>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete
               sequence
          Length = 2105742

 Score = 42.1 bits (21), Expect = 0.34
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 58      taataagtctatcaaggcatt 78
               |||||||||||||||||||||
Sbjct: 1874031 taataagtctatcaaggcatt 1874051

>gb|AC079942.12| Homo sapiens 3 BAC RP11-469L4 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 171832

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 89   tgacccatattagctactta 108
            ||||||||||||||||||||
Sbjct: 9114 tgacccatattagctactta 9095

>gb|AC116853.12| Mus musculus chromosome 1, clone RP24-400M20, complete sequence
          Length = 188514

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 40    aagaaaattatagacgaataata 62
             ||||||||||||||| |||||||
Sbjct: 99319 aagaaaattatagaccaataata 99297

>gb|AC158552.5| Mus musculus chromosome 3, clone RP23-97D22, complete sequence
          Length = 235709

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 40     aagaaaattatagacgaataata 62
              |||||||||||||| ||||||||
Sbjct: 141339 aagaaaattatagatgaataata 141317

>gb|AC099468.9| Rattus norvegicus 1 BAC CH230-37P5 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 212177

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     tattgtggccaagaataca 19
             |||||||||||||||||||
Sbjct: 30305 tattgtggccaagaataca 30323

>gb|AC147633.3| Mus musculus BAC clone RP23-302B3 from chromosome 13, complete sequence
          Length = 218640

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     atactgatcttaagaaaat 47
              |||||||||||||||||||
Sbjct: 113709 atactgatcttaagaaaat 113691

>gb|AC121880.2| Mus musculus BAC clone RP24-132E6 from 13, complete sequence
          Length = 143546

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 29   atactgatcttaagaaaat 47
            |||||||||||||||||||
Sbjct: 5824 atactgatcttaagaaaat 5842

>ref|XM_725788.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY02928)
           partial mRNA
          Length = 930

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 39  taagaaaattatagacgaa 57
           |||||||||||||||||||
Sbjct: 387 taagaaaattatagacgaa 405

>emb|BX649495.8| Zebrafish DNA sequence from clone DKEY-177B16 in linkage group 2,
             complete sequence
          Length = 81705

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     ttgtggccaagaatacact 21
             |||||||||||||||||||
Sbjct: 57579 ttgtggccaagaatacact 57597

>gb|AC092295.2| Homo sapiens chromosome 19 clone CTD-2630F21, complete sequence
          Length = 165566

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     gttttgcatactgatctta 40
              |||||||||||||||||||
Sbjct: 113933 gttttgcatactgatctta 113915

>gb|AC074138.5| Homo sapiens chromosome 19 clone CTD-3234P18, complete sequence
          Length = 200418

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 22    gttttgcatactgatctta 40
             |||||||||||||||||||
Sbjct: 21203 gttttgcatactgatctta 21185

>gb|AC023206.6| Homo sapiens chromosome 11, clone RP11-797J4, complete sequence
          Length = 208561

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 30     tactgatcttaagaaaatt 48
              |||||||||||||||||||
Sbjct: 151545 tactgatcttaagaaaatt 151563

>dbj|AP006346.1| Marsupenaeus japonicus mitochondrial DNA, complete genome
          Length = 15968

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 86   tcatgacccatattagcta 104
            |||||||||||||||||||
Sbjct: 9625 tcatgacccatattagcta 9643

>gb|AC154460.2| Mus musculus BAC clone RP24-163G22 from chromosome 13, complete sequence
          Length = 197149

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 83     tgttcatgacccatattag 101
              |||||||||||||||||||
Sbjct: 167820 tgttcatgacccatattag 167838

>gb|AC009756.9|AC009756 Homo sapiens, clone RP11-45P2, complete sequence
          Length = 178624

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 22     gttttgcatactgatctta 40
              |||||||||||||||||||
Sbjct: 119379 gttttgcatactgatctta 119361

>emb|AL953896.11| Zebrafish DNA sequence from clone CH211-119O8, complete sequence
          Length = 158018

 Score = 38.2 bits (19), Expect = 5.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 3     ttgtggccaagaatacact 21
             |||||||||||||||||||
Sbjct: 45477 ttgtggccaagaatacact 45495


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,020,645
Number of Sequences: 3902068
Number of extensions: 1020645
Number of successful extensions: 69059
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69031
Number of HSP's gapped (non-prelim): 28
length of query: 116
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 95
effective length of database: 17,151,101,840
effective search space: 1629354674800
effective search space used: 1629354674800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)