ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart56b02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF542188.1| Triticum aestivum cyc07 mRNA, complete cds 983 0.0
2gb|AY290725.1| Triticum aestivum ribosomal protein S3a-like mRNA... 922 0.0
3dbj|D26060.1|RICT151 Oryza sativa mRNA for cyc07, complete cds 333 4e-88
4dbj|AK104243.1| Oryza sativa (japonica cultivar-group) cDNA clon... 333 4e-88
5dbj|AK069251.1| Oryza sativa (japonica cultivar-group) cDNA clon... 333 4e-88
6dbj|AK104699.1| Oryza sativa (japonica cultivar-group) cDNA clon... 319 6e-84
7ref|XM_464995.1| Oryza sativa (japonica cultivar-group), mRNA 313 4e-82
8ref|XM_506775.1| PREDICTED Oryza sativa (japonica cultivar-group... 313 4e-82
9dbj|AK099131.1| Oryza sativa (japonica cultivar-group) cDNA clon... 305 9e-80
10dbj|AK059647.1| Oryza sativa (japonica cultivar-group) cDNA clon... 305 9e-80
11dbj|AK071037.1| Oryza sativa (japonica cultivar-group) cDNA clon... 301 1e-78
12gb|AF052503.1|AF052503 Oryza sativa S-phase-specific ribosomal p... 276 8e-71
13gb|BT016390.1| Zea mays clone Contig223 mRNA sequence 264 3e-67
14gb|AY109383.1| Zea mays CL7224_1 mRNA sequence 161 3e-36
15gb|AY849388.1| Vitis vinifera cultivar Riesling cyc07 mRNA, part... 159 1e-35
16gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, ... 149 1e-32
17ref|NM_119633.2| Arabidopsis thaliana structural constituent of ... 139 1e-29
18gb|AY062500.1| Arabidopsis thaliana Putative S-phase-specific ri... 139 1e-29
19emb|BX828268.1|CNS0A2YE Arabidopsis thaliana Full-length cDNA Co... 139 1e-29
20gb|BT000122.1| Arabidopsis thaliana Putative S-phase-specific ri... 137 5e-29
21gb|DQ164221.1| Nicotiana tabacum cyc07 mRNA, complete cds 137 5e-29
22emb|BX826401.1|CNS0A38P Arabidopsis thaliana Full-length cDNA Co... 137 5e-29
23emb|AJ001342.1|ATCYC07 Arabidopsis thaliana mRNA for S-phase-spe... 137 5e-29
24emb|Z25769.1|BRSPSG B.rapa mRNA for S phase specific gene 131 3e-27
25gb|DQ268835.1| Solanum tuberosum clone 115A11 cyc07-like protein... 131 3e-27
26gb|DQ252490.1| Solanum tuberosum clone 059D09 cyc07-like mRNA, c... 131 3e-27
27gb|L23553.1|BRRSPSK Brassica rapa S-phase-specific (BIS289) mRNA... 131 3e-27
28gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 129 1e-26
29gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare... 129 1e-26
30gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare str... 129 1e-26
31dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
32dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
33gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 129 1e-26
34emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa... 129 1e-26
35gb|AF479043.1| Triticum aestivum 40S ribosomal protein mRNA, par... 127 5e-26
36emb|AJ515028.1|CAR515028 Cicer arietinum mRNA for ribosomal prot... 125 2e-25
37gb|DQ445133.1| Striga asiatica isolate St513 S phase protein mRN... 123 7e-25
38dbj|AB029635.1| Daucus carota mRNA for cyc07, complete cds 119 1e-23
39gb|DQ241862.1| Solanum tuberosum clone 027B03 40S ribosomal prot... 117 4e-23
40gb|AY643842.1|AY643842S1 Hordeum vulgare subsp. vulgare clone BA... 113 7e-22
41gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones B... 111 3e-21
42gb|AF093109.1| Tortula ruralis ribosomal protein S3 (rps3) mRNA,... 105 2e-19
43gb|DQ268856.1| Solanum tuberosum clone 174A02 cyc07-like protein... 94 6e-16
44gb|DQ268849.1| Solanum tuberosum clone 155F06 cyc07-like protein... 94 6e-16
45gb|DQ252485.1| Solanum tuberosum clone 048H05 cyc07-like mRNA, c... 94 6e-16
46dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 90 1e-14
47dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic D... 90 1e-14
48dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic D... 90 1e-14
49dbj|AB023436.1| Hordeum vulgare DNA, down stream region of HvNAS... 84 6e-13
50gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete s... 82 2e-12
51gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete seq... 82 2e-12
52gb|BT019079.1| Zea mays clone Contig661.F mRNA sequence 80 9e-12
53dbj|AB116637.1| Lentinula edodes Le. cyc07 mRNA for putative S-p... 78 4e-11
54gb|DQ268842.1| Solanum tuberosum clone 135C12 40S ribosomal prot... 76 1e-10
55gb|L31645.1|HNNSPSP Helianthus annuus ribosomal protein S3a mRNA... 76 1e-10
56ref|XM_774945.1| PREDICTED: Strongylocentrotus purpuratus simila... 74 6e-10
57ref|XM_796644.1| PREDICTED: Strongylocentrotus purpuratus simila... 74 6e-10
58ref|XM_785062.1| PREDICTED: Strongylocentrotus purpuratus simila... 74 6e-10
59emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 74 6e-10
60emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, ... 74 6e-10
61emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BA... 74 6e-10
62ref|NM_111356.3| Arabidopsis thaliana structural constituent of ... 72 2e-09
63gb|AY081585.1| Arabidopsis thaliana putative 40S ribosomal prote... 72 2e-09
64gb|AY062796.1| Arabidopsis thaliana putative 40S ribosomal prote... 72 2e-09
65emb|BX824488.1|CNS0A5KP Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
66gb|AY085787.1| Arabidopsis thaliana clone 18185 mRNA, complete s... 72 2e-09
67dbj|D01058.1|CTRCYC07 Catharanthus roseus cyc07 mRNA, complete cds 72 2e-09
68gb|BT012853.1| Lycopersicon esculentum clone 113933F, mRNA sequence 68 4e-08
69emb|BX822077.1|CNS0A7LX Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
70gb|AY857460.1| Suberites domuncula S3a mRNA, complete cds 58 3e-05
71ref|XM_568980.1| Cryptococcus neoformans var. neoformans JEC21 4... 56 1e-04
72dbj|D26058.1|CTRCYC07A Catharanthus roseus cyc07 gene, exon1-7, ... 56 1e-04
73ref|XM_420443.1| PREDICTED: Gallus gallus similar to 40S ribosom... 52 0.002
74emb|AJ720257.1| Gallus gallus partial mRNA for hypothetical prot... 52 0.002
75gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J... 52 0.002
76gb|AF042107.1|AF042107 Eimeria tenella ribosomal protein S3a mRN... 52 0.002
77emb|X68555.1|ACKRPA A.californica KRP-A gene 52 0.002
78gb|AY850276.1| Periplaneta americana Parcxpwex01 mRNA, complete cds 52 0.002
79gb|BC058483.1| Rattus norvegicus ribosomal protein S3a, mRNA (cD... 50 0.008
80ref|NM_017153.1| Rattus norvegicus ribosomal protein S3a (Rps3a)... 50 0.008
81gb|AY151152.1| Ilyanassa obsoleta 40S ribosomal protein-like pro... 50 0.008
82emb|X75161.1|RNRNAS3A R.norvegicus (Sprague-Dawley) mRNA for rib... 50 0.008
83gb|BC106115.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 46 0.13
84gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosom... 46 0.13
85gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, compl... 46 0.13
86gb|BC084675.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 46 0.13
87gb|BC083338.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 46 0.13
88ref|XM_871858.1| PREDICTED: Bos taurus similar to ribosomal prot... 46 0.13
89ref|XM_863937.1| PREDICTED: Bos taurus similar to ribosomal prot... 46 0.13
90ref|XM_871665.1| PREDICTED: Bos taurus similar to ribosomal prot... 46 0.13
91ref|XM_871576.1| PREDICTED: Bos taurus similar to ribosomal prot... 46 0.13
92ref|XM_872846.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
93ref|XM_872754.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
94ref|XM_593124.2| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
95ref|XM_872539.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
96ref|XM_872447.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 46 0.13
97gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosom... 46 0.13
98ref|NM_016959.2| Mus musculus ribosomal protein S3a (Rps3a), mRNA 46 0.13
99ref|XM_974769.1| PREDICTED: Mus musculus similar to 40S ribosoma... 46 0.13
100ref|XM_994545.1| PREDICTED: Mus musculus similar to 40S ribosoma... 46 0.13
101ref|XR_002919.1| PREDICTED: Mus musculus similar to 40S ribosoma... 46 0.13
102ref|XR_002253.1| PREDICTED: Mus musculus similar to 40S ribosoma... 46 0.13
103ref|XR_005031.1| PREDICTED: Mus musculus similar to 40S ribosoma... 46 0.13
104emb|BX039677.1|CNS092S1 Single read from an extremity of a full-... 46 0.13
105emb|Z83368.1|MMRPS3A M.musculus RPS3a gene 46 0.13
106gb|BC081451.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 46 0.13
107dbj|AK146304.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 46 0.13
108dbj|AK135318.1| Mus musculus 12 days embryo male wolffian duct i... 46 0.13
109dbj|AK151982.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.13
110dbj|AK150814.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.13
111dbj|AK150796.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.13
112dbj|AK148513.1| Mus musculus adult pancreas islet cells cDNA, RI... 46 0.13
113dbj|AK151429.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.13
114dbj|AK150441.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.13
115dbj|AK166713.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 46 0.13
116dbj|AK153480.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 46 0.13
117dbj|AK167562.1| Mus musculus 11 days pregnant adult female place... 46 0.13
118dbj|AK167512.1| Mus musculus 11 days pregnant adult female place... 46 0.13
119dbj|AK159777.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 46 0.13
120dbj|AK168240.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 46 0.13
121dbj|AK010605.1| Mus musculus ES cells cDNA, RIKEN full-length en... 46 0.13
122dbj|AK003158.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 46 0.13
123dbj|AK088113.1| Mus musculus 2 days neonate thymus thymic cells ... 46 0.13
124dbj|AK050610.1| Mus musculus 2 days neonate thymus thymic cells ... 46 0.13
125gb|BC039659.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 46 0.13
126dbj|AK012345.1| Mus musculus 11 days embryo whole body cDNA, RIK... 46 0.13
127gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, com... 46 0.13
128dbj|AK196258.1| Mus musculus cDNA, clone:Y1G0121E15, strand:minu... 46 0.13
129emb|CT571277.10| Mouse DNA sequence from clone RP24-327L5 on chr... 46 0.13
130emb|AL691416.9| Mouse DNA sequence from clone RP23-110I8 on chro... 46 0.13
131ref|XM_862563.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
132ref|XM_862552.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
133ref|XM_862541.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
134ref|XM_862533.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
135ref|XM_862525.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
136ref|XM_862515.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
137ref|XM_862504.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
138ref|XM_862496.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
139ref|XM_534275.2| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
140ref|XM_862466.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
141ref|XM_862454.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
142ref|XM_862446.1| PREDICTED: Canis familiaris Ribosomal protein S... 44 0.52
143ref|XM_860742.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
144ref|XM_860726.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
145ref|XM_860710.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
146ref|XM_860701.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
147ref|XM_860686.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
148ref|XM_847366.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
149ref|XM_860652.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
150ref|XM_856691.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
151ref|XM_856663.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
152ref|XM_856635.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
153ref|XM_856605.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
154ref|XM_856573.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
155ref|XM_856546.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
156ref|XM_856515.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
157ref|XM_856484.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
158ref|XM_856455.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
159ref|XM_845382.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
160ref|XM_856398.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
161ref|XM_535263.2| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
162ref|XM_855284.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
163ref|XM_855250.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
164ref|XM_855221.1| PREDICTED: Canis familiaris similar to ribosoma... 44 0.52
165gb|AC114663.8| Mus musculus chromosome 1, clone RP24-172O22, com... 42 2.1
166gb|AY596294.1| Haloarcula marismortui ATCC 43049 plasmid pNG500,... 42 2.1
167gb|AC158967.5| Mus musculus chromosome 1, clone RP23-39N17, comp... 42 2.1
168ref|XM_458876.1| Debaryomyces hansenii CBS767 hypothetical prote... 42 2.1
169ref|XM_950881.1| Neurospora crassa OR74A hypothetical protein (N... 42 2.1
170ref|XM_327890.1| Neurospora crassa OR74A hypothetical protein (N... 42 2.1
171ref|XM_534831.2| PREDICTED: Canis familiaris similar to ribosoma... 42 2.1
172ref|XM_748992.1| Aspergillus fumigatus Af293 ribosomal protein S... 42 2.1
173ref|XM_446571.1| Candida glabrata CBS138, CAGL0G04851g partial mRNA 42 2.1
174emb|Z32681.1|CEF56F3 Caenorhabditis elegans Cosmid F56F3, comple... 42 2.1
175gb|BC047260.1| Xenopus laevis ribosomal protein S3a, mRNA (cDNA ... 42 2.1
176ref|NM_001008074.1| Xenopus tropicalis rps3a protein (rps3a), mRNA 42 2.1
177gb|BC080969.1| Xenopus tropicalis rps3a protein, mRNA (cDNA clon... 42 2.1
178emb|BX067685.1|CNS09OE1 Single read from an extremity of a full-... 42 2.1
179emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS... 42 2.1
180emb|CR380953.1| Candida glabrata strain CBS138 chromosome G comp... 42 2.1
181emb|BX294022.1|NCB11C21 Neurospora crassa DNA linkage group V BA... 42 2.1
182dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009 42 2.1
183gb|DQ066297.1| Ixodes scapularis isolate is-all-378 40S ribosoma... 42 2.1
184gb|AF379639.1|AF379639 Heliothis virescens ribosomal protein S3a... 42 2.1
185ref|NM_065509.3| Caenorhabditis elegans Ribosomal Protein, Small... 42 2.1
186ref|XM_392119.2| PREDICTED: Apis mellifera similar to Phosphatid... 42 2.1
187gb|AF429977.1| Spodoptera frugiperda ribosomal protein S3A mRNA,... 42 2.1
188gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 2.1
189gb|AF056328.1|AF056328 Oryzias latipes V-Fos transformation effe... 42 2.1
190emb|CR760859.2| Xenopus tropicalis finished cDNA, clone TTpA010n05 42 2.1
191gb|AC113456.9| Mus musculus chromosome 1, clone RP23-257E16, com... 42 2.1
192gb|M84716.1|RATVFOSPR R.norvegicus putative v-fos transformation... 42 2.1
193ref|XM_475184.1| Oryza sativa (japonica cultivar-group), predic... 40 8.2
194gb|DQ214673.1| Taeniopygia guttata clone 0061P0008B04 ribosomal ... 40 8.2
195gb|DQ214671.1| Taeniopygia guttata clone 0058P0045E12 ribosomal ... 40 8.2
196gb|DQ214668.1| Taeniopygia guttata clone 0063P0025A12 ribosomal ... 40 8.2
197ref|XM_473036.1| Oryza sativa (japonica cultivar-group), predic... 40 8.2
198gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, co... 40 8.2
199gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 40 8.2
200ref|XM_612939.2| PREDICTED: Bos taurus similar to catenin (cadhe... 40 8.2
201gb|AC105773.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.2
202gb|AC119954.12| Mus musculus chromosome 1, clone RP24-450P2, com... 40 8.2
203ref|XM_875949.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 40 8.2
204ref|XM_875867.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 40 8.2
205ref|XM_875801.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 40 8.2
206ref|XM_875730.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 40 8.2
207ref|XM_875654.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 40 8.2
208ref|XM_875583.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 40 8.2
209ref|XM_865235.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 40 8.2
210gb|AC140314.2| Mus musculus BAC clone RP23-395L3 from chromosome... 40 8.2
211gb|AC160529.6| Mus musculus chromosome 1, clone RP24-141F19, com... 40 8.2
212gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 40 8.2
213gb|AC126433.3| Mus musculus BAC clone RP24-468I23 from chromosom... 40 8.2
214gb|AC109612.22| Mus musculus strain C57BL/6J clone rp23-37i3 map... 40 8.2
215ref|XM_505043.1| Yarrowia lipolytica CLIB122, YALI0F05676g predi... 40 8.2
216ref|XM_778340.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 8.2
217gb|AC104783.3| Homo sapiens BAC clone RP11-36G9 from 4, complete... 40 8.2
218dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
219dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.2
220emb|AJ563455.1|CGI563455 Crassostrea gigas partial mRNA for ribo... 40 8.2
221dbj|AK109382.2| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.2
222dbj|AK069136.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.2
223emb|AJ249414.1|MMU249414 Mus musculus partial PI3Kgamma gene for... 40 8.2
224dbj|AB092486.1| Gallus gallus gene for iron-responsive element-b... 40 8.2
225emb|AL845344.4|CNS08CB6 Oryza sativa chromosome 12, . BAC OSJNBb... 40 8.2
226emb|AL606627.3|OSJN00052 Oryza sativa genomic DNA, chromosome 4,... 40 8.2
227emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 8.2

>gb|AF542188.1| Triticum aestivum cyc07 mRNA, complete cds
          Length = 820

 Score =  983 bits (496), Expect = 0.0
 Identities = 544/560 (97%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 31  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 90

                                                                       
Query: 101 atctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcaccaagaagcag 160
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 91  atctccaaggggaggaagggaagcaagaagaaggccgtcgatccgttcaccaagaagcag 150

                                                                       
Query: 161 tggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccctcgtg 220
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 151 tggtatgacatcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgtg 210

                                                                       
Query: 221 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 280
           |||||||| |||||||||||||||||||||||||| ||||||||| ||||||| ||||||
Sbjct: 211 tccaggacgcagggtaccaagattgcctcagagggtctgaagcacagggtgttcgaagta 270

                                                                       
Query: 281 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 340
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 271 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 330

                                                                       
Query: 341 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 400
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 331 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggacttcaccactgac 390

                                                                       
Query: 401 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
           |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 391 aagctcaggtctcttgtgaggaagtggcagacactcattgaggctcatgtggatgtgaag 450

                                                                       
Query: 461 accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 520
           ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 451 accactgacaactacatgctccgcatgttcgccattggcttcaccaagagacgcccaaac 510

                                                                       
Query: 521 caggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatg 580
           ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 511 caggtgaagcgcacttgctatgcccaagcaagtcagatcagacagatccgccgcaagatg 570

                               
Query: 581 gttgagatcatggtcaacca 600
           ||||||||||||||||||||
Sbjct: 571 gttgagatcatggtcaacca 590



to top

>gb|AY290725.1| Triticum aestivum ribosomal protein S3a-like mRNA, partial sequence
          Length = 885

 Score =  922 bits (465), Expect = 0.0
 Identities = 537/561 (95%), Gaps = 1/561 (0%)
 Strand = Plus / Plus

                                                                       
Query: 41  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 32  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 91

                                                                       
Query: 101 atctccaagggg-aggaagggtagcaagaagaaggccgtggatccgttcaccaagaagca 159
           |||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 92  atctccaagggggaggaagggaagcaagaagaaggccgtcgatccgttcaccaagaagca 151

                                                                       
Query: 160 gtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccctcgt 219
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 152 gtggtatgacatcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgt 211

                                                                       
Query: 220 gtccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagt 279
           ||||||||| |||||||||||||||| ||||||||| |||||||||  |||||| |||||
Sbjct: 212 gtccaggacgcagggtaccaagattgnctcagagggtctgaagcacanggtgttcgaagt 271

                                                                       
Query: 280 atctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgc 339
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 272 atctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgc 331

                                                                       
Query: 340 tgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactga 399
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 332 tgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggacttcaccactga 391

                                                                       
Query: 400 caagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaa 459
           |||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 392 caagctcaagtctcttgtgaggaagtggcagacactcattgaggctcatgtggatgtgaa 451

                                                                       
Query: 460 gaccactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaa 519
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 452 gaccactgacaactacatgctccgcatgttcgccattggcttcaccaagagacgcccaaa 511

                                                                       
Query: 520 ccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagat 579
           |||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 512 ccaggtgaagcgcacttgctatgcccaagcnagtcagatcagacagatccgccgcaagat 571

                                
Query: 580 ggttgagatcatggtcaacca 600
           || ||||||  ||||||||||
Sbjct: 572 ggntgagatattggtcaacca 592



to top

>dbj|D26060.1|RICT151 Oryza sativa mRNA for cyc07, complete cds
          Length = 1065

 Score =  333 bits (168), Expect = 4e-88
 Identities = 444/536 (82%)
 Strand = Plus / Plus

                                                                       
Query: 65  gcagcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagc 124
           |||||| || ||||||| || || | ||||||||||||||||||||||| ||||||   |
Sbjct: 84  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 143

                                                                       
Query: 125 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 184
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 144 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 203

                                                                       
Query: 185 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 244
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 204 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 263

                                                                       
Query: 245 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 304
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 264 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 323

                                                                       
Query: 305 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 364
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 324 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 383

                                                                       
Query: 365 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 424
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 384 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 443

                                                                       
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 484
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 444 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 503

                                                                       
Query: 485 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 544
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 504 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 563

                                                                   
Query: 545 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaacca 600
           ||||| ||||||||||||||||| || || ||||||||||| ||||||| ||||||
Sbjct: 564 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatggccaacca 619



to top

>dbj|AK104243.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-D02, full
           insert sequence
          Length = 1032

 Score =  333 bits (168), Expect = 4e-88
 Identities = 444/536 (82%)
 Strand = Plus / Plus

                                                                       
Query: 65  gcagcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagc 124
           |||||| || ||||||| || || | ||||||||||||||||||||||| ||||||   |
Sbjct: 60  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 119

                                                                       
Query: 125 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 184
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 120 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 179

                                                                       
Query: 185 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 244
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 180 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 239

                                                                       
Query: 245 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 304
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 240 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 299

                                                                       
Query: 305 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 364
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 300 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 359

                                                                       
Query: 365 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 424
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 360 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 419

                                                                       
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 484
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 420 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 479

                                                                       
Query: 485 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 544
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 480 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 539

                                                                   
Query: 545 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaacca 600
           ||||| ||||||||||||||||| || || ||||||||||| ||||||| ||||||
Sbjct: 540 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatggccaacca 595



to top

>dbj|AK069251.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023013H23, full
           insert sequence
          Length = 1097

 Score =  333 bits (168), Expect = 4e-88
 Identities = 444/536 (82%)
 Strand = Plus / Plus

                                                                       
Query: 65  gcagcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagc 124
           |||||| || ||||||| || || | ||||||||||||||||||||||| ||||||   |
Sbjct: 61  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 120

                                                                       
Query: 125 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 184
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 121 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 180

                                                                       
Query: 185 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 244
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 181 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 240

                                                                       
Query: 245 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 304
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 241 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 300

                                                                       
Query: 305 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 364
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 301 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 360

                                                                       
Query: 365 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 424
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 361 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 420

                                                                       
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 484
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 421 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 480

                                                                       
Query: 485 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 544
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 481 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 540

                                                                   
Query: 545 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaacca 600
           ||||| ||||||||||||||||| || || ||||||||||| ||||||| ||||||
Sbjct: 541 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatggccaacca 596



to top

>dbj|AK104699.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-C03, full
           insert sequence
          Length = 942

 Score =  319 bits (161), Expect = 6e-84
 Identities = 419/505 (82%)
 Strand = Plus / Plus

                                                                       
Query: 96  agcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcaccaaga 155
           |||||||||||||||||| ||||||   |||||||||| |||| ||||| ||  | ||||
Sbjct: 1   agcgcatctccaaggggaagaagggatccaagaagaagaccgtcgatccctttgctaaga 60

                                                                       
Query: 156 agcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccc 215
           || | |||||||| |||||||| |||  | | ||||     || ||| ||||||||||||
Sbjct: 61  aggactggtatgatatcaaggccccgtcggtgttcaatgtgcggaacatcggcaagaccc 120

                                                                       
Query: 216 tcgtgtccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttg 275
           |||||||||||||||||||||| |||||||| || |||||||| |||||  | |||||||
Sbjct: 121 tcgtgtccaggacacagggtacaaagattgcttctgagggcctaaagcatagagtgtttg 180

                                                                       
Query: 276 aagtatctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactcc 335
           | || ||  |||||||||| |||||||||||||| ||||| ||||||||||||||||| |
Sbjct: 181 aggtctccttagctgatctccagaacgatgaggatcaggcgtacaggaagatcagacttc 240

                                                                       
Query: 336 gtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcacca 395
           ||||||||||||||||||||| ||| || ||||| ||||| |||||||||   || || |
Sbjct: 241 gtgctgaggatgtgcaagggaagaacgtgctcaccaacttttggggcatgtcgtttacta 300

                                                                       
Query: 396 ctgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatg 455
           | || |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||
Sbjct: 301 ccgataagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatg 360

                                                                       
Query: 456 tgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcc 515
           | || ||||| |||   |||||||| ||  ||||    || |||||||||||| | || |
Sbjct: 361 tcaaaaccacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggc 420

                                                                       
Query: 516 caaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccgga 575
           | |||||||| ||| | ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 421 ctaaccaggtgaagaggacttgctatgctcaagcgagtcagatcagacagattcgtcgca 480

                                    
Query: 576 agatggttgagatcatggtcaacca 600
           |||||||||| ||||||| ||||||
Sbjct: 481 agatggttgaaatcatggccaacca 505



to top

>ref|XM_464995.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1063

 Score =  313 bits (158), Expect = 4e-82
 Identities = 434/526 (82%)
 Strand = Plus / Plus

                                                                       
Query: 75  ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 134
           ||||||| || |||| ||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 34  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 93

                                                                       
Query: 135 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 194
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 94  ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 153

                                                                       
Query: 195 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 254
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 154 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 213

                                                                       
Query: 255 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 314
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 214 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 273

                                                                       
Query: 315 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 374
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 274 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 333

                                                                       
Query: 375 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 434
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 334 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 393

                                                                       
Query: 435 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 494
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 394 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 453

                                                                       
Query: 495 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 554
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 454 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 513

                                                         
Query: 555 agatcagacagatccgccggaagatggttgagatcatggtcaacca 600
           ||||| | ||||||||||||||||||||||||||||||| ||||||
Sbjct: 514 agatccggcagatccgccggaagatggttgagatcatggccaacca 559



to top

>ref|XM_506775.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1115_D03.49
           mRNA
          Length = 1171

 Score =  313 bits (158), Expect = 4e-82
 Identities = 434/526 (82%)
 Strand = Plus / Plus

                                                                       
Query: 75  ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 134
           ||||||| || |||| ||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 70  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 129

                                                                       
Query: 135 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 194
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 130 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 189

                                                                       
Query: 195 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 254
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 190 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 249

                                                                       
Query: 255 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 314
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 250 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 309

                                                                       
Query: 315 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 374
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 310 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 369

                                                                       
Query: 375 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 434
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 370 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 429

                                                                       
Query: 435 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 494
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 430 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 489

                                                                       
Query: 495 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 554
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 490 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 549

                                                         
Query: 555 agatcagacagatccgccggaagatggttgagatcatggtcaacca 600
           ||||| | ||||||||||||||||||||||||||||||| ||||||
Sbjct: 550 agatccggcagatccgccggaagatggttgagatcatggccaacca 595



to top

>dbj|AK099131.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023048M05, full
           insert sequence
          Length = 1063

 Score =  305 bits (154), Expect = 9e-80
 Identities = 433/526 (82%)
 Strand = Plus / Plus

                                                                       
Query: 75  ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 134
           ||||||| || |||| |||| || | ||||||||||| |||||||| |||||||||||| 
Sbjct: 34  ccatggccgtgggcaagaacgagaggatctccaagggcaggaagggcagcaagaagaaga 93

                                                                       
Query: 135 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 194
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 94  ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 153

                                                                       
Query: 195 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 254
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 154 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 213

                                                                       
Query: 255 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 314
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 214 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 273

                                                                       
Query: 315 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 374
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 274 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 333

                                                                       
Query: 375 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 434
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 334 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 393

                                                                       
Query: 435 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 494
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 394 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 453

                                                                       
Query: 495 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 554
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 454 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 513

                                                         
Query: 555 agatcagacagatccgccggaagatggttgagatcatggtcaacca 600
           ||||| | ||||||||||||||||||||||||||||||| ||||||
Sbjct: 514 agatccggcagatccgccggaagatggttgagatcatggccaacca 559



to top

>dbj|AK059647.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-C03, full
           insert sequence
          Length = 1171

 Score =  305 bits (154), Expect = 9e-80
 Identities = 433/526 (82%)
 Strand = Plus / Plus

                                                                       
Query: 75  ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 134
           ||||||| || |||| ||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 70  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 129

                                                                       
Query: 135 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 194
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 130 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 189

                                                                       
Query: 195 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 254
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 190 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 249

                                                                       
Query: 255 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 314
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 250 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 309

                                                                       
Query: 315 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 374
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 310 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 369

                                                                       
Query: 375 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 434
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 370 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 429

                                                                       
Query: 435 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 494
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 430 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 489

                                                                       
Query: 495 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 554
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 490 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 549

                                                         
Query: 555 agatcagacagatccgccggaagatggttgagatcatggtcaacca 600
           ||||| | ||||||| ||||||||||||||||||||||| ||||||
Sbjct: 550 agatccggcagatcctccggaagatggttgagatcatggccaacca 595



to top

>dbj|AK071037.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079A13, full
           insert sequence
          Length = 1118

 Score =  301 bits (152), Expect = 1e-78
 Identities = 440/536 (82%)
 Strand = Plus / Plus

                                                                       
Query: 65  gcagcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagc 124
           |||||| || ||||||| ||||||| ||||||||| ||||| ||||||| ||||||   |
Sbjct: 92  gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 151

                                                                       
Query: 125 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 184
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 152 aagaagaagaccgtcgatccttttgcgaagaaggattggtatgatatcaaggccccgtcg 211

                                                                       
Query: 185 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 244
            | |||| |    | |||||||| ||||| |||||||||||||||||||| || ||||||
Sbjct: 212 gtgttcaacgtgagaaacgtcgggaagacgctcgtgtccaggacacagggcacaaagatt 271

                                                                       
Query: 245 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 304
           || ||||||||||| |||||||| |||||||| || ||  | ||||||||||||||||||
Sbjct: 272 gcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcagaacgat 331

                                                                       
Query: 305 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 364
           ||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  ||||| 
Sbjct: 332 gaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaaatgtt 391

                                                                       
Query: 365 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 424
           || ||||||||||||||||||  |||||| || ||||||||||| ||  | || | ||| 
Sbjct: 392 cttacaaacttctggggcatgagtttcacgaccgacaagctcagatcattggtcaagaaa 451

                                                                       
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 484
           |||||||| || || ||||||||||| |||||  |||||||||| || |||||||| || 
Sbjct: 452 tggcagacgctaatagaggctcatgtggatgtagagaccactgataactacatgctgcgt 511

                                                                       
Query: 485 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 544
            | ||   | ||||||||||||||||  | ||||| || ||||| || || |||||||||
Sbjct: 512 ctcttctgcgttggcttcaccaagaggaggccaaatcaagtcaaacggacatgctatgct 571

                                                                   
Query: 545 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaacca 600
           |||||||| |||||  |||||||||| || |||||||| |||| |||||| |||||
Sbjct: 572 caagcaagccagattcgacagatccgtcgcaagatggtggagaccatggtgaacca 627



to top

>gb|AF052503.1|AF052503 Oryza sativa S-phase-specific ribosomal protein (RSPSP94) mRNA,
           complete cds
          Length = 1027

 Score =  276 bits (139), Expect = 8e-71
 Identities = 432/527 (81%), Gaps = 2/527 (0%)
 Strand = Plus / Plus

                                                                       
Query: 75  ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 134
           ||||||| || |||| ||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 31  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 90

                                                                       
Query: 135 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 194
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 91  ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 150

                                                                       
Query: 195 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 254
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 151 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 210

                                                                       
Query: 255 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 314
           | || ||||| || || |||||||| ||  | || ||||||| ||| || ||||| ||||
Sbjct: 211 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcggaatgacgaggatcagg 270

                                                                       
Query: 315 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 374
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 271 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 330

                                                                       
Query: 375 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 434
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 331 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 390

                                                                       
Query: 435 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 494
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 391 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 450

                                                                       
Query: 495 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 554
           |||| ||||||||| | |||||||| ||||| ||||| || || || |||| ||  || |
Sbjct: 451 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctc-aggtagcc 509

                                                          
Query: 555 agatcagacagat-ccgccggaagatggttgagatcatggtcaacca 600
           ||||| | ||||| |||||||||||||||||||||||||| ||||||
Sbjct: 510 agatccggcagatcccgccggaagatggttgagatcatggccaacca 556



to top

>gb|BT016390.1| Zea mays clone Contig223 mRNA sequence
          Length = 1104

 Score =  264 bits (133), Expect = 3e-67
 Identities = 433/533 (81%)
 Strand = Plus / Plus

                                                                       
Query: 68  gcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaag 127
           ||||| |||||||| ||||| | ||||||| | ||||||||||| | ||||||| |||||
Sbjct: 65  gcggcgaccatggctgtcggaaagaacaagaggatctccaagggaaagaagggtggcaag 124

                                                                       
Query: 128 aagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctc 187
           || ||| |||| || || ||| | |||||| | ||||||||||||||||| |||  | | 
Sbjct: 125 aaaaagaccgtcgaccctttctctaagaaggattggtatgacatcaaggcaccgtcggtg 184

                                                                       
Query: 188 ttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcc 247
           ||||     |||||| |||| ||||| ||||| ||||||||||||||||||| |||||| 
Sbjct: 185 ttcagtgtgcgcaacatcgggaagactctcgtatccaggacacagggtaccaggattgct 244

                                                                       
Query: 248 tcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgag 307
           || ||||| ||||||||| | || ||||| || |  |||||||||||||||  ||| |||
Sbjct: 245 tctgagggtctgaagcacagagtctttgaggtttgcctagctgatcttcagggcgacgag 304

                                                                       
Query: 308 gaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctc 367
           || || || |||||||| ||||| ||||||||||| |||||||| || | |||||| |||
Sbjct: 305 gatcaagcttacaggaaaatcaggctccgtgctgaagatgtgcagggcaggaatgtgctc 364

                                                                       
Query: 368 acaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtgg 427
           |||||||| ||||| ||| |||| |||||||| || || || || || |||| |||||||
Sbjct: 365 acaaacttttggggtatgaattttaccactgataaactgagatccctagtgaagaagtgg 424

                                                                       
Query: 428 cagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatg 487
           |||||  | || || || ||||| ||||| ||||| || ||||| |||||| | ||  ||
Sbjct: 425 cagacattaatcgaagcccatgttgatgtcaagacaaccgacaactacatgttgcgtttg 484

                                                                       
Query: 488 tttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaa 547
           ||   ||| |||||||||||||| ||||||||||| |||||| | || ||||||||||| 
Sbjct: 485 ttctgcatcggcttcaccaagaggcgcccaaaccaagtcaagagaacctgctatgctcag 544

                                                                
Query: 548 gcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaacca 600
           |||   |||||| | ||||||||||| |||||||||||||| ||| |||||||
Sbjct: 545 gcatcccagatccgtcagatccgccgaaagatggttgagattatgatcaacca 597



to top

>gb|AY109383.1| Zea mays CL7224_1 mRNA sequence
          Length = 1236

 Score =  161 bits (81), Expect = 3e-36
 Identities = 222/269 (82%)
 Strand = Plus / Minus

                                                                       
Query: 332 ctccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttc 391
           ||||||||||| ||||||||||| | |||||| ||||||||||| ||||| ||| |||| 
Sbjct: 866 ctccgtgctgaagatgtgcaaggcaggaatgtgctcacaaacttttggggtatgaatttt 807

                                                                       
Query: 392 accactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtc 451
           |||||||| || || || || || |||| ||||||||||||  | || || || ||||| 
Sbjct: 806 accactgataaactgagatccctagtgaagaagtggcagacattaatcgaagcccatgtt 747

                                                                       
Query: 452 gatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaagaga 511
           ||||| ||||| || ||||| |||||| | ||  ||||   ||| |||||||||||||| 
Sbjct: 746 gatgtcaagacaaccgacaactacatgttgcgtttgttctgcatcggcttcaccaagagg 687

                                                                       
Query: 512 cgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgc 571
           |||||||||||||||||| | || ||||||||||| |||   |||||| | |||||||||
Sbjct: 686 cgcccaaaccaggtcaagagaacctgctatgctcaggcatcccagatccgtcagatccgc 627

                                        
Query: 572 cggaagatggttgagatcatggtcaacca 600
           || |||||||||||||| ||| |||||||
Sbjct: 626 cgtaagatggttgagattatgatcaacca 598



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 159/198 (80%)
 Strand = Plus / Minus

                                                                        
Query: 68   gcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaag 127
            ||||| |||||||| ||||| | ||||||| | ||||||||||| | ||||||| |||||
Sbjct: 1130 gcggcgaccatggctgtcggaaagaacaagaggatctccaagggaaagaagggtggcaag 1071

                                                                        
Query: 128  aagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctc 187
                || |||| || || ||| | |||||| | ||||||||||||||||| |||  | | 
Sbjct: 1070 nnncagaccgtcgaccctttctctaagaaggattggtatgacatcaaggcaccgtcggtg 1011

                                                                        
Query: 188  ttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcc 247
            ||||     |||||| |||| ||||| ||||| ||||||||||||||||||| |||||| 
Sbjct: 1010 ttcagtgtgcgcaacatcgggaagactctcgtatccaggacacagggtaccaggattgct 951

                              
Query: 248  tcagagggcctgaagcac 265
            || ||||| |||||||||
Sbjct: 950  tctgagggtctgaagcac 933



to top

>gb|AY849388.1| Vitis vinifera cultivar Riesling cyc07 mRNA, partial cds
          Length = 879

 Score =  159 bits (80), Expect = 1e-35
 Identities = 152/176 (86%)
 Strand = Plus / Plus

                                                                       
Query: 287 gctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggat 346
           ||||||||||||||||||||||| |  ||||||||||||||| ||||  | |||||||||
Sbjct: 145 gctgatcttcagaacgatgaggatcgtgcctacaggaagatccgactgagagctgaggat 204

                                                                       
Query: 347 gtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctc 406
           |||||||| | |||||||||||||||||||||||| ||||| || || || |||||||| 
Sbjct: 205 gtgcaaggaaagaatgtcctcacaaacttctggggaatggactttacaacagacaagctg 264

                                                                   
Query: 407 aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 462
           |||||| | ||| | |||||||||||  | |||||||||||||| ||||| |||||
Sbjct: 265 aggtctttggtgcgcaagtggcagacattgattgaggctcatgtggatgttaagac 320



to top

>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score =  149 bits (75), Expect = 1e-32
 Identities = 84/87 (96%)
 Strand = Plus / Minus

                                                                         
Query: 429   agaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgt 488
             |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||
Sbjct: 46711 agaccctcattgaggctcatgtggatgtgaagacaactgacaattacatgctccgcatgt 46652

                                        
Query: 489   ttgccattggcttcaccaagagacgcc 515
             ||||||||||||||||||||| |||||
Sbjct: 46651 ttgccattggcttcaccaagaaacgcc 46625



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                 
Query: 427   gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 478
             |||||||||||||||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 46885 gcagaccctcattgaggctcatgtggatgtgaagacaactgacaactacatg 46834



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 431   accctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 478
             |||||||||||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 47052 accctcattgaggctcatgtggatgtgaagacaactgacaactacatg 47005



to top

>ref|NM_119633.2| Arabidopsis thaliana structural constituent of ribosome AT4G34670
           mRNA, complete cds
          Length = 1093

 Score =  139 bits (70), Expect = 1e-29
 Identities = 315/394 (79%), Gaps = 2/394 (0%)
 Strand = Plus / Plus

                                                                       
Query: 73  aaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaa 132
           ||||||||| ||||| | ||||||| | || || ||||| ||||| ||  | ||||||||
Sbjct: 75  aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 134

                                                                       
Query: 133 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 191
           ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||
Sbjct: 135 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 193

                                                                       
Query: 192 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 251
           | | | | || || || ||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 194 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 253

                                                                       
Query: 252 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 311
           |||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  
Sbjct: 254 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 313

                                                                       
Query: 312 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 371
           | ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  
Sbjct: 314 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 373

                                                                       
Query: 372 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 431
           | |||||||| ||||||||||| || |||||||| |||||  | |||| |||||||||||
Sbjct: 374 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 433

                                             
Query: 432 ccctcattgaggctcatgtcgatgtgaagaccac 465
           |  | ||||| || |||||||||||||| |||||
Sbjct: 434 ctttgattgaagcccatgtcgatgtgaaaaccac 467



to top

>gb|AY062500.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein
           (At4g34670; T4L20.250) mRNA, complete cds
          Length = 1094

 Score =  139 bits (70), Expect = 1e-29
 Identities = 315/394 (79%), Gaps = 2/394 (0%)
 Strand = Plus / Plus

                                                                       
Query: 73  aaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaa 132
           ||||||||| ||||| | ||||||| | || || ||||| ||||| ||  | ||||||||
Sbjct: 75  aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 134

                                                                       
Query: 133 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 191
           ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||
Sbjct: 135 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 193

                                                                       
Query: 192 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 251
           | | | | || || || ||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 194 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 253

                                                                       
Query: 252 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 311
           |||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  
Sbjct: 254 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 313

                                                                       
Query: 312 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 371
           | ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  
Sbjct: 314 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 373

                                                                       
Query: 372 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 431
           | |||||||| ||||||||||| || |||||||| |||||  | |||| |||||||||||
Sbjct: 374 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 433

                                             
Query: 432 ccctcattgaggctcatgtcgatgtgaagaccac 465
           |  | ||||| || |||||||||||||| |||||
Sbjct: 434 ctttgattgaagcccatgtcgatgtgaaaaccac 467



to top

>emb|BX828268.1|CNS0A2YE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH6ZD12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score =  139 bits (70), Expect = 1e-29
 Identities = 315/394 (79%), Gaps = 2/394 (0%)
 Strand = Plus / Plus

                                                                       
Query: 73  aaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaa 132
           ||||||||| ||||| | ||||||| | || || ||||| ||||| ||  | ||||||||
Sbjct: 60  aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 119

                                                                       
Query: 133 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 191
           ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||
Sbjct: 120 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 178

                                                                       
Query: 192 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 251
           | | | | || || || ||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 179 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 238

                                                                       
Query: 252 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 311
           |||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  
Sbjct: 239 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 298

                                                                       
Query: 312 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 371
           | ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  
Sbjct: 299 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 358

                                                                       
Query: 372 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 431
           | |||||||| ||||||||||| || |||||||| |||||  | |||| |||||||||||
Sbjct: 359 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 418

                                             
Query: 432 ccctcattgaggctcatgtcgatgtgaagaccac 465
           |  | ||||| || |||||||||||||| |||||
Sbjct: 419 ctttgattgaagcccatgtcgatgtgaaaaccac 452



to top

>gb|BT000122.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein
           (At4g34670) mRNA, complete cds
          Length = 581

 Score =  137 bits (69), Expect = 5e-29
 Identities = 314/393 (79%), Gaps = 2/393 (0%)
 Strand = Plus / Minus

                                                                       
Query: 74  accatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaag 133
           |||||||| ||||| | ||||||| | || || ||||| ||||| ||  | |||||||||
Sbjct: 581 accatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaag 522

                                                                       
Query: 134 gccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttcac 192
           || || ||||| ||| |||||||| | ||||||||| | ||||| || | | || |||||
Sbjct: 521 gctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttcac 463

                                                                       
Query: 193 cagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcaga 252
            | | | || || || ||||| || || |||||||| |||||||||||||||||||| ||
Sbjct: 462 gaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctga 403

                                                                       
Query: 253 gggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacca 312
           ||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  |
Sbjct: 402 gggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggataa 343

                                                                       
Query: 313 ggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaa 372
            ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  |
Sbjct: 342 tgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccca 283

                                                                       
Query: 373 cttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagac 432
            |||||||| ||||||||||| || |||||||| |||||  | |||| ||||||||||||
Sbjct: 282 gttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagac 223

                                            
Query: 433 cctcattgaggctcatgtcgatgtgaagaccac 465
             | ||||| || |||||||||||||| |||||
Sbjct: 222 tttgattgaagcccatgtcgatgtgaaaaccac 190



to top

>gb|DQ164221.1| Nicotiana tabacum cyc07 mRNA, complete cds
          Length = 786

 Score =  137 bits (69), Expect = 5e-29
 Identities = 210/257 (81%)
 Strand = Plus / Plus

                                                                       
Query: 200 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 259
           ||||| ||||||||||| ||  | ||||| |||||||| |||||||| || || || || 
Sbjct: 124 aacgttggcaagaccctggtcactaggactcagggtactaagattgcttcggaaggacta 183

                                                                       
Query: 260 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 319
           |||||| | || ||||||||   | | |||||||||||||| |||||||| ||  | | |
Sbjct: 184 aagcacagagtatttgaagtcagtttggctgatcttcagaaggatgaggatcaatctttc 243

                                                                       
Query: 320 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 379
           ||||||||| |  |  | || || ||||||||||||| ||||||||||||||||||||||
Sbjct: 244 aggaagatccgcttgagggcagaagatgtgcaagggaagaatgtcctcacaaacttctgg 303

                                                                       
Query: 380 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 439
           || ||||||||||| || |||||| | |||||||| || | ||||||||||||  | |||
Sbjct: 304 ggaatggatttcacaacagacaagttgaggtctctggtaaagaagtggcagacattgatt 363

                            
Query: 440 gaggctcatgtcgatgt 456
           ||||||||||| |||||
Sbjct: 364 gaggctcatgtggatgt 380



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 554 cagatcagacagatccgccggaagatggttgagatcatg 592
           |||||| | |||||||| ||||| |||||||||||||||
Sbjct: 478 cagatccgtcagatccgtcggaaaatggttgagatcatg 516



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 125 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
           ||||||||||| | |||||||| | | |||||| | ||||||||||| |||||
Sbjct: 49  aagaagaaggcggcggatccgtacgcaaagaaggactggtatgacataaaggc 101



to top

>emb|BX826401.1|CNS0A38P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 836

 Score =  137 bits (69), Expect = 5e-29
 Identities = 201/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 221 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 280
           |||||||| |||||||||||||||||||| ||||| ||||| ||| |||||||||| || 
Sbjct: 52  tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 111

                                                                       
Query: 281 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 340
           ||||| |||||||| || || ||||||||  | ||||||||||||||| | ||  | |||
Sbjct: 112 tctcttgctgatctacaaaatgatgaggataatgcctacaggaagatccgtcttagagct 171

                                                                       
Query: 341 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 400
           || ||||| || || | ||||||  | ||  | |||||||| ||||||||||| || |||
Sbjct: 172 gaagatgttcagggaaggaatgtgttgacccagttctggggtatggatttcacaaccgac 231

                                                                       
Query: 401 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
           ||||| |||||  | |||| ||||||||||||  | ||||| || |||||||||||||| 
Sbjct: 232 aagctaaggtcattggtgaagaagtggcagactttgattgaagcccatgtcgatgtgaaa 291

                
Query: 461 accac 465
           |||||
Sbjct: 292 accac 296



to top

>emb|AJ001342.1|ATCYC07 Arabidopsis thaliana mRNA for S-phase-specific ribosomal protein
          Length = 906

 Score =  137 bits (69), Expect = 5e-29
 Identities = 201/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 221 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 280
           |||||||| |||||||||||||||||||| ||||| ||||| ||| |||||||||| || 
Sbjct: 145 tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 204

                                                                       
Query: 281 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 340
           ||||| |||||||| || || ||||||||  | ||||||||||||||| | ||  | |||
Sbjct: 205 tctcttgctgatctacaaaatgatgaggataatgcctacaggaagatccgtcttagagct 264

                                                                       
Query: 341 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 400
           || ||||| || || | ||||||  | ||  | |||||||| ||||||||||| || |||
Sbjct: 265 gaagatgttcagggaaggaatgtgttgacccagttctggggtatggatttcacaaccgac 324

                                                                       
Query: 401 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
           ||||| |||||  | |||| ||||||||||||  | ||||| || |||||||||||||| 
Sbjct: 325 aagctaaggtcattggtgaagaagtggcagactttgattgaagcccatgtcgatgtgaaa 384

                
Query: 461 accac 465
           |||||
Sbjct: 385 accac 389



to top

>emb|Z25769.1|BRSPSG B.rapa mRNA for S phase specific gene
          Length = 1050

 Score =  131 bits (66), Expect = 3e-27
 Identities = 222/274 (81%)
 Strand = Plus / Plus

                                                                       
Query: 203 gtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaag 262
           ||||| ||||| || || ||||| || ||||||||||||||||| ||||||||  |||| 
Sbjct: 232 gtcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaa 291

                                                                       
Query: 263 caccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacagg 322
           ||| | || ||||| || ||||| ||||||||| | || |||||||||||||| ||||||
Sbjct: 292 cacagagtctttgaggtgtctcttgctgatcttaacaaggatgaggaccaggcttacagg 351

                                                                       
Query: 323 aagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggc 382
           |||||| | ||| | ||||| ||||| || || | ||||||| | ||  | |||||||| 
Sbjct: 352 aagatccgtctcagagctgaagatgtccagggcaggaatgtcttgacccagttctggggt 411

                                                                       
Query: 383 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 442
           ||||| ||||| || ||||| ||||||||  | || | ||||||||||||  | || |||
Sbjct: 412 atggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttgatcgag 471

                                             
Query: 443 gctcatgtcgatgtgaagaccactgacaattaca 476
            ||||||| ||||| |||||||||||||| ||||
Sbjct: 472 tctcatgttgatgttaagaccactgacaactaca 505



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 72  caaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaaga 131
           |||||||||| ||||| | ||||||| | ||||||||||| || |||||  |||||||||
Sbjct: 101 caaccatggccgtcggtaagaacaagaggatctccaagggaagaaagggaggcaagaaga 160

                                                         
Query: 132 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
           ||   || ||||| ||| |||||||| | |||||||| ||||||||
Sbjct: 161 agattgttgatcctttcgccaagaaggattggtatgatatcaaggc 206



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 499 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctca 546
           |||||||||||||||  | ||||| || ||| | ||||||||||||||
Sbjct: 528 cttcaccaagagacgtgctaaccaagttaagagaacttgctatgctca 575



to top

>gb|DQ268835.1| Solanum tuberosum clone 115A11 cyc07-like protein mRNA, complete
           cds
          Length = 1020

 Score =  131 bits (66), Expect = 3e-27
 Identities = 195/238 (81%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctc 284
           |||| |||||||| |||||||| ||||| || || |||||| | || ||||||||   | 
Sbjct: 192 ggactcagggtactaagattgcttcagaaggactaaagcacagagtatttgaagtcagtt 251

                                                                       
Query: 285 tagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgagg 344
           | |||||||||||||| |||||||| ||||| |||||||||||| |  |  | || || |
Sbjct: 252 tggctgatcttcagaaggatgaggatcaggcttacaggaagatccgcttgagagcagaag 311

                                                                       
Query: 345 atgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagc 404
           |||||||||||| |||||||||||||||||||   || ||||| ||||| || |||||| 
Sbjct: 312 atgtgcaagggaggaatgtcctcacaaacttccatggaatggacttcacaacagacaagt 371

                                                                     
Query: 405 tcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 462
           | |||||||| ||| | |||||||||||  | |||||||||||||| ||||| |||||
Sbjct: 372 tgaggtctctggtgcgcaagtggcagactttgattgaggctcatgtggatgtcaagac 429



to top

>gb|DQ252490.1| Solanum tuberosum clone 059D09 cyc07-like mRNA, complete cds
          Length = 996

 Score =  131 bits (66), Expect = 3e-27
 Identities = 195/238 (81%)
 Strand = Plus / Plus

                                                                       
Query: 225 ggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctc 284
           |||| |||||||| |||||||| ||||| || || |||||| | || ||||||||   | 
Sbjct: 170 ggactcagggtactaagattgcttcagaaggactaaagcacagagtatttgaagtcagtt 229

                                                                       
Query: 285 tagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgagg 344
           | |||||||||||||| |||||||| ||||| |||||||||||| |  |  | || || |
Sbjct: 230 tggctgatcttcagaaggatgaggatcaggcttacaggaagatccgcttgagagcagaag 289

                                                                       
Query: 345 atgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagc 404
           |||||||||||| |||||||||||||||||||   || ||||| ||||| || |||||| 
Sbjct: 290 atgtgcaagggaggaatgtcctcacaaacttccatggaatggacttcacaacagacaagt 349

                                                                     
Query: 405 tcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 462
           | |||||||| ||| | |||||||||||  | |||||||||||||| ||||| |||||
Sbjct: 350 tgaggtctctggtgcgcaagtggcagactttgattgaggctcatgtggatgtcaagac 407



to top

>gb|L23553.1|BRRSPSK Brassica rapa S-phase-specific (BIS289) mRNA, complete cds
          Length = 1050

 Score =  131 bits (66), Expect = 3e-27
 Identities = 222/274 (81%)
 Strand = Plus / Plus

                                                                       
Query: 203 gtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaag 262
           ||||| ||||| || || ||||| || ||||||||||||||||| ||||||||  |||| 
Sbjct: 232 gtcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaa 291

                                                                       
Query: 263 caccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacagg 322
           ||| | || ||||| || ||||| ||||||||| | || |||||||||||||| ||||||
Sbjct: 292 cacagagtctttgaggtgtctcttgctgatcttaacaaggatgaggaccaggcttacagg 351

                                                                       
Query: 323 aagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggc 382
           |||||| | ||| | ||||| ||||| || || | ||||||| | ||  | |||||||| 
Sbjct: 352 aagatccgtctcagagctgaagatgtccagggcaggaatgtcttgacccagttctggggt 411

                                                                       
Query: 383 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 442
           ||||| ||||| || ||||| ||||||||  | || | ||||||||||||  | || |||
Sbjct: 412 atggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttgatcgag 471

                                             
Query: 443 gctcatgtcgatgtgaagaccactgacaattaca 476
            ||||||| ||||| |||||||||||||| ||||
Sbjct: 472 tctcatgttgatgttaagaccactgacaactaca 505



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 88/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 72  caaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaaga 131
           |||||||||| ||||| | ||||||| | ||||||||||| || |||||  |||||||||
Sbjct: 101 caaccatggccgtcggtaagaacaagaggatctccaagggaagaaagggaggcaagaaga 160

                                                         
Query: 132 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
           ||   || ||||| ||| |||||||| | |||||||| ||||||||
Sbjct: 161 agattgttgatcctttcgccaagaaggattggtatgatatcaaggc 206



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                           
Query: 499 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctca 546
           |||||||||||||||  | ||||| || ||| | ||||||||||||||
Sbjct: 528 cttcaccaagagacgtgctaaccaagttaagagaacttgctatgctca 575



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                           
Query: 240     agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
               ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 5244369 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 5244428

                                                                           
Query: 300     acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
               |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 5244429 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 5244488

                                    
Query: 360     atgtcctcacaaacttctggg 380
               | || ||||| ||||| ||||
Sbjct: 5244489 acgtgctcaccaacttttggg 5244509



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                           
Query: 401     aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
               |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 5244600 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 5244659

                                                                           
Query: 461     accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 520
               ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 5244660 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 5244719

                                                            
Query: 521     caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 565
               ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 5244720 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 5244764



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                                 
Query: 204     tcggcaagaccctcgtgtccaggacacagggtac 237
               ||||||||||||||||||||||||||||||||||
Sbjct: 5243526 tcggcaagaccctcgtgtccaggacacagggtac 5243559



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                           
Query: 65      gcagcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagc 124
               |||||| || ||||||| || || | ||||||||||||||||||||||| ||||||   |
Sbjct: 5243269 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 5243328

                        
Query: 125     aagaagaag 133
               |||||||||
Sbjct: 5243329 aagaagaag 5243337



to top

>gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare strain chromosome 3
             clone OSJNBa0021H20, complete sequence
          Length = 133079

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                         
Query: 240   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
             ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 67771 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 67830

                                                                         
Query: 300   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
             |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 67831 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 67890

                                  
Query: 360   atgtcctcacaaacttctggg 380
             | || ||||| ||||| ||||
Sbjct: 67891 acgtgctcaccaacttttggg 67911



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                         
Query: 401   aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
             |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 68002 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 68061

                                                                         
Query: 461   accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 520
             ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 68062 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 68121

                                                          
Query: 521   caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 565
             ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 68122 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 68166



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                               
Query: 204   tcggcaagaccctcgtgtccaggacacagggtac 237
             ||||||||||||||||||||||||||||||||||
Sbjct: 66928 tcggcaagaccctcgtgtccaggacacagggtac 66961



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                         
Query: 65    gcagcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagc 124
             |||||| || ||||||| || || | ||||||||||||||||||||||| ||||||   |
Sbjct: 66671 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 66730

                      
Query: 125   aagaagaag 133
             |||||||||
Sbjct: 66731 aagaagaag 66739



to top

>gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0091J11, from chromosome 3, complete sequence
          Length = 181163

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                         
Query: 240   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
             ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 12149 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 12090

                                                                         
Query: 300   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
             |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 12089 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 12030

                                  
Query: 360   atgtcctcacaaacttctggg 380
             | || ||||| ||||| ||||
Sbjct: 12029 acgtgctcaccaacttttggg 12009



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Minus

                                                                         
Query: 401   aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
             |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 11918 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 11859

                                                                         
Query: 461   accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 520
             ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 11858 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 11799

                                                          
Query: 521   caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 565
             ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 11798 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 11754



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Minus

                                               
Query: 204   tcggcaagaccctcgtgtccaggacacagggtac 237
             ||||||||||||||||||||||||||||||||||
Sbjct: 12992 tcggcaagaccctcgtgtccaggacacagggtac 12959



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                         
Query: 65    gcagcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagc 124
             |||||| || ||||||| || || | ||||||||||||||||||||||| ||||||   |
Sbjct: 13249 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 13190

                      
Query: 125   aagaagaag 133
             |||||||||
Sbjct: 13189 aagaagaag 13181



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                            
Query: 240      agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
                ||||||| ||||||||||| |||||||| |||||||| || ||  | |||||||||||||
Sbjct: 12316009 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 12315950

                                                                            
Query: 300      acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
                |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  |
Sbjct: 12315949 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 12315890

                                     
Query: 360      atgtcctcacaaacttctggg 380
                |||| || |||||||||||||
Sbjct: 12315889 atgttcttacaaacttctggg 12315869



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                            
Query: 379      gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 438
                |||||||  |||||| || ||||||||||| ||  | || | ||| |||||||| || ||
Sbjct: 12315798 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 12315739

                                                                            
Query: 439      tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 498
                 ||||||||||| ||||| ||||||||||| || |||||||| ||  | ||   ||||||
Sbjct: 12315738 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 12315679

                                                                            
Query: 499      cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 558
                ||||||||||||  | ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 12315678 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 12315619



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 200      aacgtcggcaagaccctcgtgtccaggacacaggg 234
                |||||||| ||||| ||||||||||||||||||||
Sbjct: 12318352 aacgtcgggaagacgctcgtgtccaggacacaggg 12318318



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                      
Query: 563      cagatccgccggaagatggttgagatcatggtcaacca 600
                |||||||| || |||||||| ||||||||||| |||||
Sbjct: 12315503 cagatccgtcgcaagatggtggagatcatggtgaacca 12315466



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 34       ctccacccgccgcagcgccgccac 57
                ||||||||||||| ||||||||||
Sbjct: 18425138 ctccacccgccgccgcgccgccac 18425115



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                           
Query: 240     agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
               ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 5243584 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 5243643

                                                                           
Query: 300     acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
               |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 5243644 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 5243703

                                    
Query: 360     atgtcctcacaaacttctggg 380
               | || ||||| ||||| ||||
Sbjct: 5243704 acgtgctcaccaacttttggg 5243724



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                           
Query: 401     aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
               |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 5243815 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 5243874

                                                                           
Query: 461     accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 520
               ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 5243875 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 5243934

                                                            
Query: 521     caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 565
               ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 5243935 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 5243979



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                                 
Query: 204     tcggcaagaccctcgtgtccaggacacagggtac 237
               ||||||||||||||||||||||||||||||||||
Sbjct: 5242741 tcggcaagaccctcgtgtccaggacacagggtac 5242774



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                           
Query: 65      gcagcggcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagc 124
               |||||| || ||||||| || || | ||||||||||||||||||||||| ||||||   |
Sbjct: 5242484 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 5242543

                        
Query: 125     aagaagaag 133
               |||||||||
Sbjct: 5242544 aagaagaag 5242552



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                            
Query: 240      agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
                ||||||| ||||||||||| |||||||| |||||||| || ||  | |||||||||||||
Sbjct: 12270379 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 12270320

                                                                            
Query: 300      acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
                |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  |
Sbjct: 12270319 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 12270260

                                     
Query: 360      atgtcctcacaaacttctggg 380
                |||| || |||||||||||||
Sbjct: 12270259 atgttcttacaaacttctggg 12270239



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                            
Query: 379      gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 438
                |||||||  |||||| || ||||||||||| ||  | || | ||| |||||||| || ||
Sbjct: 12270168 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 12270109

                                                                            
Query: 439      tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 498
                 ||||||||||| ||||| ||||||||||| || |||||||| ||  | ||   ||||||
Sbjct: 12270108 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 12270049

                                                                            
Query: 499      cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 558
                ||||||||||||  | ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 12270048 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 12269989



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 200      aacgtcggcaagaccctcgtgtccaggacacaggg 234
                |||||||| ||||| ||||||||||||||||||||
Sbjct: 12272722 aacgtcgggaagacgctcgtgtccaggacacaggg 12272688



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                      
Query: 563      cagatccgccggaagatggttgagatcatggtcaacca 600
                |||||||| || |||||||| ||||||||||| |||||
Sbjct: 12269873 cagatccgtcgcaagatggtggagatcatggtgaacca 12269836



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 34       ctccacccgccgcagcgccgccac 57
                ||||||||||||| ||||||||||
Sbjct: 18351364 ctccacccgccgccgcgccgccac 18351341



to top

>emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa0009F05 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 163702

 Score =  129 bits (65), Expect = 1e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                         
Query: 240   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
             ||||||| ||||||||||| |||||||| |||||||| || ||  | |||||||||||||
Sbjct: 30374 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 30315

                                                                         
Query: 300   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
             |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  |
Sbjct: 30314 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 30255

                                  
Query: 360   atgtcctcacaaacttctggg 380
             |||| || |||||||||||||
Sbjct: 30254 atgttcttacaaacttctggg 30234



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                         
Query: 379   gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 438
             |||||||  |||||| || ||||||||||| ||  | || | ||| |||||||| || ||
Sbjct: 30163 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 30104

                                                                         
Query: 439   tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 498
              ||||||||||| ||||| ||||||||||| || |||||||| ||  | ||   ||||||
Sbjct: 30103 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 30044

                                                                         
Query: 499   cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 558
             ||||||||||||  | ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 30043 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 29984



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 200   aacgtcggcaagaccctcgtgtccaggacacaggg 234
             |||||||| ||||| ||||||||||||||||||||
Sbjct: 32717 aacgtcgggaagacgctcgtgtccaggacacaggg 32683



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 563   cagatccgccggaagatggttgagatcatggtcaacca 600
             |||||||| || |||||||| ||||||||||| |||||
Sbjct: 29868 cagatccgtcgcaagatggtggagatcatggtgaacca 29831



to top

>gb|AF479043.1| Triticum aestivum 40S ribosomal protein mRNA, partial cds
          Length = 342

 Score =  127 bits (64), Expect = 5e-26
 Identities = 70/72 (97%)
 Strand = Plus / Plus

                                                                       
Query: 529 gcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagat 588
           ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 3   gcgcacttgctatgcccaagcaagtcagatcagacagatccgccgcaagatggttgagat 62

                       
Query: 589 catggtcaacca 600
           ||||||||||||
Sbjct: 63  catggtcaacca 74



to top

>emb|AJ515028.1|CAR515028 Cicer arietinum mRNA for ribosomal protein S3a (rs3a gene)
          Length = 1026

 Score =  125 bits (63), Expect = 2e-25
 Identities = 198/243 (81%)
 Strand = Plus / Plus

                                                                       
Query: 358 gaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgt 417
           |||||||||||| ||||| |  || |||||||||||||||||||||||||||||| | ||
Sbjct: 332 gaatgtcctcaccaacttttatggtatggatttcaccactgacaagctcaggtctttggt 391

                                                                       
Query: 418 gaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacat 477
             | || ||||| || |||||||| |||||||| ||||| ||||||||||| ||||| | 
Sbjct: 392 ccgtaaatggcaaactctcattgaagctcatgtggatgttaagaccactgataattatac 451

                                                                       
Query: 478 gctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttg 537
             |  | |||||   ||||||||| ||||||||||||   ||||| || ||| | || ||
Sbjct: 452 cttgagaatgttctgcattggctttaccaagagacgcagtaaccaagtgaagagaacctg 511

                                                                       
Query: 538 ctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaa 597
            ||||||||| | || |||||||||||||||||| ||||||||   ||||||||||| ||
Sbjct: 512 ttatgctcaatccagccagatcagacagatccgcaggaagatgagggagatcatggttaa 571

              
Query: 598 cca 600
           |||
Sbjct: 572 cca 574



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 72  caaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaaga 131
           |||||||||||||||||| ||||||| | || |||||||| | ||||||  |||||||||
Sbjct: 46  caaccatggcggtcggcaagaacaagagaatttccaagggaaagaagggaggcaagaaga 105

                                                         
Query: 132 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
           | ||||  ||||| ||  |||||||| | |||||||| ||||||||
Sbjct: 106 aagccgccgatcccttttccaagaaggattggtatgatatcaaggc 151



to top

>gb|DQ445133.1| Striga asiatica isolate St513 S phase protein mRNA, partial cds
          Length = 571

 Score =  123 bits (62), Expect = 7e-25
 Identities = 143/170 (84%)
 Strand = Plus / Plus

                                                                       
Query: 302 gatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaat 361
           |||||||||||  ||| |||||||||| |  |  | ||||| ||||| || || | ||||
Sbjct: 67  gatgaggaccactccttcaggaagatccgtttgagagctgaagatgttcagggaaagaat 126

                                                                       
Query: 362 gtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgagg 421
           || |||||||||||||||||||||||||||||||| |||||||| || ||||| ||||||
Sbjct: 127 gttctcacaaacttctggggcatggatttcaccaccgacaagctgagatctctcgtgagg 186

                                                             
Query: 422 aagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaa 471
           || |||||| | || |||||||||||||| ||||| ||||| || |||||
Sbjct: 187 aaatggcagtcactaattgaggctcatgttgatgtcaagactaccgacaa 236



to top

>dbj|AB029635.1| Daucus carota mRNA for cyc07, complete cds
          Length = 1050

 Score =  119 bits (60), Expect = 1e-23
 Identities = 282/356 (79%)
 Strand = Plus / Plus

                                                                       
Query: 230 cagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagct 289
           ||||||||||||||||| || || || || || ||||| ||||| || || |  || |||
Sbjct: 175 cagggtaccaagattgcttctgaaggactcaaacaccgagtgttcgaggtttgccttgct 234

                                                                       
Query: 290 gatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtg 349
           || ||||||   |||||||||||||| || ||||||||  | ||  | || |||||||||
Sbjct: 235 gaccttcagggagatgaggaccaggcttataggaagattcgcctgagagcagaggatgtg 294

                                                                       
Query: 350 caagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcagg 409
           ||||||| |||||| || ||||||||||  || ||||| ||||| ||||||||| | |||
Sbjct: 295 caagggaagaatgtgcttacaaacttctatggaatggacttcacaactgacaagttgagg 354

                                                                       
Query: 410 tctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 469
           ||||| ||  | ||||||||||| || ||||| |||||||| ||||||||||| ||||| 
Sbjct: 355 tctctggtacgcaagtggcagacactgattgaagctcatgtagatgtgaagacaactgat 414

                                                                       
Query: 470 aattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaag 529
           | ||| |  || || ||||||  |||||| || ||||||| |||  |||| |||   |||
Sbjct: 415 agttatactctgcgaatgttttgcattggatttaccaagaaacgtgcaaatcagcagaag 474

                                                                   
Query: 530 cgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggttga 585
            | || |||||||| ||| | || |||||| | ||||| ||||| |||||||||||
Sbjct: 475 agaacctgctatgcccaatctagccagatccggcagattcgccgtaagatggttga 530



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 71  gcaaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaag 130
           ||||||||||| ||||||| ||||||| | ||||| ||||| | ||||||  ||||||||
Sbjct: 16  gcaaccatggctgtcggcaagaacaagaggatctcgaagggaaagaagggaggcaagaag 75

                
Query: 131 aaggc 135
           |||||
Sbjct: 76  aaggc 80



to top

>gb|DQ241862.1| Solanum tuberosum clone 027B03 40S ribosomal protein S3a-like mRNA,
           complete cds
          Length = 1118

 Score =  117 bits (59), Expect = 4e-23
 Identities = 212/263 (80%)
 Strand = Plus / Plus

                                                                       
Query: 200 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 259
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 210 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagagggccta 269

                                                                       
Query: 260 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 319
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 270 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 329

                                                                       
Query: 320 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 379
           ||||| ||| |  |  | || || ||||||||||||| |||||| ||||||||||||   
Sbjct: 330 aggaaaatccgtttgagagcagaagatgtgcaagggaggaatgttctcacaaacttccat 389

                                                                       
Query: 380 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 439
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 390 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 449

                                  
Query: 440 gaggctcatgtcgatgtgaagac 462
           ||||| ||||| ||||| |||||
Sbjct: 450 gaggcccatgttgatgtcaagac 472



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 563 cagatccgccggaagatggttgagat 588
           ||||||||| ||||||||||||||||
Sbjct: 573 cagatccgcaggaagatggttgagat 598



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 82/102 (80%)
 Strand = Plus / Plus

                                                                       
Query: 76  catggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 135
           |||||| ||||||| ||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 86  catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 145

                                                     
Query: 136 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
            | |||||| |   | |||||| | ||||| |||||||||||
Sbjct: 146 ggcggatccttatgcaaagaaggactggtacgacatcaaggc 187



to top

>gb|AY643842.1|AY643842S1 Hordeum vulgare subsp. vulgare clone BAC 519K7 hardness locus region
          Length = 12998

 Score =  113 bits (57), Expect = 7e-22
 Identities = 81/89 (91%)
 Strand = Plus / Plus

                                                                        
Query: 427  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcat 486
            |||||||||||||||||||||||  ||||| ||||| |||||||| ||||||||||||||
Sbjct: 3401 gcagaccctcattgaggctcatgcagatgtcaagacaactgacaactacatgctccgcat 3460

                                         
Query: 487  gtttgccattggcttcaccaagagacgcc 515
            |||| ||| |||||||||||||| |||||
Sbjct: 3461 gtttcccactggcttcaccaagaaacgcc 3489



to top

>gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones BAC 799C8 and 122A5 hardness locus
              region
          Length = 160897

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                          
Query: 428    cagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatg 487
              |||||||||| |||||||||||  ||||| ||||| ||||||||||||||||| ||||||
Sbjct: 128530 cagaccctcagtgaggctcatgcagatgtcaagacaactgacaattacatgcttcgcatg 128471

                                          
Query: 488    tttgccattggcttcaccaagagacgcc 515
              ||||||||||||||||| |||| |||||
Sbjct: 128470 tttgccattggcttcacaaagaaacgcc 128443



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                  
Query: 427    gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 478
              ||||| |||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 128702 gcagaacctcattgaggctcatgtagatgtcaagacaactgacaattacatg 128651



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 427    gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 478
              |||||||| |||||| |||||||| ||||| ||||| |||||||||||||||
Sbjct: 128814 gcagacccacattgaagctcatgtagatgtcaagacaactgacaattacatg 128763



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 427    gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 478
              ||||| |||||||||| ||||||| ||||| ||||| |||||||||||||||
Sbjct: 128758 gcagaacctcattgagactcatgtagatgtcaagacaactgacaattacatg 128707



to top

>gb|AF093109.1| Tortula ruralis ribosomal protein S3 (rps3) mRNA, complete cds
          Length = 899

 Score =  105 bits (53), Expect = 2e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 296 cagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaaggg 355
           |||||||||||||||||||| | | | |||||||  ||  | || ||||||||||| || 
Sbjct: 238 cagaacgatgaggaccaggctttccgcaagatcaagctgagggcggaggatgtgcagggc 297

                                                                       
Query: 356 atgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctctt 415
           | ||| || ||||| ||||||||||||||||| |||||||| ||||||||  ||||||| 
Sbjct: 298 aagaacgtgctcaccaacttctggggcatggacttcaccacggacaagctgcggtctctg 357

                                                                
Query: 416 gtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactga 468
           ||| | ||||||||||   | ||  ||||||| ||||||||||||||||||||
Sbjct: 358 gtgcgcaagtggcagagtttgatccaggctcacgtcgatgtgaagaccactga 410



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 95  aagcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcaccaag 154
           |||||||| |||||||| | ||||||  ||||||||||    || ||||||||| |||||
Sbjct: 40  aagcgcatttccaagggcaagaagggcggcaagaagaaaattgtcgatccgttctccaag 99

                                     
Query: 155 aagcagtggtatgacatcaaggcgcc 180
           ||| | ||||||||||||||||||||
Sbjct: 100 aaggactggtatgacatcaaggcgcc 125



to top

>gb|DQ268856.1| Solanum tuberosum clone 174A02 cyc07-like protein mRNA, complete
           cds
          Length = 1045

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 200 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 259
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 197 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 256

                                                                       
Query: 260 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 319
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 257 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 316

                                                                       
Query: 320 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 379
           ||||| ||| |  |  | || || |||||||||||||  ||||| |||||||| |||   
Sbjct: 317 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 376

                                                                       
Query: 380 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 439
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 377 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 436

                                  
Query: 440 gaggctcatgtcgatgtgaagac 462
           ||||| ||||| ||||| |||||
Sbjct: 437 gaggcccatgttgatgtaaagac 459



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Plus

                                                                       
Query: 76  catggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 135
           |||||| ||||||| ||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 73  catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 132

                                                     
Query: 136 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
            | |||||| | | | |||||| | ||||| |||||||||||
Sbjct: 133 ggcggatccttacgcaaagaaggactggtacgacatcaaggc 174



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 563 cagatccgccggaagatggttgagat 588
           ||||||||| ||||||||||||||||
Sbjct: 560 cagatccgcaggaagatggttgagat 585



to top

>gb|DQ268849.1| Solanum tuberosum clone 155F06 cyc07-like protein mRNA, complete
           cds
          Length = 1038

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 200 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 259
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 181 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 240

                                                                       
Query: 260 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 319
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 241 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 300

                                                                       
Query: 320 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 379
           ||||| ||| |  |  | || || |||||||||||||  ||||| |||||||| |||   
Sbjct: 301 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 360

                                                                       
Query: 380 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 439
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 361 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 420

                                  
Query: 440 gaggctcatgtcgatgtgaagac 462
           ||||| ||||| ||||| |||||
Sbjct: 421 gaggcccatgttgatgtaaagac 443



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 563 cagatccgccggaagatggttgagat 588
           ||||||||| ||||||||||||||||
Sbjct: 544 cagatccgcaggaagatggttgagat 569



to top

>gb|DQ252485.1| Solanum tuberosum clone 048H05 cyc07-like mRNA, complete cds
          Length = 998

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 200 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 259
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 157 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 216

                                                                       
Query: 260 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 319
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 217 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 276

                                                                       
Query: 320 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 379
           ||||| ||| |  |  | || || |||||||||||||  ||||| |||||||| |||   
Sbjct: 277 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 336

                                                                       
Query: 380 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 439
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 337 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 396

                                  
Query: 440 gaggctcatgtcgatgtgaagac 462
           ||||| ||||| ||||| |||||
Sbjct: 397 gaggcccatgttgatgtaaagac 419



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Plus

                                                                       
Query: 76  catggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 135
           |||||| ||||||| ||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 33  catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 92

                                                     
Query: 136 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
            | |||||| | | | |||||| | ||||| |||||||||||
Sbjct: 93  ggcggatccttacgcaaagaaggactggtacgacatcaaggc 134



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 563 cagatccgccggaagatggttgagat 588
           ||||||||| ||||||||||||||||
Sbjct: 520 cagatccgcaggaagatggttgagat 545



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                            
Query: 240      agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
                ||||||| || ||||| || ||||| || || |||||||| ||  | || ||||||||||
Sbjct: 10823785 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 10823726

                                                                            
Query: 300      acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
                | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| ||
Sbjct: 10823725 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 10823666

                                     
Query: 360      atgtcctcacaaacttctggg 380
                |||||||||| || |||||||
Sbjct: 10823665 atgtcctcacgaatttctggg 10823645



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                            
Query: 437      attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 496
                ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||||
Sbjct: 10823493 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 10823434

                                                   
Query: 497      ggcttcaccaagagacgcccaaaccaggtcaagcg 531
                || ||||||||| | |||||||| ||||| |||||
Sbjct: 10823433 ggtttcaccaagcgccgcccaaatcaggtgaagcg 10823399



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                     
Query: 564      agatccgccggaagatggttgagatcatggtcaacca 600
                |||||||||||||||||||||||||||||| ||||||
Sbjct: 10823258 agatccgccggaagatggttgagatcatggccaacca 10823222



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                            
Query: 150      ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 209
                |||||||| | ||||| |||||||||||||||    | ||| ||  ||||||| ||||||
Sbjct: 10824487 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 10824428

                                                
Query: 210      agaccctcgtgtccaggacacagggtaccaag 241
                |||||||||| |||||||| ||||| ||||||
Sbjct: 10824427 agaccctcgtctccaggacccaggggaccaag 10824396



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                           
Query: 75       ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaag 133
                ||||||| || |||| ||||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 10824694 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 10824636



to top

>dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1756_H07
          Length = 217205

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                         
Query: 240   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
             ||||||| || ||||| || ||||| || || |||||||| ||  | || ||||||||||
Sbjct: 29984 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 29925

                                                                         
Query: 300   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
             | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| ||
Sbjct: 29924 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 29865

                                  
Query: 360   atgtcctcacaaacttctggg 380
             |||||||||| || |||||||
Sbjct: 29864 atgtcctcacgaatttctggg 29844



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                         
Query: 437   attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 496
             ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||||
Sbjct: 29692 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 29633

                                                
Query: 497   ggcttcaccaagagacgcccaaaccaggtcaagcg 531
             || ||||||||| | |||||||| ||||| |||||
Sbjct: 29632 ggtttcaccaagcgccgcccaaatcaggtgaagcg 29598



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                  
Query: 564   agatccgccggaagatggttgagatcatggtcaacca 600
             |||||||||||||||||||||||||||||| ||||||
Sbjct: 29457 agatccgccggaagatggttgagatcatggccaacca 29421



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                         
Query: 150   ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 209
             |||||||| | ||||| |||||||||||||||    | ||| ||  ||||||| ||||||
Sbjct: 30686 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 30627

                                             
Query: 210   agaccctcgtgtccaggacacagggtaccaag 241
             |||||||||| |||||||| ||||| ||||||
Sbjct: 30626 agaccctcgtctccaggacccaggggaccaag 30595



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                        
Query: 75    ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaag 133
             ||||||| || |||| ||||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 30893 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 30835



to top

>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1115_D03
          Length = 169378

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                          
Query: 240    agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
              ||||||| || ||||| || ||||| || || |||||||| ||  | || ||||||||||
Sbjct: 163266 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 163207

                                                                          
Query: 300    acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 359
              | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| ||
Sbjct: 163206 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 163147

                                   
Query: 360    atgtcctcacaaacttctggg 380
              |||||||||| || |||||||
Sbjct: 163146 atgtcctcacgaatttctggg 163126



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                          
Query: 437    attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 496
              ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||||
Sbjct: 162974 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 162915

                                                 
Query: 497    ggcttcaccaagagacgcccaaaccaggtcaagcg 531
              || ||||||||| | |||||||| ||||| |||||
Sbjct: 162914 ggtttcaccaagcgccgcccaaatcaggtgaagcg 162880



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 36/37 (97%)
 Strand = Plus / Minus

                                                   
Query: 564    agatccgccggaagatggttgagatcatggtcaacca 600
              |||||||||||||||||||||||||||||| ||||||
Sbjct: 162739 agatccgccggaagatggttgagatcatggccaacca 162703



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                          
Query: 150    ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 209
              |||||||| | ||||| |||||||||||||||    | ||| ||  ||||||| ||||||
Sbjct: 163968 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 163909

                                              
Query: 210    agaccctcgtgtccaggacacagggtaccaag 241
              |||||||||| |||||||| ||||| ||||||
Sbjct: 163908 agaccctcgtctccaggacccaggggaccaag 163877



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                         
Query: 75     ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaag 133
              ||||||| || |||| ||||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 164175 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 164117



to top

>dbj|AB023436.1| Hordeum vulgare DNA, down stream region of HvNAS1 gene
          Length = 10603

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 67/74 (90%), Gaps = 1/74 (1%)
 Strand = Plus / Minus

                                                                        
Query: 427  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcat 486
            ||||||||||| |||||||||||  ||||| ||||| |||||||||| ||||||| ||||
Sbjct: 4956 gcagaccctcagtgaggctcatgcagatgtcaagacaactgacaatt-catgctctgcat 4898

                          
Query: 487  gtttgccattggct 500
            ||||||||||||||
Sbjct: 4897 gtttgccattggct 4884



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                
Query: 427  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 478
            ||||| |||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 5127 gcagaacctcattgaggctcatgtagatgtcaagacaactgacaattacatg 5076



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 427  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 478
            |||||||||||||||| ||||||| ||||| ||||| |||||||| ||||||
Sbjct: 5183 gcagaccctcattgagcctcatgtagatgtcaagacaactgacaaatacatg 5132



to top

>gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete sequence
          Length = 145314

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 140/173 (80%)
 Strand = Plus / Plus

                                                                         
Query: 383   atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 442
             |||||||| ||||| |||||||| |||||  | ||| | ||||||||||| |||||||| 
Sbjct: 48503 atggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcattgaa 48562

                                                                         
Query: 443   gctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttc 502
             |||||||| ||||| ||||||||||| || || |   |  | |||||   |||||| |||
Sbjct: 48563 gctcatgtggatgttaagaccactgataactatactttgagaatgttctgcattgggttc 48622

                                                                  
Query: 503   accaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtca 555
             |||||||| ||| |||||||||| ||| | ||||| ||||| ||| |||||||
Sbjct: 48623 accaagaggcgctcaaaccaggtgaagaggacttgttatgcccaatcaagtca 48675



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                      
Query: 76    catggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaa 132
             |||||||||||| | ||||||| | || || ||||| | ||||||| ||||||||||
Sbjct: 47391 catggcggtcggaaagaacaagagaatttcaaagggaaagaagggtggcaagaagaa 47447



to top

>gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete sequence
          Length = 108644

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 140/173 (80%)
 Strand = Plus / Minus

                                                                         
Query: 383   atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 442
             |||||||| ||||| |||||||| |||||  | ||| | ||||||||||| |||||||| 
Sbjct: 42408 atggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcattgaa 42349

                                                                         
Query: 443   gctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttc 502
             |||||||| ||||| ||||||||||| || || |   |  | |||||   |||||| |||
Sbjct: 42348 gctcatgtggatgttaagaccactgataactatactttgagaatgttctgcattgggttc 42289

                                                                  
Query: 503   accaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtca 555
             |||||||| ||| |||||||||| ||| | ||||| ||||| ||| |||||||
Sbjct: 42288 accaagaggcgctcaaaccaggtgaagaggacttgttatgcccaatcaagtca 42236



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                      
Query: 76    catggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaa 132
             |||||||||||| | ||||||| | || || ||||| | ||||||| ||||||||||
Sbjct: 43520 catggcggtcggaaagaacaagagaatttcaaagggaaagaagggtggcaagaagaa 43464



to top

>gb|BT019079.1| Zea mays clone Contig661.F mRNA sequence
          Length = 1229

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 91/108 (84%)
 Strand = Plus / Minus

                                                                       
Query: 493 cattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaag 552
           |||||| || |||||||| |||||||||||||||||| | || ||||||||||| |||  
Sbjct: 603 cattggttttaccaagaggcgcccaaaccaggtcaagagaacctgctatgctcaggcatc 544

                                                           
Query: 553 tcagatcagacagatccgccggaagatggttgagatcatggtcaacca 600
            |||||  | ||||| ||||| |||||||||||||| ||| |||||||
Sbjct: 543 ccagattcggcagattcgccgcaagatggttgagattatgatcaacca 496



to top

>dbj|AB116637.1| Lentinula edodes Le. cyc07 mRNA for putative S-phase specific
           ribosomal protein cyc07, complete cds
          Length = 980

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 383 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 442
           |||||||||||| | ||||||||  | ||||| ||  |||| |||||||| |||||||| 
Sbjct: 367 atggatttcacctccgacaagctgcgatctctcgtacggaaatggcagactctcattgaa 426

                                      
Query: 443 gctcatgtcgatgtgaagaccactgac 469
           || ||||||||||||||||||||||||
Sbjct: 427 gcccatgtcgatgtgaagaccactgac 453



to top

>gb|DQ268842.1| Solanum tuberosum clone 135C12 40S ribosomal protein S3a-like
           protein mRNA, complete cds
          Length = 1059

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 227 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 286
           ||||||||||| |||||||| ||||| ||||||||||| || ||||||||||| ||  | 
Sbjct: 182 acacagggtacaaagattgcttcagaaggcctgaagcatcgtgtgtttgaagtgtcattg 241

                                                                       
Query: 287 gctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggat 346
           |||||||||||||| || || || ||  ||| |||||||||  | ||  | ||||| |||
Sbjct: 242 gctgatcttcagaatgacgaagatcactccttcaggaagattcgtcttagagctgaagat 301

                                                                       
Query: 347 gtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctc 406
           || ||||| |  |||||| | |||||||||   || ||||| |||||||| || ||  | 
Sbjct: 302 gtccaaggaagaaatgtcttgacaaacttccatggtatggacttcaccacagataaattg 361

                                                                       
Query: 407 aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccact 466
           ||||| ||||| | ||| |||||  |  | |||||||||||||| ||||| ||||| |||
Sbjct: 362 aggtcacttgtaaagaaatggcaatcattgattgaggctcatgttgatgttaagacaact 421

             
Query: 467 ga 468
           ||
Sbjct: 422 ga 423



to top

>gb|L31645.1|HNNSPSP Helianthus annuus ribosomal protein S3a mRNA, complete cds
          Length = 982

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 230 cagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagct 289
           |||||||| |||||||| || |||||  |||| || ||||||||||| || ||| | |||
Sbjct: 223 cagggtactaagattgcttccgagggattgaaacatcgggtgtttgaggtgtctttggct 282

                                                                       
Query: 290 gatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtg 349
           ||||| ||||| ||||| || ||  ||||||| |||||| |  |  | ||||| || || 
Sbjct: 283 gatctccagaatgatgaagatcattcctacagaaagatccggttgagagctgaagacgtt 342

                                                                       
Query: 350 caagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcagg 409
           ||||||| ||||||  | || || |||||||| |||||| | ||||| || |||||||||
Sbjct: 343 caagggaagaatgttttgaccaatttctggggtatggatgttaccacagataagctcagg 402

                                                                       
Query: 410 tctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 469
           || ||||||| ||| |||||| |  | || || || ||||||||||| ||||| || |||
Sbjct: 403 tcgcttgtgaagaaatggcagtctttgatcgaagcacatgtcgatgttaagacaaccgac 462

             
Query: 470 aa 471
           ||
Sbjct: 463 aa 464



to top

>ref|XM_774945.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S3a, transcript variant 1 (LOC575056), mRNA
          Length = 1003

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 255
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 130 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 189

                                                                
Query: 256 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 308
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 190 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 242



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 566 atccgccggaagatggttgagatcatgg 593
           |||||| |||||||| ||||||||||||
Sbjct: 497 atccgcaggaagatgattgagatcatgg 524



to top

>ref|XM_796644.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S3a, transcript variant 2 (LOC575056), mRNA
          Length = 749

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 255
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 130 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 189

                                                                
Query: 256 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 308
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 190 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 242



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 566 atccgccggaagatggttgagatcatgg 593
           |||||| |||||||| ||||||||||||
Sbjct: 497 atccgcaggaagatgattgagatcatgg 524



to top

>ref|XM_785062.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S3a (V-fos transformation effector protein)
           (LOC585229), partial mRNA
          Length = 327

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 255
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 96  ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 155

                                                                
Query: 256 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 308
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 156 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 208



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                        
Query: 240  agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
            |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || |
Sbjct: 4117 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 4176

                                         
Query: 300  acgatgaggaccaggcctacaggaagatc 328
            | ||||||||  | |||||||||||||||
Sbjct: 4177 atgatgaggataatgcctacaggaagatc 4205



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 383  atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 442
            ||||||||||| || |||||||| |||||  | |||| ||||||||||||  | ||||| 
Sbjct: 4330 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 4389

                                   
Query: 443  gctcatgtcgatgtgaagaccac 465
            || |||||||||||||| |||||
Sbjct: 4390 gcccatgtcgatgtgaaaaccac 4412



to top

>emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 81
          Length = 195921

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                          
Query: 240    agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
              |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || |
Sbjct: 195038 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 195097

                                           
Query: 300    acgatgaggaccaggcctacaggaagatc 328
              | ||||||||  | |||||||||||||||
Sbjct: 195098 atgatgaggataatgcctacaggaagatc 195126



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                          
Query: 383    atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 442
              ||||||||||| || |||||||| |||||  | |||| ||||||||||||  | ||||| 
Sbjct: 195251 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 195310

                                     
Query: 443    gctcatgtcgatgtgaagaccac 465
              || |||||||||||||| |||||
Sbjct: 195311 gcccatgtcgatgtgaaaaccac 195333



to top

>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project)
          Length = 125502

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                         
Query: 240   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 299
             |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || |
Sbjct: 85349 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 85408

                                          
Query: 300   acgatgaggaccaggcctacaggaagatc 328
             | ||||||||  | |||||||||||||||
Sbjct: 85409 atgatgaggataatgcctacaggaagatc 85437



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 383   atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 442
             ||||||||||| || |||||||| |||||  | |||| ||||||||||||  | ||||| 
Sbjct: 85562 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 85621

                                    
Query: 443   gctcatgtcgatgtgaagaccac 465
             || |||||||||||||| |||||
Sbjct: 85622 gcccatgtcgatgtgaaaaccac 85644



to top

>ref|NM_111356.3| Arabidopsis thaliana structural constituent of ribosome AT3G04840
           mRNA, complete cds
          Length = 1004

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 221 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 280
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 203 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 262

                                                                       
Query: 281 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 340
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 263 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 322

                                                                       
Query: 341 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 400
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 323 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 382

                                                                       
Query: 401 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 383 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 442

                           
Query: 461 accactgacaattaca 476
           ||||| |||| |||||
Sbjct: 443 accaccgacagttaca 458



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 499 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 558
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 481 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 540

                                 
Query: 559 cagacagatccgccggaagatg 580
           | | ||||||||| ||||||||
Sbjct: 541 ccgtcagatccgcaggaagatg 562



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                       
Query: 75  ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 134
           ||||||| ||||| |  |||||| | ||||| ||||| ||||||||  | ||||||||||
Sbjct: 57  ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 116

                                 
Query: 135 ccgtggatccgttcaccaagaa 156
           | || ||||| ||| |||||||
Sbjct: 117 ctgttgatcctttctccaagaa 138



to top

>gb|AY081585.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase
           specific) (At3g04840) mRNA, complete cds
          Length = 870

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 221 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 280
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 145 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 204

                                                                       
Query: 281 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 340
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 205 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 264

                                                                       
Query: 341 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 400
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 265 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 324

                                                                       
Query: 401 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 325 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 384

                           
Query: 461 accactgacaattaca 476
           ||||| |||| |||||
Sbjct: 385 accaccgacagttaca 400



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 499 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 558
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 423 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 482

                                 
Query: 559 cagacagatccgccggaagatg 580
           | | ||||||||| ||||||||
Sbjct: 483 ccgtcagatccgcaggaagatg 504



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 92  aacaagcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcacc 151
           |||||| | ||||| ||||| ||||||||  | ||||||||||| || ||||| ||| ||
Sbjct: 16  aacaagagaatctctaagggtaggaagggaggaaagaagaaggctgttgatcctttctcc 75

                
Query: 152 aagaa 156
           |||||
Sbjct: 76  aagaa 80



to top

>gb|AY062796.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase
           specific) (At3g04840; T9J14.21) mRNA, complete cds
          Length = 1000

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 221 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 280
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 202 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 261

                                                                       
Query: 281 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 340
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 262 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 321

                                                                       
Query: 341 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 400
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 322 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 381

                                                                       
Query: 401 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 382 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 441

                           
Query: 461 accactgacaattaca 476
           ||||| |||| |||||
Sbjct: 442 accaccgacagttaca 457



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 499 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 558
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 480 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 539

                                 
Query: 559 cagacagatccgccggaagatg 580
           | | ||||||||| ||||||||
Sbjct: 540 ccgtcagatccgcaggaagatg 561



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                       
Query: 75  ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 134
           ||||||| ||||| |  |||||| | ||||| ||||| ||||||||  | ||||||||||
Sbjct: 56  ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 115

                                 
Query: 135 ccgtggatccgttcaccaagaa 156
           | || ||||| ||| |||||||
Sbjct: 116 ctgttgatcctttctccaagaa 137



to top

>emb|BX824488.1|CNS0A5KP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH51ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 927

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 221 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 280
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 135 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 194

                                                                       
Query: 281 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 340
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 195 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 254

                                                                       
Query: 341 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 400
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 255 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 314

                                                                       
Query: 401 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 315 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 374

                           
Query: 461 accactgacaattaca 476
           ||||| |||| |||||
Sbjct: 375 accaccgacagttaca 390



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 499 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 558
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 413 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 472

                                 
Query: 559 cagacagatccgccggaagatg 580
           | | ||||||||| ||||||||
Sbjct: 473 ccgtcagatccgcaggaagatg 494



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 92  aacaagcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcacc 151
           |||||| | ||||| ||||| ||||||||  | ||||||||||| || ||||| ||| ||
Sbjct: 6   aacaagagaatctctaagggtaggaagggaggaaagaagaaggctgttgatcctttctcc 65

                
Query: 152 aagaa 156
           |||||
Sbjct: 66  aagaa 70



to top

>gb|AY085787.1| Arabidopsis thaliana clone 18185 mRNA, complete sequence
          Length = 1001

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 221 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 280
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 203 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 262

                                                                       
Query: 281 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 340
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 263 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 322

                                                                       
Query: 341 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 400
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 323 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 382

                                                                       
Query: 401 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 460
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 383 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 442

                           
Query: 461 accactgacaattaca 476
           ||||| |||| |||||
Sbjct: 443 accaccgacagttaca 458



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 499 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 558
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 481 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 540

                                 
Query: 559 cagacagatccgccggaagatg 580
           | | ||||||||| ||||||||
Sbjct: 541 ccgtcagatccgcaggaagatg 562



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                       
Query: 75  ccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 134
           ||||||| ||||| |  |||||| | ||||| ||||| ||||||||  | ||||||||||
Sbjct: 57  ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 116

                                 
Query: 135 ccgtggatccgttcaccaagaa 156
           | || ||||| ||| |||||||
Sbjct: 117 ctgttgatcctttctccaagaa 138



to top

>dbj|D01058.1|CTRCYC07 Catharanthus roseus cyc07 mRNA, complete cds
          Length = 1100

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                       
Query: 371 aacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcag 430
           ||||||||||| ||||| ||||| || || ||| | ||||||||||||||||||||||| 
Sbjct: 366 aacttctggggtatggacttcactacagataagttgaggtctcttgtgaggaagtggcaa 425

                                                   
Query: 431 accctcattgaggctcatgtcgatgtgaagaccactgaca 470
            || | || || |||||||| ||||| ||||| |||||||
Sbjct: 426 tccttgatagaagctcatgttgatgttaagacaactgaca 465



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 539 tatgctcaagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaac 598
           ||||| ||| ||||||| ||| | ||||| || |||||||||   |||||||||||||||
Sbjct: 534 tatgcacaatcaagtcaaatccgccagattcgtcggaagatgcgggagatcatggtcaac 593

             
Query: 599 ca 600
           ||
Sbjct: 594 ca 595



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 85/106 (80%)
 Strand = Plus / Plus

                                                                       
Query: 72  caaccatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaaga 131
           |||||||||| ||||| | ||||||| | || || ||||| | ||| ||  | |||||||
Sbjct: 67  caaccatggccgtcggtaagaacaagaggatatcgaagggtaagaaaggaggaaagaaga 126

                                                         
Query: 132 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
           |||| | |||||| ||  |||||||| | |||||||| ||||||||
Sbjct: 127 aggcagcggatccatttgccaagaaggattggtatgatatcaaggc 172



to top

>gb|BT012853.1| Lycopersicon esculentum clone 113933F, mRNA sequence
          Length = 1053

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 227 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 286
           ||||||||||| |||||||| ||||| ||||||||||| || ||||| ||||| ||  | 
Sbjct: 222 acacagggtacaaagattgcttcagaaggcctgaagcatcgtgtgttcgaagtgtcattg 281

                         
Query: 287 gctgatcttcagaa 300
           ||||||||||||||
Sbjct: 282 gctgatcttcagaa 295



to top

>emb|BX822077.1|CNS0A7LX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 716

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 374 ttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagacc 433
           |||||||||||||| |||||||| || || || |||||  | || | |||||||||||| 
Sbjct: 68  ttctggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagact 127

                                                      
Query: 434 ctcattgaggctcatgtcgatgtgaagaccactgacaattaca 476
            | |||||||||||||| ||||| || ||||| |||| |||||
Sbjct: 128 ttgattgaggctcatgttgatgttaaaaccaccgacagttaca 170



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 499 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 558
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 193 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 252

                                 
Query: 559 cagacagatccgccggaagatg 580
           | | ||||||||| ||||||||
Sbjct: 253 ccgtcagatccgcaggaagatg 274



to top

>gb|AY857460.1| Suberites domuncula S3a mRNA, complete cds
          Length = 759

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 392 accactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtc 451
           ||||| ||||| |||||| | ||||| | ||| |||||||| || ||||||||  |||||
Sbjct: 313 accacagacaaactcagggcacttgtaaagaaatggcagactctgattgaggccaatgtc 372

                            
Query: 452 gatgtgaagaccactga 468
           ||||||||||| |||||
Sbjct: 373 gatgtgaagacaactga 389



to top

>ref|XM_568980.1| Cryptococcus neoformans var. neoformans JEC21 40s ribosomal protein
           s3ae-a (s1-a) (CNB04880) partial mRNA
          Length = 826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                       
Query: 74  accatggcggtcggcaggaacaagcgcatctccaaggggaggaagggtagcaagaagaag 133
           |||||||| ||||||| ||||||| |  | || ||||| | |||||| |  |||||||||
Sbjct: 10  accatggctgtcggcaagaacaagaggctttcaaagggaaagaagggaattaagaagaag 69

                                                       
Query: 134 gccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
           | ||| || || ||||||| |||| ||||||| |||||||||||
Sbjct: 70  gtcgtcgaccccttcaccaggaaggagtggtacgacatcaaggc 113



to top

>dbj|D26058.1|CTRCYC07A Catharanthus roseus cyc07 gene, exon1-7, complete cds
          Length = 4798

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                        
Query: 407  aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccact 466
            |||||||||||||||||||||||  || | || || |||||||| ||||| ||||| |||
Sbjct: 3458 aggtctcttgtgaggaagtggcaatccttgatagaagctcatgttgatgttaagacaact 3517

                
Query: 467  gaca 470
            ||||
Sbjct: 3518 gaca 3521



to top

>ref|XM_420443.1| PREDICTED: Gallus gallus similar to 40S ribosomal protein S3a
           (V-fos transformation effector protein) (LOC422477),
           mRNA
          Length = 1423

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 74  accatggcggtcggcaggaacaagcgcatctccaaggg 111
           |||||||||||||||| |||||||||| || |||||||
Sbjct: 661 accatggcggtcggcaagaacaagcgcctcaccaaggg 698



to top

>emb|AJ720257.1| Gallus gallus partial mRNA for hypothetical protein, clone 13j13
          Length = 107

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 74  accatggcggtcggcaggaacaagcgcatctccaaggg 111
           |||||||||||||||| |||||||||| || |||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgcctcaccaaggg 60



to top

>gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J14 genomic sequence, complete
             sequence
          Length = 93234

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                         
Query: 379   gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 438
             ||||||||| |||||||| || || || |||||  | || | ||||||||||||  | ||
Sbjct: 74315 gggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttgat 74256

                                                   
Query: 439   tgaggctcatgtcgatgtgaagaccactgacaattaca 476
             |||||||||||| ||||| || ||||| |||| |||||
Sbjct: 74255 tgaggctcatgttgatgttaaaaccaccgacagttaca 74218



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 499   cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaa 547
             |||||||||||||||  | |||||||||||| | |||||||| ||||||
Sbjct: 74195 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaa 74147



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                       
Query: 240   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttca 297
             ||||||||||||| ||| |||| ||| | || ||||| || ||||| |||||||||||
Sbjct: 74563 agattgcctcagaaggcttgaaacacagagtttttgaggtttctcttgctgatcttca 74506



to top

>gb|AF042107.1|AF042107 Eimeria tenella ribosomal protein S3a mRNA, complete cds
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 74  accatggcggtcggcaggaacaagcgcatctccaaggg 111
           |||||||||||||||| |||||||||| || |||||||
Sbjct: 4   accatggcggtcggcaagaacaagcgcctcaccaaggg 41



to top

>emb|X68555.1|ACKRPA A.californica KRP-A gene
          Length = 849

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 397 tgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgt 456
           |||||||||| | ||| | |||| |||||||||||| || ||||||||  |||| |||||
Sbjct: 330 tgacaagctctgctctatggtgaagaagtggcagactcttattgaggccaatgttgatgt 389

                 
Query: 457 gaagac 462
           ||||||
Sbjct: 390 gaagac 395



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 287 gctgatcttcagaacgatgagg 308
           ||||||||||||||||||||||
Sbjct: 223 gctgatcttcagaacgatgagg 244



to top

>gb|AY850276.1| Periplaneta americana Parcxpwex01 mRNA, complete cds
          Length = 893

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 227 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 286
           |||||||| || |||||||| ||||||||  ||||| || | ||||||||||| ||||| 
Sbjct: 162 acacagggcacaaagattgcgtcagagggtttgaagtacagagtgtttgaagtgtctctg 221

                 
Query: 287 gctgat 292
           ||||||
Sbjct: 222 gctgat 227



to top

>gb|BC058483.1| Rattus norvegicus ribosomal protein S3a, mRNA (cDNA clone MGC:72868
           IMAGE:6887884), complete cds
          Length = 896

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 422 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 462
           |||||||||||| | ||||| |||||||| |||||||||||
Sbjct: 375 aagtggcagaccatgattgaagctcatgttgatgtgaagac 415



to top

>ref|NM_017153.1| Rattus norvegicus ribosomal protein S3a (Rps3a), mRNA
          Length = 880

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 422 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 462
           |||||||||||| | ||||| |||||||| |||||||||||
Sbjct: 370 aagtggcagaccatgattgaagctcatgttgatgtgaagac 410



to top

>gb|AY151152.1| Ilyanassa obsoleta 40S ribosomal protein-like protein mRNA, partial
           cds
          Length = 489

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 421 gaagtggcagaccctcattgaggctcatgtcgatgtgaagaccac 465
           ||||||||||||||| || ||||| ||||| || |||||||||||
Sbjct: 36  gaagtggcagaccctgatcgaggcccatgtggacgtgaagaccac 80



to top

>emb|X75161.1|RNRNAS3A R.norvegicus (Sprague-Dawley) mRNA for ribosomal protein S3a
          Length = 880

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 422 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 462
           |||||||||||| | ||||| |||||||| |||||||||||
Sbjct: 370 aagtggcagaccatgattgaagctcatgttgatgtgaagac 410



to top

>gb|BC106115.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:117914
           IMAGE:2599128), complete cds
          Length = 870

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 12  accatggcggtcggcaagaacaagcgc 38



to top

>gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosome 13, complete
             sequence
          Length = 196911

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 74    accatggcggtcggcaggaacaagcgc 100
             |||||||||||||||| ||||||||||
Sbjct: 22654 accatggcggtcggcaagaacaagcgc 22628



to top

>gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, complete sequence
          Length = 212613

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 74    accatggcggtcggcaggaacaagcgc 100
             |||||||||||||||| ||||||||||
Sbjct: 81045 accatggcggtcggcaagaacaagcgc 81019



to top

>gb|BC084675.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102469
           IMAGE:5319512), complete cds
          Length = 869

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 14  accatggcggtcggcaagaacaagcgc 40



to top

>gb|BC083338.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102070
           IMAGE:6820218), complete cds
          Length = 861

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 3   accatggcggtcggcaagaacaagcgc 29



to top

>ref|XM_871858.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 4 (LOC613340), mRNA
          Length = 872

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 31  accatggcggtcggcaagaacaagcgc 57



to top

>ref|XM_863937.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 1 (LOC613340), mRNA
          Length = 910

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 32  accatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_871665.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 3 (LOC613340), mRNA
          Length = 587

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 17  accatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_871576.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 2 (LOC613340), mRNA
          Length = 717

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 6   accatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_872846.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 6
           (LOC613460), mRNA
          Length = 918

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>ref|XM_872754.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 5
           (LOC613460), mRNA
          Length = 862

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 17  accatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_593124.2| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 2
           (LOC613460), mRNA
          Length = 876

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>ref|XM_872539.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 4
           (LOC613460), mRNA
          Length = 584

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 17  accatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_872447.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 3
           (LOC613460), mRNA
          Length = 714

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 6   accatggcggtcggcaagaacaagcgc 32



to top

>gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosome 3, complete sequence
          Length = 192136

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 74    accatggcggtcggcaggaacaagcgc 100
             |||||||||||||||| ||||||||||
Sbjct: 21193 accatggcggtcggcaagaacaagcgc 21219



to top

>ref|NM_016959.2| Mus musculus ribosomal protein S3a (Rps3a), mRNA
          Length = 863

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>ref|XM_974769.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC674452), mRNA
          Length = 889

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>ref|XM_994545.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC668144), mRNA
          Length = 889

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>ref|XR_002919.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC544977), mRNA
          Length = 895

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>ref|XR_002253.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC668799), mRNA
          Length = 847

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 8   accatggcggtcggcaagaacaagcgc 34



to top

>ref|XR_005031.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC677290), mRNA
          Length = 853

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 8   accatggcggtcggcaagaacaagcgc 34



to top

>emb|BX039677.1|CNS092S1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 128 aagaaggccgtggatccgttcac 150
           |||||||||||||||||||||||
Sbjct: 80  aagaaggccgtggatccgttcac 102



to top

>emb|Z83368.1|MMRPS3A M.musculus RPS3a gene
          Length = 5695

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 842 accatggcggtcggcaagaacaagcgc 868



to top

>gb|BC081451.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102071
           IMAGE:6824188), complete cds
          Length = 872

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 10  accatggcggtcggcaagaacaagcgc 36



to top

>dbj|AK146304.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730048K19 product:ribosomal protein S3a, full
           insert sequence
          Length = 871

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 31  accatggcggtcggcaagaacaagcgc 57



to top

>dbj|AK135318.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
           region cDNA, RIKEN full-length enriched library,
           clone:6720473N01 product:ribosomal protein S3a, full
           insert sequence
          Length = 864

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 24  accatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK151982.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830044H24 product:ribosomal
           protein S3a, full insert sequence
          Length = 873

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>dbj|AK150814.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830015K17 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK150796.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830015H22 product:ribosomal
           protein S3a, full insert sequence
          Length = 873

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>dbj|AK148513.1| Mus musculus adult pancreas islet cells cDNA, RIKEN full-length
           enriched library, clone:C820015M15 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK151429.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830030B03 product:ribosomal
           protein S3a, full insert sequence
          Length = 864

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 24  accatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK150441.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830007K16 product:ribosomal
           protein S3a, full insert sequence
          Length = 862

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK166713.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0005O17 product:40S ribosomal protein
           S3a homolog [Mus musculus], full insert sequence
          Length = 865

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>dbj|AK153480.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830165N20 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK167562.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530022H01
           product:ribosomal protein S3a, full insert sequence
          Length = 862

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 22  accatggcggtcggcaagaacaagcgc 48



to top

>dbj|AK167512.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530018C11
           product:ribosomal protein S3a, full insert sequence
          Length = 870

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 24  accatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK159777.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420030N20 product:ribosomal protein S3a,
           full insert sequence
          Length = 869

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK168240.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730070G06 product:ribosomal protein S3a, full
           insert sequence
          Length = 868

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>dbj|AK010605.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410029J05 product:ribosomal protein S3a, full
           insert sequence
          Length = 860

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 20  accatggcggtcggcaagaacaagcgc 46



to top

>dbj|AK003158.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1100001E09 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK088113.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430004H05
           product:ribosomal protein S3a, full insert sequence
          Length = 860

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 20  accatggcggtcggcaagaacaagcgc 46



to top

>dbj|AK050610.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:C920016J02
           product:ribosomal protein S3a, full insert sequence
          Length = 862

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>gb|BC039659.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:49186
           IMAGE:5025347), complete cds
          Length = 877

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 22  accatggcggtcggcaagaacaagcgc 48



to top

>dbj|AK012345.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700038N16 product:ribosomal
           protein S3a, full insert sequence
          Length = 860

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 20  accatggcggtcggcaagaacaagcgc 46



to top

>gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, complete sequence
          Length = 164201

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 74    accatggcggtcggcaggaacaagcgc 100
             |||||||||||||||| ||||||||||
Sbjct: 92495 accatggcggtcggcaagaacaagcgc 92469



to top

>dbj|AK196258.1| Mus musculus cDNA, clone:Y1G0121E15, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000029722, based on BLAT search
          Length = 282

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 74  accatggcggtcggcaggaacaagcgc 100
           |||||||||||||||| ||||||||||
Sbjct: 9   accatggcggtcggcaagaacaagcgc 35



to top

>emb|CT571277.10| Mouse DNA sequence from clone RP24-327L5 on chromosome 14, complete
             sequence
          Length = 142749

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 74    accatggcggtcggcaggaacaagcgc 100
             |||||||||||||||| ||||||||||
Sbjct: 34612 accatggcggtcggcaagaacaagcgc 34586



to top

>emb|AL691416.9| Mouse DNA sequence from clone RP23-110I8 on chromosome 2, complete
              sequence
          Length = 208363

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 74     accatggcggtcggcaggaacaagcgc 100
              |||||||||||||||| ||||||||||
Sbjct: 155043 accatggcggtcggcaagaacaagcgc 155017



to top

>ref|XM_862563.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 13 (RPS3A), mRNA
          Length = 1051

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 7   ccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_862552.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 12 (RPS3A), mRNA
          Length = 1051

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 7   ccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_862541.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 11 (RPS3A), mRNA
          Length = 852

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 51  ccatggcggtcggcaagaacaagcgc 76



to top

>ref|XM_862533.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 10 (RPS3A), mRNA
          Length = 1065

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 19  ccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_862525.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 9 (RPS3A), mRNA
          Length = 1056

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 50  ccatggcggtcggcaagaacaagcgc 75



to top

>ref|XM_862515.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 8 (RPS3A), mRNA
          Length = 982

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_862504.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 7 (RPS3A), mRNA
          Length = 912

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_862496.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 6 (RPS3A), mRNA
          Length = 876

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 20  ccatggcggtcggcaagaacaagcgc 45



to top

>ref|XM_534275.2| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 1 (RPS3A), mRNA
          Length = 1106

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 62  ccatggcggtcggcaagaacaagcgc 87



to top

>ref|XM_862466.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 4 (RPS3A), mRNA
          Length = 769

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 17  ccatggcggtcggcaagaacaagcgc 42



to top

>ref|XM_862454.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 3 (RPS3A), mRNA
          Length = 774

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 50  ccatggcggtcggcaagaacaagcgc 75



to top

>ref|XM_862446.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 2 (RPS3A), mRNA
          Length = 553

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 19  ccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_860742.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 7 (LOC609500), mRNA
          Length = 875

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860726.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 6 (LOC609500), mRNA
          Length = 857

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860710.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 5 (LOC609500), mRNA
          Length = 866

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_860701.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC609500), mRNA
          Length = 1072

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860686.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 3 (LOC609500), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_847366.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC609500), mRNA
          Length = 1069

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_860652.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC609500), mRNA
          Length = 760

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 16  ccatggcggtcggcaagaacaagcgc 41



to top

>ref|XM_856691.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 12 (LOC608454), mRNA
          Length = 874

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856663.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 11 (LOC608454), mRNA
          Length = 875

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856635.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 10 (LOC608454), mRNA
          Length = 879

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856605.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 9 (LOC608454), mRNA
          Length = 883

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856573.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 8 (LOC608454), mRNA
          Length = 883

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856546.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 7 (LOC608454), mRNA
          Length = 882

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856515.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 6 (LOC608454), mRNA
          Length = 1042

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 10  ccatggcggtcggcaagaacaagcgc 35



to top

>ref|XM_856484.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 5 (LOC608454), mRNA
          Length = 1047

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 15  ccatggcggtcggcaagaacaagcgc 40



to top

>ref|XM_856455.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC608454), mRNA
          Length = 1080

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_845382.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC608454), mRNA
          Length = 1058

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 26  ccatggcggtcggcaagaacaagcgc 51



to top

>ref|XM_856398.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 3 (LOC608454), mRNA
          Length = 901

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 19  ccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_535263.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC608454), mRNA
          Length = 759

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 75  ccatggcggtcggcaggaacaagcgc 100
           ||||||||||||||| ||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_855284.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 6 (LOC607824), mRNA
          Length = 844

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagac 462
           ||||||||| | ||||| |||||||| |||||||||||
Sbjct: 355 tggcagaccatgattgaagctcatgttgatgtgaagac 392



to top

>ref|XM_855250.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 5 (LOC607824), mRNA
          Length = 1060

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagac 462
           ||||||||| | ||||| |||||||| |||||||||||
Sbjct: 355 tggcagaccatgattgaagctcatgttgatgtgaagac 392



to top

>ref|XM_855221.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC607824), mRNA
          Length = 1042

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagac 462
           ||||||||| | ||||| |||||||| |||||||||||
Sbjct: 337 tggcagaccatgattgaagctcatgttgatgtgaagac 374



to top

>gb|AC114663.8| Mus musculus chromosome 1, clone RP24-172O22, complete sequence
          Length = 167652

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 399    acaagctcaggtctcttgtgaggaagtgg 427
              |||||| ||||||||||| ||||||||||
Sbjct: 146589 acaagcccaggtctcttgagaggaagtgg 146617



to top

>gb|AY596294.1| Haloarcula marismortui ATCC 43049 plasmid pNG500, complete sequence
          Length = 132678

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 211   gaccctcgtgtccaggacaca 231
             |||||||||||||||||||||
Sbjct: 26758 gaccctcgtgtccaggacaca 26738



to top

>gb|AC158967.5| Mus musculus chromosome 1, clone RP23-39N17, complete sequence
          Length = 244130

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 399    acaagctcaggtctcttgtgaggaagtgg 427
              |||||| ||||||||||| ||||||||||
Sbjct: 238451 acaagcccaggtctcttgagaggaagtgg 238479



to top

>ref|XM_458876.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0D10395g)
           partial mRNA
          Length = 771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 125 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
           |||||||||| | | || || |||||||||||| | |||| ||||||||||||
Sbjct: 49  aagaagaaggtcatcgaccctttcaccaagaaggaatggtttgacatcaaggc 101



to top

>ref|XM_950881.1| Neurospora crassa OR74A hypothetical protein (NCU01452.1) partial
           mRNA
          Length = 1014

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 108/137 (78%)
 Strand = Plus / Plus

                                                                       
Query: 389 ttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcat 448
           |||||| | ||||||||| | || |||||  | ||||||||||| |||||||||||  | 
Sbjct: 556 ttcacctccgacaagctccgctcgcttgtccgcaagtggcagactctcattgaggccaac 615

                                                                       
Query: 449 gtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaag 508
            ||   || |||||||| ||| | ||| | |||||| | || ||||||| ||||||||||
Sbjct: 616 atcaccgtcaagaccaccgacgactacctcctccgcctcttcgccattgccttcaccaag 675

                            
Query: 509 agacgcccaaaccaggt 525
            | ||||| ||||||||
Sbjct: 676 cgccgccctaaccaggt 692



to top

>ref|XM_327890.1| Neurospora crassa OR74A hypothetical protein (NCU01452.1) partial
           mRNA
          Length = 1014

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 108/137 (78%)
 Strand = Plus / Plus

                                                                       
Query: 389 ttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcat 448
           |||||| | ||||||||| | || |||||  | ||||||||||| |||||||||||  | 
Sbjct: 556 ttcacctccgacaagctccgctcgcttgtccgcaagtggcagactctcattgaggccaac 615

                                                                       
Query: 449 gtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaag 508
            ||   || |||||||| ||| | ||| | |||||| | || ||||||| ||||||||||
Sbjct: 616 atcaccgtcaagaccaccgacgactacctcctccgcctcttcgccattgccttcaccaag 675

                            
Query: 509 agacgcccaaaccaggt 525
            | ||||| ||||||||
Sbjct: 676 cgccgccctaaccaggt 692



to top

>ref|XM_534831.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC608748), mRNA
          Length = 886

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 422 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 462
           |||||||||||| | ||||| |||||||| ||||| |||||
Sbjct: 374 aagtggcagaccatgattgaagctcatgttgatgtaaagac 414



to top

>ref|XM_748992.1| Aspergillus fumigatus Af293 ribosomal protein S0.e.B, cytosolic
           (Afu5g05450) partial mRNA
          Length = 771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 499 cttcaccaagagacgcccaaaccag 523
           |||||||||||||||||| ||||||
Sbjct: 423 cttcaccaagagacgcccgaaccag 447



to top

>ref|XM_446571.1| Candida glabrata CBS138, CAGL0G04851g partial mRNA
          Length = 1101

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 115  gaagggtagcaagaagaaggc 135
            |||||||||||||||||||||
Sbjct: 990  gaagggtagcaagaagaaggc 1010



to top

>emb|Z32681.1|CEF56F3 Caenorhabditis elegans Cosmid F56F3, complete sequence
          Length = 29039

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                  
Query: 125   aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
             |||||||||||||||||||| ||| ||   ||| | ||||| |||||||||||
Sbjct: 23554 aagaagaaggccgtggatccattctcccgcaaggaatggtacgacatcaaggc 23606



to top

>gb|BC047260.1| Xenopus laevis ribosomal protein S3a, mRNA (cDNA clone MGC:53968
           IMAGE:5570910), complete cds
          Length = 867

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 465
           ||||||||| | ||||| || ||||| ||||||||||||||
Sbjct: 360 tggcagaccatgattgaagcccatgttgatgtgaagaccac 400



to top

>ref|NM_001008074.1| Xenopus tropicalis rps3a protein (rps3a), mRNA
          Length = 922

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 465
           ||||||||| | ||||| || ||||| ||||||||||||||
Sbjct: 356 tggcagaccatgattgaagcacatgttgatgtgaagaccac 396



to top

>gb|BC080969.1| Xenopus tropicalis rps3a protein, mRNA (cDNA clone MGC:79742
           IMAGE:6983416), complete cds
          Length = 922

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 465
           ||||||||| | ||||| || ||||| ||||||||||||||
Sbjct: 356 tggcagaccatgattgaagcacatgttgatgtgaagaccac 396



to top

>emb|BX067685.1|CNS09OE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 130 gaaggccgtggatccgttcac 150
           |||||||||||||||||||||
Sbjct: 68  gaaggccgtggatccgttcac 88



to top

>emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS767 of Debaryomyces
              hansenii
          Length = 1602771

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 125    aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
              |||||||||| | | || || |||||||||||| | |||| ||||||||||||
Sbjct: 772733 aagaagaaggtcatcgaccctttcaccaagaaggaatggtttgacatcaaggc 772681



to top

>emb|CR380953.1| Candida glabrata strain CBS138 chromosome G complete sequence
          Length = 992211

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 115    gaagggtagcaagaagaaggc 135
              |||||||||||||||||||||
Sbjct: 462782 gaagggtagcaagaagaaggc 462762



to top

>emb|BX294022.1|NCB11C21 Neurospora crassa DNA linkage group V BAC clone B11C21
          Length = 62209

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 108/137 (78%)
 Strand = Plus / Minus

                                                                         
Query: 389   ttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcat 448
             |||||| | ||||||||| | || |||||  | ||||||||||| |||||||||||  | 
Sbjct: 41524 ttcacctccgacaagctccgctcgcttgtccgcaagtggcagactctcattgaggccaac 41465

                                                                         
Query: 449   gtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaag 508
              ||   || |||||||| ||| | ||| | |||||| | || ||||||| ||||||||||
Sbjct: 41464 atcaccgtcaagaccaccgacgactacctcctccgcctcttcgccattgccttcaccaag 41405

                              
Query: 509   agacgcccaaaccaggt 525
              | ||||| ||||||||
Sbjct: 41404 cgccgccctaaccaggt 41388



to top

>dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009
          Length = 1913118

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                        
Query: 88      caggaacaagcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatcc 144
               ||||||||||||| | || ||||| | |||||||| |||||||| | |||| |||||
Sbjct: 1909636 caggaacaagcgcttgtcgaagggcaagaagggtatcaagaagaggaccgttgatcc 1909692



to top

>gb|DQ066297.1| Ixodes scapularis isolate is-all-378 40S ribosomal protein S3a
           mRNA, complete cds
          Length = 813

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                       
Query: 421 gaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgct 480
           |||||||||||| || ||||||||    |||||||||| ||| || |||   ||| ||||
Sbjct: 345 gaagtggcagacgctgattgaggccacggtcgatgtgaggacaacggacggctacctgct 404

                                        
Query: 481 ccgcatgtttgccattggcttcaccaaga 509
           |||||||||   ||| |||||||||||||
Sbjct: 405 ccgcatgttctgcatcggcttcaccaaga 433



to top

>gb|AF379639.1|AF379639 Heliothis virescens ribosomal protein S3a mRNA, partial cds
          Length = 794

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 380 ggcatggatttcaccactgacaagctcag 408
           ||||||||  |||||||||||||||||||
Sbjct: 271 ggcatggacctcaccactgacaagctcag 299



to top

>ref|NM_065509.3| Caenorhabditis elegans Ribosomal Protein, Small subunit family
           member (rps-1) (rps-1) mRNA, complete cds
          Length = 838

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 125 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 177
           |||||||||||||||||||| ||| ||   ||| | ||||| |||||||||||
Sbjct: 75  aagaagaaggccgtggatccattctcccgcaaggaatggtacgacatcaaggc 127



to top

>ref|XM_392119.2| PREDICTED: Apis mellifera similar to Phosphatidylinositol 3-kinase
           regulatory alpha subunit (PI3-kinase p85-alpha subunit)
           (PtdIns-3-kinase p85-alpha) (PI3K) (LOC408577), mRNA
          Length = 4102

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 465 ctgacaattacatgctccgca 485
           |||||||||||||||||||||
Sbjct: 260 ctgacaattacatgctccgca 280



to top

>gb|AF429977.1| Spodoptera frugiperda ribosomal protein S3A mRNA, complete cds
          Length = 873

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 380 ggcatggatttcaccactgacaagctcag 408
           ||||||||  |||||||||||||||||||
Sbjct: 337 ggcatggacctcaccactgacaagctcag 365



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 34     ctccacccgccgcagcgccgc 54
              |||||||||||||||||||||
Sbjct: 516397 ctccacccgccgcagcgccgc 516417



 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 36      ccacccgccgcagcgccgcc 55
               ||||||||||||||||||||
Sbjct: 3214356 ccacccgccgcagcgccgcc 3214375



to top

>gb|AF056328.1|AF056328 Oryzias latipes V-Fos transformation effector (fte-1) mRNA,
           complete cds
          Length = 873

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 421 gaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 469
           ||||||||||||| | ||||| || || || || |||||||||||||||
Sbjct: 361 gaagtggcagaccatgattgaagcccacgtggacgtgaagaccactgac 409



to top

>emb|CR760859.2| Xenopus tropicalis finished cDNA, clone TTpA010n05
          Length = 863

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 425 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 465
           ||||||||| | ||||| || ||||| ||||||||||||||
Sbjct: 353 tggcagaccatgattgaagcacatgttgatgtgaagaccac 393



to top

>gb|AC113456.9| Mus musculus chromosome 1, clone RP23-257E16, complete sequence
          Length = 174902

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 399    acaagctcaggtctcttgtgaggaagtgg 427
              |||||| ||||||||||| ||||||||||
Sbjct: 152024 acaagcccaggtctcttgagaggaagtgg 151996



to top

>gb|M84716.1|RATVFOSPR R.norvegicus putative v-fos transformation effector protein (Fte-1)
           mRNA, complete cds
          Length = 860

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 422 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 462
           |||||||||||| | ||||| |||||||| || ||||||||
Sbjct: 364 aagtggcagaccatgattgaagctcatgttgacgtgaagac 404



to top

>ref|XM_475184.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1437

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 36   ccacccgccgcagcgccgcc 55
            ||||||||||||||||||||
Sbjct: 1288 ccacccgccgcagcgccgcc 1269



to top

>gb|DQ214673.1| Taeniopygia guttata clone 0061P0008B04 ribosomal protein S3a-like
           mRNA, complete sequence
          Length = 922

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 76  catggcggtcggcaggaacaagcgcatctccaaggg 111
           |||||||||||| | |||||||||| || |||||||
Sbjct: 43  catggcggtcgggaagaacaagcgcctcaccaaggg 78



to top

>gb|DQ214671.1| Taeniopygia guttata clone 0058P0045E12 ribosomal protein S3a-like
           mRNA, complete sequence
          Length = 893

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 76  catggcggtcggcaggaacaagcgcatctccaaggg 111
           |||||||||||| | |||||||||| || |||||||
Sbjct: 40  catggcggtcgggaagaacaagcgcctcaccaaggg 75



to top

>gb|DQ214668.1| Taeniopygia guttata clone 0063P0025A12 ribosomal protein S3a-like
           mRNA, complete sequence
          Length = 630

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 76  catggcggtcggcaggaacaagcgcatctccaaggg 111
           |||||||||||| | |||||||||| || |||||||
Sbjct: 24  catggcggtcgggaagaacaagcgcctcaccaaggg 59



to top

>ref|XM_473036.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1038

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 184  gctcttcaccagccgcaacgtcggcaag 211
            ||||||| || |||||||||||||||||
Sbjct: 984  gctcttctccggccgcaacgtcggcaag 1011



to top

>gb|AC125735.1| Leishmania major strain Friedlin chromosome 3, complete sequence
          Length = 384518

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 190    caccagccgcaacgtcggca 209
              ||||||||||||||||||||
Sbjct: 301181 caccagccgcaacgtcggca 301162



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 190     caccagccgcaacgtcggca 209
               ||||||||||||||||||||
Sbjct: 5566815 caccagccgcaacgtcggca 5566834



to top

>ref|XM_612939.2| PREDICTED: Bos taurus similar to catenin (cadherin-associated
            protein), delta 2 (neural plakophilin-related arm-repeat
            protein) (LOC533509), mRNA
          Length = 2298

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 479  ctccgcatgtttgccattggcttcacca 506
            |||||||| |||||||||||| ||||||
Sbjct: 1362 ctccgcatctttgccattggcctcacca 1335



to top

>gb|AC105773.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1562_H01,
             complete sequence
          Length = 88352

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    ccacccgccgcagcgccgcc 55
             ||||||||||||||||||||
Sbjct: 47708 ccacccgccgcagcgccgcc 47727



to top

>gb|AC119954.12| Mus musculus chromosome 1, clone RP24-450P2, complete sequence
          Length = 179212

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 387    atttcaccactgacaagctc 406
              ||||||||||||||||||||
Sbjct: 143375 atttcaccactgacaagctc 143356



to top

>ref|XM_875949.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 8
          (LOC613769), mRNA
          Length = 900

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 74 accatggcggtcggcaggaacaag 97
          |||||||||||||||| |||||||
Sbjct: 49 accatggcggtcggcaagaacaag 72



to top

>ref|XM_875867.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 7
          (LOC613769), mRNA
          Length = 879

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 74 accatggcggtcggcaggaacaag 97
          |||||||||||||||| |||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>ref|XM_875801.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 6
          (LOC613769), mRNA
          Length = 884

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 74 accatggcggtcggcaggaacaag 97
          |||||||||||||||| |||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>ref|XM_875730.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 5
          (LOC613769), mRNA
          Length = 871

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 74 accatggcggtcggcaggaacaag 97
          |||||||||||||||| |||||||
Sbjct: 20 accatggcggtcggcaagaacaag 43



to top

>ref|XM_875654.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 4
          (LOC613769), mRNA
          Length = 890

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 74 accatggcggtcggcaggaacaag 97
          |||||||||||||||| |||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>ref|XM_875583.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 3
          (LOC613769), mRNA
          Length = 878

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 74 accatggcggtcggcaggaacaag 97
          |||||||||||||||| |||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>ref|XM_865235.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
          transformation effector protein), transcript variant 2
          (LOC613769), mRNA
          Length = 876

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 74 accatggcggtcggcaggaacaag 97
          |||||||||||||||| |||||||
Sbjct: 39 accatggcggtcggcaagaacaag 62



to top

>gb|AC140314.2| Mus musculus BAC clone RP23-395L3 from chromosome 12, complete sequence
          Length = 191322

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 575    aagatggttgagatcatggt 594
              ||||||||||||||||||||
Sbjct: 136931 aagatggttgagatcatggt 136950



to top

>gb|AC160529.6| Mus musculus chromosome 1, clone RP24-141F19, complete sequence
          Length = 167687

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 387   atttcaccactgacaagctc 406
             ||||||||||||||||||||
Sbjct: 89646 atttcaccactgacaagctc 89665



to top

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 34      ctccacccgccgcagcgccg 53
               ||||||||||||||||||||
Sbjct: 4627694 ctccacccgccgcagcgccg 4627713



to top

>gb|AC126433.3| Mus musculus BAC clone RP24-468I23 from chromosome 17, complete
             sequence
          Length = 165036

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 427   gcagaccctcattgaggctcatgt 450
             ||||||||||||| ||||||||||
Sbjct: 49123 gcagaccctcattcaggctcatgt 49100



to top

>gb|AC109612.22| Mus musculus strain C57BL/6J clone rp23-37i3 map 17, complete sequence
          Length = 179382

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 491    gccattggcttcaccaagag 510
              ||||||||||||||||||||
Sbjct: 109671 gccattggcttcaccaagag 109690



to top

>ref|XM_505043.1| Yarrowia lipolytica CLIB122, YALI0F05676g predicted mRNA
          Length = 744

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 201 acgtcggcaagaccctcgtg 220
           ||||||||||||||||||||
Sbjct: 101 acgtcggcaagaccctcgtg 120



to top

>ref|XM_778340.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein S3a (LOC578151), mRNA
          Length = 764

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 566 atccgccggaagatggttgagatcatgg 593
           |||||| |||||||| ||||||||||||
Sbjct: 256 atccgcaggaagatgattgagatcatgg 283



to top

>gb|AC104783.3| Homo sapiens BAC clone RP11-36G9 from 4, complete sequence
          Length = 28480

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 356  atgaatgtcctcacaaactt 375
            ||||||||||||||||||||
Sbjct: 4827 atgaatgtcctcacaaactt 4846



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 184      gctcttcaccagccgcaacgtcggcaag 211
                ||||||| || |||||||||||||||||
Sbjct: 24833587 gctcttctccggccgcaacgtcggcaag 24833560



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 36       ccacccgccgcagcgccgcc 55
                ||||||||||||||||||||
Sbjct: 18742305 ccacccgccgcagcgccgcc 18742324



to top

>emb|AJ563455.1|CGI563455 Crassostrea gigas partial mRNA for ribosomal protein S3a (rps3a
           gene)
          Length = 792

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 441 aggctcatgtcgatgtgaagaccactga 468
           |||||||||| ||||| |||||||||||
Sbjct: 368 aggctcatgttgatgtcaagaccactga 395



to top

>dbj|AK109382.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-210-F02, full
            insert sequence
          Length = 1343

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 184  gctcttcaccagccgcaacgtcggcaag 211
            ||||||| || |||||||||||||||||
Sbjct: 1092 gctcttctccggccgcaacgtcggcaag 1119



to top

>dbj|AK069136.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008C06, full
            insert sequence
          Length = 1269

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 184  gctcttcaccagccgcaacgtcggcaag 211
            ||||||| || |||||||||||||||||
Sbjct: 1030 gctcttctccggccgcaacgtcggcaag 1057



to top

>emb|AJ249414.1|MMU249414 Mus musculus partial PI3Kgamma gene for phosphoinositide 3-kinase
           gamma, exons 3-4
          Length = 1777

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 575 aagatggttgagatcatggt 594
           ||||||||||||||||||||
Sbjct: 934 aagatggttgagatcatggt 915



to top

>dbj|AB092486.1| Gallus gallus gene for iron-responsive element-binding protein, exon
            sequence
          Length = 6946

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 358  gaatgtcctcacaaacttctgggg 381
            ||||||||||| ||||||||||||
Sbjct: 3631 gaatgtcctcataaacttctgggg 3654



to top

>emb|AL845344.4|CNS08CB6 Oryza sativa chromosome 12, . BAC OSJNBb0108O14 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 138585

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 34    ctccacccgccgcagcgccgccac 57
             ||||||||||||| ||||||||||
Sbjct: 77037 ctccacccgccgccgcgccgccac 77014



to top

>emb|AL606627.3|OSJN00052 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0067K08,
             complete sequence
          Length = 170765

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 184   gctcttcaccagccgcaacgtcggcaag 211
             ||||||| || |||||||||||||||||
Sbjct: 95303 gctcttctccggccgcaacgtcggcaag 95276



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 201    acgtcggcaagaccctcgtg 220
              ||||||||||||||||||||
Sbjct: 843013 acgtcggcaagaccctcgtg 842994


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,438,787
Number of Sequences: 3902068
Number of extensions: 4438787
Number of successful extensions: 81837
Number of sequences better than 10.0: 227
Number of HSP's better than 10.0 without gapping: 226
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 80850
Number of HSP's gapped (non-prelim): 949
length of query: 600
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 577
effective length of database: 17,143,297,704
effective search space: 9891682775208
effective search space used: 9891682775208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top