length = 1518

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 310 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 369

                                                                
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 370 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 422



to top

>gb|U93215.3| Arabidopsis thaliana chromosome 2 BAC T6B20 genomic sequence, complete
             sequence
          Length = 104861

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                         
Query: 393   aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
             |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 58002 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 58061

                                                                  
Query: 453   gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
             || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 58062 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 58114



to top

>gb|AY065145.1| Arabidopsis thaliana cinnamate-4-hydroxylase (At2g30490; T6B20.16)
           mRNA, complete cds
          Length = 1794

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 397 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 456

                                                                
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 457 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 509



to top

>emb|BX819707.1|CNS0AA1Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS19ZE10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1751

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 383 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 442

                                                                
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 443 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 495



to top

>emb|BX820902.1|CNS0A9NW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZF08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1679

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 361 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 420

                                                                
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 421 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 473



to top

>dbj|D78596.1| Arabidopsis thaliana mRNA for trans-cinnamate 4-hydroxylase,
           complete cds
          Length = 1711

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 366 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 425

                                                                
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 426 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 478



to top

>gb|U37235.1|ATU37235 Arabidopsis thaliana cinnamate 4-hydroxylase (CYP73A5) mRNA,
           complete cds
          Length = 1735

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 358 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 417

                                                                
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 418 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 470



to top

>gb|U71081.1|ATU71081 Arabidopsis thaliana cinnamate-4-hydroxylase (atC4H) mRNA, complete
           cds
          Length = 1727

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 365 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 424

                                                                
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
           || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 425 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 477



to top

>gb|U71080.1|ATU71080 Arabidopsis thaliana cinnamate-4-hydroxylase (atC4H) gene, complete
            cds
          Length = 5432

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 393  aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
            |||||||| |||||||| |||||||| || || || || ||||||||||| || ||||||
Sbjct: 3261 aacgtcgtgttcgacattttcaccgggaaaggtcaagatatggtgttcactgtttacggc 3320

                                                                 
Query: 453  gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
            || || ||| | |||||| |  | ||||||||||| || ||||||||||||||
Sbjct: 3321 gagcattggaggaagatgagaagaatcatgacggttcctttcttcaccaacaa 3373



to top

>gb|AF255013.1|AF255013 Citrus sinensis cinnamate 4-hydroxylase CYP73 (C4H1) mRNA, complete
           cds
          Length = 1708

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 375 ttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggcaagggacaggacatg 434
           ||||| |||||| | |||||||| || ||||| || ||||| ||||| ||||||||||||
Sbjct: 364 ttcggatcccgcccacgcaacgtggttttcgatattttcacgggcaatggacaggacatg 423

                                                                       
Query: 435 gtgttcacggtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgcccttc 494
           |||||||| || || || || || |||||||| |||||  |||| |||||  |||| || 
Sbjct: 424 gtgttcactgtttatggtgagcattggcgcaaaatgcgtaggattatgacactgccattt 483

                   
Query: 495 ttcaccaa 502
           ||||||||
Sbjct: 484 ttcaccaa 491



to top

>gb|L38898.1|PUMC4H Petroselinum crispum trans-cinnamate 4-monooxygenase (C4H) mRNA,
           complete cds
          Length = 1801

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                       
Query: 363 cagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggcaag 422
           ||||| || ||||| || || ||||| || ||||| || ||||| |||||||| ||||||
Sbjct: 434 cagggtgttgagtttggatcacgcactcgtaacgttgttttcgatatcttcacaggcaag 493

                               
Query: 423 ggacaggacatggtgttcac 442
           ||||||||||||||||||||
Sbjct: 494 ggacaggacatggtgttcac 513



to top

>gb|AC141923.27| Medicago truncatula clone mth2-7f19, complete sequence
          Length = 116685

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                         
Query: 339   ctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtc 398
             |||||||| || ||||||||||| || || || || ||||| || || || || ||||| 
Sbjct: 57665 ctcgccaaagaagtcctccacacacaaggtgttgaattcggatcacgtacacgtaacgta 57606

                                                                         
Query: 399   gtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccac 458
             || ||||| |||||||| || || ||||| |||||||||||||| || |||||||| || 
Sbjct: 57605 gttttcgatatcttcactggtaaaggacaagacatggtgttcacagtctacggcgaacat 57546

                           
Query: 459   tggcgcaagatgcg 472
             ||||| || |||||
Sbjct: 57545 tggcgtaaaatgcg 57532



to top

>gb|DQ335792.1| Medicago truncatula cytochrome P450 monooxygenase CYP73A (CYP73A)
           mRNA, complete cds
          Length = 1863

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                       
Query: 339 ctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtc 398
           |||||||| || ||||||||||| || || || || ||||| || || || || ||||| 
Sbjct: 407 ctcgccaaagaagtcctccacacacaaggtgttgaattcggatcacgtacacgtaacgta 466

                                                                       
Query: 399 gtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccac 458
           || ||||| |||||||| || || ||||| |||||||||||||| || |||||||| || 
Sbjct: 467 gttttcgatatcttcactggtaaaggacaagacatggtgttcacagtctacggcgaacat 526

                         
Query: 459 tggcgcaagatgcg 472
           ||||| || |||||
Sbjct: 527 tggcgtaaaatgcg 540



to top

>gb|L11046.1|ALFEICA4HA Medicago sativa elicitor-inducible cinnamic acid 4-hydroxylase
           mRNA, complete cds
          Length = 1744

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 136/170 (80%)
 Strand = Plus / Plus

                                                                       
Query: 339 ctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtc 398
           |||||||| || ||||||||||| ||  | || || ||||| || || || || ||||| 
Sbjct: 285 ctcgccaaagaagtcctccacacacaatgtgttgaattcggatcacgtacacgtaacgta 344

                                                                       
Query: 399 gtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccac 458
           || ||||| || ||||| || || ||||| |||||||||||||| || |||||||| || 
Sbjct: 345 gtattcgatattttcacaggtaaaggacaagacatggtgttcactgtctacggcgaacat 404

                                                             
Query: 459 tggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggt 508
           ||||| || |||||  | |||||||| || || |||||||| ||||||||
Sbjct: 405 tggcgtaaaatgcgcagaatcatgaccgttcctttcttcacaaacaaggt 454



to top

>gb|AY641731.2| Camellia sinensis trans-cinnamate 4-hydroxylase (C4H) mRNA,
           complete cds
          Length = 1352

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                       
Query: 432 atggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgccc 491
           ||||||||||| || ||||| || |||||| | |||||| || ||||||||||||| || 
Sbjct: 1   atggtgttcactgtatacggtgagcactggaggaagatgaggaggatcatgacggttcct 60

                                
Query: 492 ttcttcaccaacaaggtggtg 512
           || || |||||||||||||||
Sbjct: 61  ttttttaccaacaaggtggtg 81



to top

>gb|AY541032.1| Allium cepa cinammate 4-hydroxylase mRNA, complete cds
          Length = 1761

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 203 ccccatcgtcggcaactggctgcaggtcggcgacgacctcaaccaccgcaacct 256
           ||||||| ||||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 159 ccccatcttcggcaactggctccaagtcggcgacgatctgaaccaccggaacct 212



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 104/131 (79%)
 Strand = Plus / Plus

                                                                       
Query: 372 gagttcggctcccgcacccgcaacgtcgtcttcgacatcttcaccggcaagggacaggac 431
           |||||||| ||||| ||||| || || || || || || ||||| || || || ||||| 
Sbjct: 328 gagttcggatcccggacccgaaatgttgtttttgatatattcactggaaaagggcaggat 387

                                                                       
Query: 432 atggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatcatgacggtgccc 491
           ||||| ||||| || ||||| || |||||| | |||||| | ||||| ||||| || || 
Sbjct: 388 atggttttcactgtttacggtgagcactggaggaagatgagacggattatgactgttcct 447

                      
Query: 492 ttcttcaccaa 502
           |||||||||||
Sbjct: 448 ttcttcaccaa 458



to top

>emb|AJ007449.2|CAR7449 Cicer arietinum mRNA for Trans-Cinnamate 4-Monooxygenase
          Length = 1629

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 339 ctcgccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtc 398
           ||||| || ||||| |||||||| || || ||||| ||||| ||||| ||  | ||||| 
Sbjct: 256 ctcgcaaaagaggttctccacactcaaggtgtcgaattcggttcccgaacaaggaacgtt 315

                                                                
Query: 399 gtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacgg 451
           || ||||| ||||||||||| || |||||||| ||||| ||||| || |||||
Sbjct: 316 gttttcgatatcttcaccggaaaaggacaggatatggttttcaccgtttacgg 368



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 211 tcggcaactggctgcaggtcggcgacgacctcaaccaccg 250
           |||| |||||||| || |||||||| || |||||||||||
Sbjct: 128 tcggtaactggcttcaagtcggcgatgatctcaaccaccg 167



to top

>gb|AY748324.1| Ginkgo biloba cinnamic acid 4-hydroxylase mRNA, complete cds
          Length = 1854

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 130/164 (79%)
 Strand = Plus / Plus

                                                                       
Query: 342 gccaaggaggtcctccacacccagggcgtcgagttcggctcccgcacccgcaacgtcgtc 401
           ||||||||||| || || ||||| || || |||||||| ||||||||  | || || || 
Sbjct: 438 gccaaggaggtgctgcatacccaaggtgtggagttcggttcccgcacaagaaatgtggtt 497

                                                                       
Query: 402 ttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggcgaccactgg 461
           || || || |||||||| |||||||| || ||||| || ||||| || || || ||||||
Sbjct: 498 tttgatattttcaccgggaagggacaagatatggtttttacggtttatggagagcactgg 557

                                                       
Query: 462 cgcaagatgcggcggatcatgacggtgcccttcttcaccaacaa 505
            | ||||||||  | || ||||| || || ||||||||||||||
Sbjct: 558 aggaagatgcgcagaattatgactgtacctttcttcaccaacaa 601



to top

>gb|AF029856.1|AF029856 Sorghum bicolor cytochrome P450 CYP98A1 (CYP98A1) mRNA, complete
           cds
          Length = 1784

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 318 gtggtcgtctccagccccgagctcgccaaggaggt 352
           ||||||||||||| | |||||||||||||||||||
Sbjct: 243 gtggtcgtctccacctccgagctcgccaaggaggt 277



to top

>emb|Z17369.1|HTTC4MMR H.tuberosus mRNA for trans-cinnamate 4-monooxygenase
          Length = 1620

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 420 aagggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatc 479
           ||||| ||||| |||||||| ||||| || || || || ||| | |||||| || |||||
Sbjct: 367 aagggtcaggatatggtgtttacggtttatggtgagcattggaggaagatgaggaggatc 426

                                     
Query: 480 atgacggtgcccttcttcaccaacaa 505
           ||||| || ||||| |||||||||||
Sbjct: 427 atgaccgtaccctttttcaccaacaa 452



to top

>gb|AF302495.1|AF302495 Populus trichocarpa X Populus deltoides cinnamate 4-hydroxylase
           (C4H) mRNA, complete cds
          Length = 1750

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                       
Query: 420 aagggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatc 479
           |||||||| |||||||||||||| || ||||| || || ||| | |||||| || | |||
Sbjct: 372 aagggacaagacatggtgttcactgtctacggtgaacattggaggaagatgaggagaatc 431

                                        
Query: 480 atgacggtgcccttcttcaccaacaaggt 508
           ||||| || || ||||| || ||||||||
Sbjct: 432 atgactgtccctttctttacaaacaaggt 460



to top

>gb|AF368378.1| Nicotiana tabacum elicitor-inducible cytochrome P450 (CYP73A27)
           mRNA, complete cds
          Length = 1745

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 96/120 (80%)
 Strand = Plus / Plus

                                                                       
Query: 393 aacgtcgtcttcgacatcttcaccggcaagggacaggacatggtgttcacggtgtacggc 452
           ||||| ||||||||||| || || || || ||||| ||||||||||||||  | || || 
Sbjct: 410 aacgttgtcttcgacatatttactggtaatggacaagacatggtgttcaccatttatggt 469

                                                                       
Query: 453 gaccactggcgcaagatgcggcggatcatgacggtgcccttcttcaccaacaaggtggtg 512
           ||||| ||||| || ||| |||| || |||||| | || || ||||| ||||| ||||||
Sbjct: 470 gaccattggcgaaaaatgaggcgtattatgacgcttccatttttcactaacaaagtggtg 529



to top

>ref|XM_543057.2| PREDICTED: Canis familiaris similar to serologically defined colon
            cancer antigen 33 like (LOC485933), mRNA
          Length = 3468

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 535  aggaggaggcccggctggtggtggagg 561
            ||||||||||||||||||||| |||||
Sbjct: 2318 aggaggaggcccggctggtggaggagg 2344



to top

>gb|DQ371297.1| Astragalus membranaceus var. mongholicus trans-cinnamate
           4-monooxygenase (C4H) mRNA, partial cds
          Length = 713

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                       
Query: 354 ctccacacccagggcgtcgagttcggctcccgcacccgcaacgtcgtcttcgacatcttc 413
           |||||||| ||||| || || ||||| || || || || |||||||| ||||| ||||||
Sbjct: 16  ctccacacacagggtgttgaattcggttcacgaactcgtaacgtcgttttcgatatcttc 75

                                  
Query: 414 accggcaagggacaggacatggt 436
           ||||| || || ||||| |||||
Sbjct: 76  accggaaaaggtcaggatatggt 98



to top

>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 117     ggcctcttcgccgcggcggtgct 139
               |||||||||||||||||||||||
Sbjct: 1344288 ggcctcttcgccgcggcggtgct 1344266



to top

>gb|AC121849.3| Mus musculus BAC clone RP24-90K18 from chromosome 6, complete sequence
          Length = 205721

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 37    gacacacaggcacaggcacagg 58
             ||||||||||||||||||||||
Sbjct: 39734 gacacacaggcacaggcacagg 39713



to top

>gb|AC124425.3| Mus musculus BAC clone RP24-230N16 from chromosome 5, complete sequence
          Length = 178931

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 47     cacaggcacaggagccacacac 68
              ||||||||||||||||||||||
Sbjct: 122940 cacaggcacaggagccacacac 122961



to top

>ref|XM_811087.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053506967.50) partial mRNA
          Length = 1020

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 533 ggaggaggaggcccggctggtggtgg 558
           |||||||||||||| |||||||||||
Sbjct: 431 ggaggaggaggccctgctggtggtgg 406



to top

>ref|XM_816925.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053508221.660) partial mRNA
          Length = 1008

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 533 ggaggaggaggcccggctggtggtgg 558
           |||||||||||||| |||||||||||
Sbjct: 431 ggaggaggaggccctgctggtggtgg 406



to top

>gb|AC105305.8| Mus musculus strain C57BL/6J clone rp23-80n4 map 17, complete sequence
          Length = 214567

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 37     gacacacaggcacaggcacagg 58
              ||||||||||||||||||||||
Sbjct: 199132 gacacacaggcacaggcacagg 199111



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 37     gacacacaggcacaggcacagg 58
              ||||||||||||||||||||||
Sbjct: 199050 gacacacaggcacaggcacagg 199029



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 37     gacacacaggcacaggcacagg 58
              ||||||||||||||||||||||
Sbjct: 198792 gacacacaggcacaggcacagg 198771



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 37     gacacacaggcacaggcaca 56
              ||||||||||||||||||||
Sbjct: 198988 gacacacaggcacaggcaca 198969



to top

>gb|AC105302.27| Mus musculus strain C57BL/6J clone rp23-45h18 map 17, complete sequence
          Length = 238088

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 37     gacacacaggcacaggcacagg 58
              ||||||||||||||||||||||
Sbjct: 174111 gacacacaggcacaggcacagg 174132



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 37     gacacacaggcacaggcacagg 58
              ||||||||||||||||||||||
Sbjct: 173853 gacacacaggcacaggcacagg 173874



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 37     gacacacaggcacaggcacagg 58
              ||||||||||||||||||||||
Sbjct: 173771 gacacacaggcacaggcacagg 173792



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 37     gacacacaggcacaggcaca 56
              ||||||||||||||||||||
Sbjct: 173915 gacacacaggcacaggcaca 173934



to top

>gb|AC109609.12| Mus musculus strain C57BL/6J clone rp23-167h1 map 17, complete sequence
          Length = 167619

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 37    gacacacaggcacaggcacagg 58
             ||||||||||||||||||||||
Sbjct: 82992 gacacacaggcacaggcacagg 83013



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 37    gacacacaggcacaggcacagg 58
             ||||||||||||||||||||||
Sbjct: 82734 gacacacaggcacaggcacagg 82755



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 37    gacacacaggcacaggcacagg 58
             ||||||||||||||||||||||
Sbjct: 82652 gacacacaggcacaggcacagg 82673



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 37    gacacacaggcacaggcaca 56
             ||||||||||||||||||||
Sbjct: 82796 gacacacaggcacaggcaca 82815



to top

>emb|AL939106.1|SCO939106 Streptomyces coelicolor A3(2) complete genome; segment 3/29
          Length = 314100

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 319    tggtcgtctccagccccgagct 340
              ||||||||||||||||||||||
Sbjct: 162253 tggtcgtctccagccccgagct 162232



to top

>emb|AL603925.20| Mouse DNA sequence from clone RP23-175K24 on chromosome 11 Contains the
              gene for nuclear DNA binding protein C1d and a aldo-keto
              reductase family 1 member B3 (aldose reductase) (Akr1b3)
              pseudogene, complete sequence
          Length = 232869

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 37     gacacacaggcacaggcacagg 58
              ||||||||||||||||||||||
Sbjct: 172506 gacacacaggcacaggcacagg 172527



to top

>gb|AC147632.3| Mus musculus BAC clone RP23-326H18 from chromosome 5, complete sequence
          Length = 185519

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 47     cacaggcacaggagccacacac 68
              ||||||||||||||||||||||
Sbjct: 150784 cacaggcacaggagccacacac 150763



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 135     gtgctggccatcgccgtagccaagct 160
               ||||||||||||||||| ||||||||
Sbjct: 1271345 gtgctggccatcgccgtcgccaagct 1271370



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 110     cctgctgggcctcttcgccgcggcggtgctggcc 143
               ||||||||||  |||||||||||||||| |||||
Sbjct: 2389248 cctgctgggcaccttcgccgcggcggtggtggcc 2389215



to top

>gb|AF009336.1|AF009336 Streptomyces coelicolor lipase (lipA), and LipR activator (lipR)
            genes, complete cds
          Length = 6286

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 319  tggtcgtctccagccccgagct 340
            ||||||||||||||||||||||
Sbjct: 6014 tggtcgtctccagccccgagct 6035



to top

>dbj|AP000439.6| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-44E22, complete
             sequence
          Length = 105962

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 98    cctggagaaggccctgctgggc 119
             ||||||||||||||||||||||
Sbjct: 69574 cctggagaaggccctgctgggc 69595



to top

>gb|AC093319.18| Mus musculus strain C57BL/6J chromosome 17 clone rp23-258p19, complete
             sequence
          Length = 166527

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 37    gacacacaggcacaggcacagg 58
             ||||||||||||||||||||||
Sbjct: 88969 gacacacaggcacaggcacagg 88948



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 37    gacacacaggcacaggcacagg 58
             ||||||||||||||||||||||
Sbjct: 88887 gacacacaggcacaggcacagg 88866



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    gacacacaggcacaggcaca 56
             ||||||||||||||||||||
Sbjct: 88825 gacacacaggcacaggcaca 88806



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    gacacacaggcacaggcaca 56
             ||||||||||||||||||||
Sbjct: 88629 gacacacaggcacaggcaca 88610



to top

>gb|AC132431.3| Mus musculus BAC clone RP23-211M23 from 6, complete sequence
          Length = 207155

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 37    gacacacaggcacaggcacagg 58
             ||||||||||||||||||||||
Sbjct: 32162 gacacacaggcacaggcacagg 32183



to top

>emb|AL844895.6| Mouse DNA sequence from clone RP23-359N12 on chromosome 2, complete
             sequence
          Length = 210427

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 37    gacacacaggcacaggcacagg 58
             ||||||||||||||||||||||
Sbjct: 25158 gacacacaggcacaggcacagg 25179



to top

>emb|AL844865.6| Mouse DNA sequence from clone RP23-350L23 on chromosome 2, complete
              sequence
          Length = 197785

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 37     gacacacaggcacaggcacagg 58
              ||||||||||||||||||||||
Sbjct: 175419 gacacacaggcacaggcacagg 175398



to top

>gb|AC107725.10| Mus musculus chromosome 5, clone RP23-477O15, complete sequence
          Length = 169321

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 72467 acacacaggcacaggcacagg 72487



to top

>gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, complete sequence
          Length = 214765

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 38     acacacaggcacaggcacagg 58
              |||||||||||||||||||||
Sbjct: 193514 acacacaggcacaggcacagg 193534



to top

>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold
          Length = 1996640

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 38      acacacaggcacaggcacagg 58
               |||||||||||||||||||||
Sbjct: 1064278 acacacaggcacaggcacagg 1064258



to top

>gb|AC165965.3| Mus musculus BAC clone RP23-307L24 from chromosome 6, complete sequence
          Length = 209230

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 37     gacacacaggcacaggcacag 57
              |||||||||||||||||||||
Sbjct: 124734 gacacacaggcacaggcacag 124714



to top

>gb|AC099948.9| Mus musculus chromosome 10, clone RP23-19D21, complete sequence
          Length = 203086

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 99993 acacacaggcacaggcacagg 99973



to top

>gb|AC127594.3| Mus musculus BAC clone RP23-44G8 from chromosome 7, complete sequence
          Length = 209828

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 24094 acacacaggcacaggcacagg 24074



to top

>gb|AC110379.3| Mus musculus BAC clone RP24-193N24 from 15, complete sequence
          Length = 139884

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 38     acacacaggcacaggcacagg 58
              |||||||||||||||||||||
Sbjct: 105363 acacacaggcacaggcacagg 105383



to top

>gb|AC116659.3| Mus musculus BAC clone RP24-147E15 from 7, complete sequence
          Length = 140476

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 19644 acacacaggcacaggcacagg 19624



to top

>gb|AC135230.8| Medicago truncatula clone mth2-23e14, complete sequence
          Length = 124972

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 523   gcgtggggtgggaggaggagg 543
             |||||||||||||||||||||
Sbjct: 51633 gcgtggggtgggaggaggagg 51653



to top

>gb|AC137829.23| Medicago truncatula clone mth2-34j5, complete sequence
          Length = 127295

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 523   gcgtggggtgggaggaggagg 543
             |||||||||||||||||||||
Sbjct: 74850 gcgtggggtgggaggaggagg 74830



to top

>gb|AC158217.4| Mus musculus chromosome 5, clone RP24-377B20, complete sequence
          Length = 160008

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 20453 acacacaggcacaggcacagg 20433



to top

>ref|XM_780739.1| PREDICTED: Strongylocentrotus purpuratus similar to ubiquitin
          fusion degradation 1-like (LOC580698), mRNA
          Length = 918

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 47 cacaggcacaggagccacaca 67
          |||||||||||||||||||||
Sbjct: 47 cacaggcacaggagccacaca 27



to top

>emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete genome; segment 9/16
          Length = 348706

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 126  gccgcggcggtgctggccatcgccg 150
            |||||||| ||||||||||||||||
Sbjct: 4600 gccgcggccgtgctggccatcgccg 4624



to top

>emb|BX640427.1| Bordetella parapertussis strain 12822, complete genome; segment 5/14
          Length = 348997

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 126    gccgcggcggtgctggccatcgccg 150
              |||||||| ||||||||||||||||
Sbjct: 261385 gccgcggccgtgctggccatcgccg 261409



to top

>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12
          Length = 347071

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 126    gccgcggcggtgctggccatcgccg 150
              |||||||| ||||||||||||||||
Sbjct: 129718 gccgcggccgtgctggccatcgccg 129742



to top

>gb|AC106707.9| Homo sapiens 3 BAC RP11-538P18 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 189059

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 523    gcgtggggtgggaggaggagg 543
              |||||||||||||||||||||
Sbjct: 181711 gcgtggggtgggaggaggagg 181731



to top

>gb|AC023715.4| Drosophila melanogaster X BAC RP98-17H6 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 160629

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 38     acacacaggcacaggcacagg 58
              |||||||||||||||||||||
Sbjct: 115501 acacacaggcacaggcacagg 115481



to top

>gb|AC151548.3| Macropus eugenii clone ME_KBa-603H10, complete sequence
          Length = 111549

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 38   acacacaggcacaggcacagg 58
            |||||||||||||||||||||
Sbjct: 1591 acacacaggcacaggcacagg 1571



to top

>gb|AC154811.2| Mus musculus BAC clone RP24-531D17 from chromosome 14, complete sequence
          Length = 167122

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 38     acacacaggcacaggcacagg 58
              |||||||||||||||||||||
Sbjct: 140605 acacacaggcacaggcacagg 140625



to top

>gb|AC011510.7|AC011510 Homo sapiens chromosome 19 clone CTD-2195B23, complete sequence
          Length = 129402

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 59261 acacacaggcacaggcacagg 59241



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 569     ggccgacccggcggcggcgac 589
               |||||||||||||||||||||
Sbjct: 4545944 ggccgacccggcggcggcgac 4545924



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 361     cccagggcgtcgagttcggct 381
               |||||||||||||||||||||
Sbjct: 1088174 cccagggcgtcgagttcggct 1088154



to top

>dbj|AK110548.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-168-B11, full
           insert sequence
          Length = 1741

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 508 tggtggcgcaaaaccgcgtgg 528
           |||||||||||||||||||||
Sbjct: 277 tggtggcgcaaaaccgcgtgg 297



to top

>emb|AL672107.5| Zebrafish DNA sequence from clone BUSM1-84N18 in linkage group 1
             Contains a novel lambda recombinase like pseudogene, a
             putative novel gene and two CpG islands, complete sequence
          Length = 106684

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 61639 acacacaggcacaggcacagg 61619



to top

>gb|AE003432.5| Drosophila melanogaster chromosome X, section 16 of 74 of the complete
             sequence
          Length = 319328

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 45233 acacacaggcacaggcacagg 45213



to top

>gb|AY664418.1| Zea mays cultivar Mo17 locus 9008, complete sequence
          Length = 282600

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 173    cttccgcctcccacccggcccctcc 197
              ||||||||||||||||| |||||||
Sbjct: 161410 cttccgcctcccacccgccccctcc 161386



to top

>gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence
          Length = 339089

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 173    cttccgcctcccacccggcccctcc 197
              ||||||||||||||||| |||||||
Sbjct: 177589 cttccgcctcccacccgccccctcc 177565



to top

>gb|AC146616.3| Mus musculus BAC clone RP23-9A18 from 7, complete sequence
          Length = 198813

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 54525 acacacaggcacaggcacagg 54545



to top

>gb|U47293.1|PTU47293 Populus tremuloides trans-cinnamate 4-hydroxylase (PtC4H) mRNA,
           complete cds
          Length = 1803

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 420 aagggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatc 479
           |||||||| |||||||||||||| || || || || || ||| | |||||| || | |||
Sbjct: 411 aagggacaagacatggtgttcactgtctatggtgagcattggaggaagatgaggagaatc 470

                                        
Query: 480 atgacggtgcccttcttcaccaacaaggt 508
           ||||| || || ||||| || ||||||||
Sbjct: 471 atgacagtccctttctttacaaacaaggt 499



to top

>gb|AC120163.10| Mus musculus chromosome 15, clone RP24-466O11, complete sequence
          Length = 129237

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 38    acacacaggcacaggcacagg 58
             |||||||||||||||||||||
Sbjct: 83919 acacacaggcacaggcacagg 83899



to top

>dbj|AP006142.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT08A24, TM0250,
             complete sequence
          Length = 104321

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 446   gtacggcgaccactggcgcaa 466
             |||||||||||||||||||||
Sbjct: 29840 gtacggcgaccactggcgcaa 29820



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 447  tacggcgaccactggcgcaa 466
            ||||||||||||||||||||
Sbjct: 8199 tacggcgaccactggcgcaa 8180



to top

>dbj|D82815.1|POPPCYP73D Populus kitakamiensis cyp73a mRNA for cinnamic acid 4-hydroxylase,
           complete cds
          Length = 1737

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 420 aagggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatc 479
           |||||||| |||||||||||||| || || || || || ||| | |||||| || | |||
Sbjct: 396 aagggacaagacatggtgttcactgtctatggtgagcattggaggaagatgaggagaatc 455

                                        
Query: 480 atgacggtgcccttcttcaccaacaaggt 508
           ||||| || || ||||| || ||||||||
Sbjct: 456 atgactgtccctttctttacaaacaaggt 484



to top

>dbj|D82813.1|POPCYP73BB Populus kitakamiensis cyp73b gene for cinnamic acid 4-hydroxylase,
            partial cds
          Length = 4933

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                        
Query: 420  aagggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatc 479
            |||||||| |||||||||||||| || || || || || ||| | |||||| || | |||
Sbjct: 2506 aagggacaagacatggtgttcactgtctatggtgagcattggaggaagatgaggagaatc 2565

                                         
Query: 480  atgacggtgcccttcttcaccaacaaggt 508
            ||||| || || ||||| || ||||||||
Sbjct: 2566 atgactgtccctttctttacaaacaaggt 2594



to top

>dbj|D82812.1|POPCYP73AA Populus kitakamiensis cyp73a gene for cinnamic acid 4-hydroxylase,
            complete cds
          Length = 5167

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                        
Query: 420  aagggacaggacatggtgttcacggtgtacggcgaccactggcgcaagatgcggcggatc 479
            |||||||| |||||||||||||| || || || || || ||| | |||||| || | |||
Sbjct: 2709 aagggacaagacatggtgttcactgtctatggtgagcattggaggaagatgaggagaatc 2768

                                         
Query: 480  atgacggtgcccttcttcaccaacaaggt 508
            ||||| || || ||||| || ||||||||
Sbjct: 2769 atgactgtccctttctttacaaacaaggt 2797



to top

>gb|AC123684.8| Mus musculus chromosome 3, clone RP23-297F14, complete sequence
          Length = 200566

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 38    acacacaggcacaggcacag 57
             ||||||||||||||||||||
Sbjct: 39628 acacacaggcacaggcacag 39647



to top

>ref|XM_480310.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 330

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 532 gggaggaggaggcccggctggtgg 555
           |||||||| |||||||||||||||
Sbjct: 83  gggaggagcaggcccggctggtgg 60



to top

>gb|AC132347.4| Mus musculus BAC clone RP24-186F6 from chromosome 13, complete sequence
          Length = 155751

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    cacaggcacaggcacaggag 60
             ||||||||||||||||||||
Sbjct: 28377 cacaggcacaggcacaggag 28358



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 568     gggccgacccggcggcggcg 587
               ||||||||||||||||||||
Sbjct: 1500145 gggccgacccggcggcggcg 1500126



to top

>ref|NM_191387.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2964

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 525 gtggggtgggaggaggaggc 544
           ||||||||||||||||||||
Sbjct: 23  gtggggtgggaggaggaggc 42



to top

>ref|XM_514338.1| PREDICTED: Pan troglodytes similar to espin (LOC457896), mRNA
          Length = 3379

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 533  ggaggaggaggcccggctgg 552
            ||||||||||||||||||||
Sbjct: 2994 ggaggaggaggcccggctgg 3013



to top

>ref|NM_031475.1| Homo sapiens espin (ESPN), mRNA
          Length = 3542

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 533  ggaggaggaggcccggctgg 552
            ||||||||||||||||||||
Sbjct: 2499 ggaggaggaggcccggctgg 2518



to top

>gb|AC162037.2| Mus musculus chromosome 8, clone RP23-35K23, complete sequence
          Length = 241548

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 39    cacacaggcacaggcacagg 58
             ||||||||||||||||||||
Sbjct: 76157 cacacaggcacaggcacagg 76176



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 39    cacacaggcacaggcacagg 58
             ||||||||||||||||||||
Sbjct: 76131 cacacaggcacaggcacagg 76150



to top

>gb|AY644468.1| Saccharum officinarum mitochondrial alternative oxidase 1d mRNA,
           complete cds; nuclear gene for mitochondrial product
          Length = 1108

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 127 ccgcggcggtgctggccatc 146
           ||||||||||||||||||||
Sbjct: 38  ccgcggcggtgctggccatc 19



to top

>gb|BT015224.1| Drosophila melanogaster RE33368 full insert cDNA
          Length = 2540

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 43   caggcacaggcacaggagccacac 66
            ||||||||||||||||||| ||||
Sbjct: 1977 caggcacaggcacaggagcaacac 2000



to top

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    gccgcggcggtgctggccat 145
              ||||||||||||||||||||
Sbjct: 656945 gccgcggcggtgctggccat 656926



to top

>gb|AY881693.1| Baboon herpesvirus 2 strain 860 ICP22 (US1), US2 (US2), protein
            kinase (US3), glycoprotein G (US4), glycoprotein J (US5),
            glycoprotein D (US6), glycoprotein I (US7), glycoprotein
            E (US8), US8.5 (US8.5), US9 (US9), US10 (US10), tegument
            protein (US11), and ICP47 (US12) genes, complete cds
          Length = 15072

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 40   acacaggcacaggcacagga 59
            ||||||||||||||||||||
Sbjct: 4578 acacaggcacaggcacagga 4559



to top

>gb|AC159902.2| Pan troglodytes BAC clone CH251-493H22 from chromosome 2, complete
              sequence
          Length = 242783

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 539    ggaggcccggctggtggtgg 558
              ||||||||||||||||||||
Sbjct: 132079 ggaggcccggctggtggtgg 132060



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 128     cgcggcggtgctggccatcg 147
               ||||||||||||||||||||
Sbjct: 3643933 cgcggcggtgctggccatcg 3643914



to top

>ref|XM_582601.2| PREDICTED: Bos taurus similar to Centaurin-beta 2 (Cnt-b2)
           (LOC506187), mRNA
          Length = 2841

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 550 tggtggtggaggacctcagg 569
           ||||||||||||||||||||
Sbjct: 395 tggtggtggaggacctcagg 414



to top

>gb|AE006713.1| Sulfolobus solfataricus P2 section 72 of 272 of the complete genome
          Length = 7448

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 487  tgcccttcttcaccaacaaggtgg 510
            ||||||| ||||||||||||||||
Sbjct: 4081 tgcccttgttcaccaacaaggtgg 4104



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 157     agctcgccggcaagcgcttc 176
               ||||||||||||||||||||
Sbjct: 1337769 agctcgccggcaagcgcttc 1337750



to top

>gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, complete sequence
          Length = 190426

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 39     cacacaggcacaggcacagg 58
              ||||||||||||||||||||
Sbjct: 103719 cacacaggcacaggcacagg 103738



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 39     cacacaggcacaggcacagg 58
              ||||||||||||||||||||
Sbjct: 103599 cacacaggcacaggcacagg 103618



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 154      ccaagctcgccggcaagcgc 173
                ||||||||||||||||||||
Sbjct: 13934242 ccaagctcgccggcaagcgc 13934261



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 87       gacgtcctcctcctggagaa 106
                ||||||||||||||||||||
Sbjct: 11055685 gacgtcctcctcctggagaa 11055666



to top

>gb|AY203958.1| Homo sapiens LP2654 mRNA, complete cds
          Length = 1363

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 533 ggaggaggaggcccggctgg 552
           ||||||||||||||||||||
Sbjct: 853 ggaggaggaggcccggctgg 872



to top

>ref|XM_570147.1| Cryptococcus neoformans var. neoformans JEC21 initiation factor 5a
           (eif-5a) (CND05400) partial mRNA
          Length = 647

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 259 tcgacatcttcaccggcaag 278



to top

>gb|AC121999.3| Mus musculus BAC clone RP24-318P16 from chromosome 8, complete sequence
          Length = 192510

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 536   ggaggaggcccggctggtgg 555
             ||||||||||||||||||||
Sbjct: 74996 ggaggaggcccggctggtgg 75015



to top

>gb|AC135907.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1057D12,
             from chromosome 3, complete sequence
          Length = 161676

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 154   ccaagctcgccggcaagcgc 173
             ||||||||||||||||||||
Sbjct: 77240 ccaagctcgccggcaagcgc 77221



to top

>gb|AC126265.3| Mus musculus BAC clone RP23-383O12 from chromosome 16, complete sequence
          Length = 186172

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 41     cacaggcacaggcacaggag 60
              ||||||||||||||||||||
Sbjct: 159892 cacaggcacaggcacaggag 159873



to top

>gb|AC122806.4| Mus musculus BAC clone RP23-297C11 from 8, complete sequence
          Length = 184206

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 38    acacacaggcacaggcacag 57
             ||||||||||||||||||||
Sbjct: 54598 acacacaggcacaggcacag 54617



to top

>emb|AL606458.5| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084A10,
              complete sequence
          Length = 144811

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 146    cgccgtagccaagctcgccg 165
              ||||||||||||||||||||
Sbjct: 103585 cgccgtagccaagctcgccg 103566



to top

>ref|XM_537009.2| PREDICTED: Canis familiaris similar to Na(+)/H(+) exchange regulatory
            cofactor NHE-RF2 (NHERF-2) (Tyrosine kinase activator
            protein 1) (TKA-1) (SRY interacting protein 1) (SIP-1)
            (Solute carrier family 9 isoform A3 regulatory factor 2)
            (NHE3 kinase A regulatory protein E3KARP... (LOC479884),
            mRNA
          Length = 2209

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 533  ggaggaggaggcccggctggtggtggaggacc 564
            |||||| |||||||||||| |||||| |||||
Sbjct: 1542 ggaggacgaggcccggctgctggtggtggacc 1573



to top

>ref|XM_848159.1| PREDICTED: Canis familiaris similar to transmembrane protein 24
           (LOC610622), mRNA
          Length = 2991

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 107 ggccctgctgggcctcttcgccgc 130
           ||||||||||| ||||||||||||
Sbjct: 39  ggccctgctggtcctcttcgccgc 62



to top

>ref|XM_500654.1| Yarrowia lipolytica CLIB122, YALI0B08778g predicted mRNA
          Length = 3024

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 128 cgcggcggtgctggccatcg 147
           ||||||||||||||||||||
Sbjct: 51  cgcggcggtgctggccatcg 70



to top

>emb|AL158217.25| Human DNA sequence from clone RP4-650H14 on chromosome 1p36.23-36.33
            Contains the 3' end of the ESPN gene for espin, the
            TNFRSF25 gene for tumor necrosis factor receptor
            superfamily member 25, the gene for a novel PH
            domain-containing protein and four CpG islands, complete
            sequence
          Length = 53983

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 533  ggaggaggaggcccggctgg 552
            ||||||||||||||||||||
Sbjct: 6362 ggaggaggaggcccggctgg 6381



to top

>emb|AL157886.13| Human DNA sequence from clone RP11-59M22 on chromosome 9q21.31-21.33,
              complete sequence
          Length = 156956

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 524    cgtggggtgggaggaggagg 543
              ||||||||||||||||||||
Sbjct: 154498 cgtggggtgggaggaggagg 154479



to top

>emb|AL137798.8| Human DNA sequence from clone RP5-1182A14 on chromosome 1 Contains the
             5' end of a novel gene, a novel gene, a macrophage
             stimulating 1 (hepatocyte growth factor-like)(MST1)
             pseudogene and three CpG islands, complete sequence
          Length = 146141

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 533   ggaggaggaggcccggctgg 552
             ||||||||||||||||||||
Sbjct: 20971 ggaggaggaggcccggctgg 20990



to top

>gb|AC063952.15| Homo sapiens 3 BAC RP11-174O3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 152024

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 39    cacacaggcacaggcacagg 58
             ||||||||||||||||||||
Sbjct: 39949 cacacaggcacaggcacagg 39930



to top

>emb|AL049695.20|HSJ236J16 Human DNA sequence from clone RP1-236J16 on chromosome 6q21-22.1
             Contains a cytokine inducible SH2-containing protein 6
             (CISH6) pseudogene, complete sequence
          Length = 106348

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    acacacaggcacaggcacag 57
             ||||||||||||||||||||
Sbjct: 32837 acacacaggcacaggcacag 32818



to top

>emb|AL021920.1|HS163M9 Human DNA sequence from clone RP1-163M9 on chromosome 1p35.1-36.21
             Contains a novel pseudogene, a eukaryotic translation
             initiation factor 1A pseudogene 1 (EIF1AP1), part of a
             novel gene (LOC284729), a macrophage stimulating 1
             (hepatocyte growth factor-like)(MST1) pseudogene and five
             CpG islands, complete sequence
          Length = 118067

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 533   ggaggaggaggcccggctgg 552
             ||||||||||||||||||||
Sbjct: 10196 ggaggaggaggcccggctgg 10177



to top

>gb|AF461424.2| Oryza sativa chromosome 3 clone OSJNBa0016B07, complete sequence
          Length = 167588

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 87    gacgtcctcctcctggagaa 106
             ||||||||||||||||||||
Sbjct: 77437 gacgtcctcctcctggagaa 77456



to top

>emb|BX070349.1|CNS09QG1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 153 gccaagctcgccggcaagcgcttccgcc 180
           |||||| ||||||||||| |||||||||
Sbjct: 489 gccaagttcgccggcaagagcttccgcc 462



to top

>emb|BX069760.1|CNS09PZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 708

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 696 tcgacatcttcaccggcaag 677



to top

>emb|BX069759.1|CNS09PZN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 478 tcgacatcttcaccggcaag 497



to top

>emb|BX065533.1|CNS09MQ9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 700 tcgacatcttcaccggcaag 681



to top

>emb|BX065532.1|CNS09MQ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 849

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 540 tcgacatcttcaccggcaag 559



to top

>emb|BX062970.1|CNS09KR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 677 tcgacatcttcaccggcaag 658



to top

>emb|BX062969.1|CNS09KR1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 481 tcgacatcttcaccggcaag 500



to top

>emb|BX061234.1|CNS09JEU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 715 tcgacatcttcaccggcaag 696



to top

>emb|BX061233.1|CNS09JET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 551 tcgacatcttcaccggcaag 570



to top

>emb|BX054603.1|CNS09EAN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 490 tcgacatcttcaccggcaag 509



to top

>emb|BX031008.1|CNS08W38 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 680 tcgacatcttcaccggcaag 661



to top

>emb|BX031007.1|CNS08W37 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 493 tcgacatcttcaccggcaag 512



to top

>emb|BX048479.1|CNS099KJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 497 tcgacatcttcaccggcaag 516



to top

>emb|BX046617.1|CNS0984T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 477 tcgacatcttcaccggcaag 496



to top

>emb|BX042901.1|CNS0959L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 153 gccaagctcgccggcaagcgcttccgcc 180
           |||||| ||||||||||| |||||||||
Sbjct: 464 gccaagttcgccggcaagagcttccgcc 437



to top

>emb|BX044684.1|CNS096N4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC18CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 589 tcgacatcttcaccggcaag 570



to top

>emb|BX044683.1|CNS096N3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1067

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 456 tcgacatcttcaccggcaag 475



to top

>emb|BX036938.1|CNS090NY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 299

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 153 gccaagctcgccggcaagcgcttccgcc 180
           |||||| ||||||||||| |||||||||
Sbjct: 256 gccaagttcgccggcaagagcttccgcc 229



to top

>emb|BX036809.1|CNS090KD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 153 gccaagctcgccggcaagcgcttccgcc 180
           |||||| ||||||||||| |||||||||
Sbjct: 480 gccaagttcgccggcaagagcttccgcc 453



to top

>emb|BX034667.1|CNS08YWV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 597 tcgacatcttcaccggcaag 578



to top

>emb|BX034666.1|CNS08YWU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 481 tcgacatcttcaccggcaag 500



to top

>emb|BX033329.1|CNS08XVP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 715 tcgacatcttcaccggcaag 696



to top

>emb|BX033328.1|CNS08XVO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1049

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 489 tcgacatcttcaccggcaag 508



to top

>emb|BX030845.1|CNS08VYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 691 tcgacatcttcaccggcaag 672



to top

>emb|BX030844.1|CNS08VYO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 521 tcgacatcttcaccggcaag 540



to top

>emb|BX029157.1|CNS08UNT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 443

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 327 tcgacatcttcaccggcaag 308



to top

>emb|BX029156.1|CNS08UNS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 484 tcgacatcttcaccggcaag 503



to top

>emb|BX027684.1|CNS08TIW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 153 gccaagctcgccggcaagcgcttccgcc 180
           |||||| ||||||||||| |||||||||
Sbjct: 502 gccaagttcgccggcaagagcttccgcc 475



to top

>emb|BX026573.1|CNS08SO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA4DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 692 tcgacatcttcaccggcaag 673



to top

>emb|BX026572.1|CNS08SO0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 490 tcgacatcttcaccggcaag 509



to top

>emb|BX025408.1|CNS08RRO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 474 tcgacatcttcaccggcaag 493



to top

>emb|BX024323.1|CNS08QXJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 492 tcgacatcttcaccggcaag 511



to top

>emb|BX023872.1|CNS08QL0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 491 tcgacatcttcaccggcaag 510



to top

>emb|BX021457.1|CNS08OPX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 686 tcgacatcttcaccggcaag 667



to top

>emb|BX021456.1|CNS08OPW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1090

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 543 tcgacatcttcaccggcaag 562



to top

>emb|BX017857.1|CNS08LXX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 473 tcgacatcttcaccggcaag 492



to top

>emb|BX018286.1|CNS08M9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 611

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 570 tcgacatcttcaccggcaag 551



to top

>emb|BX018285.1|CNS08M9T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 627

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 493 tcgacatcttcaccggcaag 512



to top

>emb|BX017607.1|CNS08LQZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 525 tcgacatcttcaccggcaag 544



to top

>emb|BX015877.1|CNS08KEX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 692

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 539 tcgacatcttcaccggcaag 520



to top

>emb|BX015876.1|CNS08KEW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 520 tcgacatcttcaccggcaag 539



to top

>emb|BX015847.1|CNS08KE3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 449 tcgacatcttcaccggcaag 468



to top

>emb|BX013968.1|CNS08IXW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 153 gccaagctcgccggcaagcgcttccgcc 180
           |||||| ||||||||||| |||||||||
Sbjct: 475 gccaagttcgccggcaagagcttccgcc 448



to top

>emb|BX012987.1|CNS08I6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 472 tcgacatcttcaccggcaag 491



to top

>emb|BX009423.1|CNS08FFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 677 tcgacatcttcaccggcaag 658



to top

>emb|BX009422.1|CNS08FFM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1026

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 515 tcgacatcttcaccggcaag 534



to top

>emb|BX009321.1|CNS08FCT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1046

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 452 tcgacatcttcaccggcaag 471



to top

>emb|BX008798.1|CNS08EYA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA14BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 702 tcgacatcttcaccggcaag 683



to top

>emb|BX008797.1|CNS08EY9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 475 tcgacatcttcaccggcaag 494



to top

>emb|BX008255.1|CNS08EJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 599 tcgacatcttcaccggcaag 580



to top

>emb|BX008254.1|CNS08EJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 483 tcgacatcttcaccggcaag 502



to top

>emb|BX006970.1|CNS08DJI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 687 tcgacatcttcaccggcaag 668



to top

>emb|BX006969.1|CNS08DJH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 481 tcgacatcttcaccggcaag 500



to top

>emb|BX005839.1|CNS08CO3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 691 tcgacatcttcaccggcaag 672



to top

>emb|BX005838.1|CNS08CO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 460 tcgacatcttcaccggcaag 479



to top

>emb|BX842573.1| Mycobacterium tuberculosis H37Rv complete genome; segment 2/13
          Length = 342416

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    gccgcggcggtgctggccat 145
              ||||||||||||||||||||
Sbjct: 313586 gccgcggcggtgctggccat 313567



to top

>emb|BX572607.1| Rhodopseudomonas palustris CGA009 complete genome; segment 15/16
          Length = 345012

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 334    ccgagctcgccaaggaggtc 353
              ||||||||||||||||||||
Sbjct: 307257 ccgagctcgccaaggaggtc 307238



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 157     agctcgccggcaagcgcttc 176
               ||||||||||||||||||||
Sbjct: 2655242 agctcgccggcaagcgcttc 2655223



to top

>emb|BX248335.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 2/14
          Length = 324050

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 126    gccgcggcggtgctggccat 145
              ||||||||||||||||||||
Sbjct: 313736 gccgcggcggtgctggccat 313717



to top

>emb|AL136880.1|HSM801848 Homo sapiens mRNA; cDNA DKFZp434A196 (from clone DKFZp434A196)
          Length = 3542

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 533  ggaggaggaggcccggctgg 552
            ||||||||||||||||||||
Sbjct: 2499 ggaggaggaggcccggctgg 2518



to top

>emb|AL035288.1|HS163M094 H.sapiens gene from PAC 163M9, similar to rat Espin gene, partial cds
          Length = 2015

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 533  ggaggaggaggcccggctgg 552
            ||||||||||||||||||||
Sbjct: 1941 ggaggaggaggcccggctgg 1960



to top

>emb|AL596103.22| Mouse DNA sequence from clone RP23-309E16 on chromosome 11 Contains the
              P4ha2 gene for procollagen-proline 2-oxoglutarate
              4-dioxygenase (proline 4-hydroxylase) alpha II polypeptide,
              a novel pseudogene, two novel genes, a diazepam binding
              inhibitor (Dbi) pseudogene, the Csf2 gene for colony
              stimulating factor 2 (granulocyte-macrophage), the Il3 gene
              for interleukin 3 and a CpG island, complete sequence
          Length = 199500

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 39     cacacaggcacaggcacagg 58
              ||||||||||||||||||||
Sbjct: 141915 cacacaggcacaggcacagg 141896



to top

>emb|AL954256.1| Pan troglodytes chromosome 22 clone PTB-129I16 map 22q22.3, complete
              sequence
          Length = 180777

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 37     gacacacaggcacaggcaca 56
              ||||||||||||||||||||
Sbjct: 146480 gacacacaggcacaggcaca 146499



to top

>gb|AC154796.2| Mus musculus BAC clone RP24-490B17 from chromosome 17, complete
             sequence
          Length = 161075

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    gacacacaggcacaggcaca 56
             ||||||||||||||||||||
Sbjct: 25967 gacacacaggcacaggcaca 25948



to top

>dbj|AB110205.1| Oryza sativa (japonica cultivar-group) mRNA for hypothetical
           protein, complete cds, clone: pBSK-OsNMCP1bEN31
          Length = 2986

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 525 gtggggtgggaggaggaggc 544
           ||||||||||||||||||||
Sbjct: 34  gtggggtgggaggaggaggc 53



to top

>gb|AE005954.1| Caulobacter crescentus CB15 section 280 of 359 of the complete genome
          Length = 10098

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 128  cgcggcggtgctggccatcg 147
            ||||||||||||||||||||
Sbjct: 2128 cgcggcggtgctggccatcg 2109



to top

>dbj|AB226196.1| Aspergillus oryzae cDNA, contig sequence: AoEST3055
          Length = 915

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 tcgacatcttcaccggcaag 422
           ||||||||||||||||||||
Sbjct: 321 tcgacatcttcaccggcaag 340



to top

>gb|AC084429.5| Mus Musculus Chromosome 2 Clone RP23-291P1, complete sequence
          Length = 181684

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 39   cacacaggcacaggcacagg 58
            ||||||||||||||||||||
Sbjct: 1503 cacacaggcacaggcacagg 1484


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,865,113
Number of Sequences: 3902068
Number of extensions: 5865113
Number of successful extensions: 122228
Number of sequences better than 10.0: 320
Number of HSP's better than 10.0 without gapping: 320
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 117014
Number of HSP's gapped (non-prelim): 5193
length of query: 603
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 580
effective length of database: 17,143,297,704
effective search space: 9943112668320
effective search space used: 9943112668320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top