Clone Name	bart55b09
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	98	4e-17
2	dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic D...	98	4e-17
3	dbj|AK066582.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	4e-17
4	dbj|AK106416.1| Oryza sativa (japonica cultivar-group) cDNA clon...	90	1e-14
5	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	48	0.033
6	dbj|AP004464.3| Oryza sativa (japonica cultivar-group) genomic D...	48	0.033
7	dbj|AK121123.1| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.033
8	ref|NM_111697.2| Arabidopsis thaliana unknown protein AT3G08630 ...	46	0.13
9	ref|XM_550107.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.13
10	ref|XM_469780.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.13
11	ref|XM_468431.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.13
12	gb|AF377947.3| Oryza sativa (japonica cultivar-group) chromosome...	46	0.13
13	gb|BT012416.1| Arabidopsis thaliana At3g08630 mRNA, complete cds	46	0.13
14	gb|BT012218.1| Arabidopsis thaliana At3g08630 gene, complete cds	46	0.13
15	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	46	0.13
16	gb|AC092556.8| Oryza sativa chromosome 3 BAC OSJNBa0047E24 genom...	46	0.13
17	ref|XM_542999.2| PREDICTED: Canis familiaris similar to zinc fin...	46	0.13
18	gb|AC135225.4| Oryza sativa chromosome 3 BAC OJ1112_G08 genomic ...	46	0.13
19	emb|AL606601.3|OSJN00029 Oryza sativa genomic DNA, chromosome 4,...	46	0.13
20	gb|AC079075.6| Homo sapiens chromosome 15, clone RP11-300G22, co...	46	0.13
21	gb|AC013787.15| Homo sapiens chromosome 15, clone RP11-531E13, c...	46	0.13
22	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.13
23	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.13
24	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.13
25	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.13
26	emb|AL606597.4|OSJN00042 Oryza sativa genomic DNA, chromosome 4,...	46	0.13
27	emb|BX822126.1|CNS0A5W1 Arabidopsis thaliana Full-length cDNA Co...	46	0.13
28	gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17...	46	0.13
29	dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic D...	46	0.13
30	dbj|AP003311.2| Oryza sativa (japonica cultivar-group) genomic D...	46	0.13
31	dbj|AP004878.3| Oryza sativa (japonica cultivar-group) genomic D...	46	0.13
32	dbj|AP004048.3| Oryza sativa (japonica cultivar-group) genomic D...	46	0.13
33	ref|NM_106208.1| Arabidopsis thaliana unknown protein AT1G75550 ...	44	0.52
34	ref|XM_629930.1| Dictyostelium discoideum hypothetical protein (...	44	0.52
35	ref|XM_629783.1| Dictyostelium discoideum hypothetical protein (...	44	0.52
36	ref|XM_468447.1| Oryza sativa (japonica cultivar-group), mRNA	44	0.52
37	gb|AC159381.10| Mus musculus 6 BAC RP24-460E4 (Roswell Park Canc...	44	0.52
38	ref|XM_463087.1| Oryza sativa (japonica cultivar-group), mRNA	44	0.52
39	ref|NM_196163.1| Oryza sativa (japonica cultivar-group) putative...	44	0.52
40	ref|XM_469589.1| Oryza sativa (japonica cultivar-group), mRNA	44	0.52
41	gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome...	44	0.52
42	emb|CR974571.9| Mouse DNA sequence from clone RP23-145P19 on chr...	44	0.52
43	ref|XM_568769.1| Cryptococcus neoformans var. neoformans JEC21 n...	44	0.52
44	emb|CT009545.5| M.truncatula DNA sequence from clone MTH2-107B14...	44	0.52
45	gb|AC137921.2| Oryza sativa chromosome 3 BAC OSJNBa0027H16 genom...	44	0.52
46	gb|AC137997.2| Oryza sativa chromosome 3 BAC OJ1499_D04 genomic ...	44	0.52
47	gb|AC006651.2| Caenorhabditis elegans fosmid H06I04, complete se...	44	0.52
48	gb|AY346329.1| Oryza sativa (indica cultivar-group) homeodomain ...	44	0.52
49	gb|CP000317.1| Polaromonas sp. JS666 plasmid 1, complete sequence	44	0.52
50	gb|BC057510.1| Danio rerio zgc:66306, mRNA (cDNA clone MGC:66306...	44	0.52
51	gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr...	44	0.52
52	ref|NM_200662.1| Danio rerio zgc:66306 (zgc:66306), mRNA	44	0.52
53	gb|AC010033.8| Drosophila melanogaster 3L BAC RP98-3I5 (Roswell ...	44	0.52
54	tpg|BK002084.1| TPA: TPA_inf: Drosophila melanogaster HDC09626 (...	44	0.52
55	ref|NM_206329.1| Drosophila melanogaster CG33269-PA (CG33269) mR...	44	0.52
56	ref|NM_206328.1| Drosophila melanogaster CG33270-PA (CG33270) mR...	44	0.52
57	ref|NM_206327.1| Drosophila melanogaster CG33271-PA (CG33271) mR...	44	0.52
58	ref|NM_206323.1| Drosophila melanogaster CG33272-PA (CG33272) mR...	44	0.52
59	gb|AC079935.3| Genomic sequence for Oryza sativa (japonica culti...	44	0.52
60	gb|AC153362.4| Mus musculus BAC clone RP23-92N20 from chromosome...	44	0.52
61	ref|NM_065254.3| Caenorhabditis elegans H06I04.3a (H06I04.3) mRN...	44	0.52
62	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.52
63	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.52
64	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	44	0.52
65	gb|AY190960.1| Drosophila pseudoobscura clone DPSF01_12_K22 (D14...	44	0.52
66	gb|AC006434.5|AC006434 Genomic sequence for Arabidopsis thaliana...	44	0.52
67	dbj|AP004020.3| Oryza sativa (japonica cultivar-group) genomic D...	44	0.52
68	dbj|AP003608.3| Oryza sativa (japonica cultivar-group) genomic D...	44	0.52
69	dbj|AK101749.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.52
70	gb|AE003544.4| Drosophila melanogaster chromosome 3L, section 41...	44	0.52
71	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	44	0.52
72	gb|AC004438.1|AC004438 Drosophila melanogaster DNA sequence (P1 ...	44	0.52
73	emb|AL669913.15| Mouse DNA sequence from clone RP23-479C2 on chr...	44	0.52
74	dbj|AP006552.1| Lotus japonicus genomic DNA, chromosome 1, clone...	44	0.52
75	dbj|AP006551.1| Lotus japonicus genomic DNA, chromosome 1, clone...	44	0.52
76	gb|AC142105.7| Mus musculus BAC clone RP24-240E7 from chromosome...	44	0.52
77	emb|AL844513.8| Mouse DNA sequence from clone RP23-132A3 on chro...	44	0.52
78	emb|X01918.1|DMSGS378 Drosophila 68C glue gene cluster	44	0.52
79	gb|M14650.1|DROGBR D.melanogaster glue gene cluster 68C boundary...	44	0.52
80	gb|AY841017.1| Aegilops triuncialis low-molecular-weight gluteni...	42	2.1
81	gb|AY841014.1| Aegilops tauschii low-molecular-weight glutenin s...	42	2.1
82	gb|AY841013.1| Aegilops tauschii low-molecular-weight glutenin s...	42	2.1
83	gb|AC107851.17| Mus musculus chromosome 9, clone RP23-451B4, com...	42	2.1
84	gb|AY829369.1| Secale sylvestre clone S16-23 low molecular weigh...	42	2.1
85	gb|AY829368.1| Secale sylvestre clone S16-12 low molecular weigh...	42	2.1
86	ref|XM_641784.1| Dictyostelium discoideum hypothetical protein (...	42	2.1
87	ref|XM_641505.1| Dictyostelium discoideum putative BRD family pr...	42	2.1
88	ref|XM_640949.1| Dictyostelium discoideum hypothetical protein (...	42	2.1
89	ref|XM_639826.1| Dictyostelium discoideum hypothetical protein (...	42	2.1
90	ref|XM_639952.1| Dictyostelium discoideum cAMP-binding protein (...	42	2.1
91	ref|XM_639951.1| Dictyostelium discoideum cAMP-binding protein (...	42	2.1
92	ref|XM_639278.1| Dictyostelium discoideum hypothetical protein (...	42	2.1
93	ref|XM_638325.1| Dictyostelium discoideum hypothetical protein (...	42	2.1
94	ref|XM_514781.1| PREDICTED: Pan troglodytes similar to PTK6 prot...	42	2.1
95	ref|XM_629675.1| Dictyostelium discoideum hypothetical protein (...	42	2.1
96	ref|XM_629551.1| Dictyostelium discoideum hypothetical protein (...	42	2.1
97	gb|AC139867.4| Mus musculus BAC clone RP23-430P22 from chromosom...	42	2.1
98	gb|AC167812.4| Mus musculus BAC clone RP24-299F5 from chromosome...	42	2.1
99	ref|XM_483462.1| Oryza sativa (japonica cultivar-group), mRNA	42	2.1
100	ref|NM_193483.1| Oryza sativa (japonica cultivar-group), predic...	42	2.1
101	ref|XM_470239.1| Oryza sativa (japonica cultivar-group), predic...	42	2.1
102	ref|XM_478543.1| Oryza sativa (japonica cultivar-group), mRNA	42	2.1
103	gb|AY585355.1| Aegilops tauschii low molecular weight glutenin s...	42	2.1
104	gb|AY020570.1| Oryza sativa microsatellite MRG2895 containing (G...	42	2.1
105	gb|BT015281.1| Drosophila melanogaster LD08594 full insert cDNA	42	2.1
106	gb|AC132345.4| Mus musculus BAC clone RP24-177P9 from chromosome...	42	2.1
107	ref|XM_952350.1| Neurospora crassa OR74A hypothetical protein (N...	42	2.1
108	ref|XM_327503.1| Neurospora crassa OR74A hypothetical protein (N...	42	2.1
109	ref|XM_708012.1| Candida albicans SC5314 hypothetical protein (C...	42	2.1
110	ref|XM_707989.1| Candida albicans SC5314 hypothetical protein (C...	42	2.1
111	ref|XM_706959.1| Candida albicans SC5314 G1 cyclin (CaO19.10172)...	42	2.1
112	ref|XM_706938.1| Candida albicans SC5314 G1 cyclin (CaO19.2649),...	42	2.1
113	gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 compl...	42	2.1
114	gb|BT011124.1| Drosophila melanogaster LD09942 full insert cDNA	42	2.1
115	gb|AC145753.1| Genomic sequence for Medicago truncatula, clone M...	42	2.1
116	emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K...	42	2.1
117	gb|AY214450.1| Triticum aestivum low-molecular-weight glutenin s...	42	2.1
118	emb|BX072054.1|CNS09RRE Single read from an extremity of a full-...	42	2.1
119	emb|BX072011.1|CNS09RQ7 Single read from an extremity of a full-...	42	2.1
120	emb|BX072010.1|CNS09RQ6 Single read from an extremity of a full-...	42	2.1
121	emb|BX071935.1|CNS09RO3 Single read from an extremity of a full-...	42	2.1
122	emb|BX071934.1|CNS09RO2 Single read from an extremity of a full-...	42	2.1
123	emb|BX071886.1|CNS09RMQ Single read from an extremity of a full-...	42	2.1
124	emb|BX071885.1|CNS09RMP Single read from an extremity of a full-...	42	2.1
125	emb|BX071198.1|CNS09R3M Single read from an extremity of a full-...	42	2.1
126	emb|BX071197.1|CNS09R3L Single read from an extremity of a full-...	42	2.1
127	emb|BX071134.1|CNS09R1U Single read from an extremity of a full-...	42	2.1
128	emb|BX071327.1|CNS09R77 Single read from an extremity of a full-...	42	2.1
129	emb|BX071326.1|CNS09R76 Single read from an extremity of a full-...	42	2.1
130	emb|BX071022.1|CNS09QYQ Single read from an extremity of a full-...	42	2.1
131	emb|BX071021.1|CNS09QYP Single read from an extremity of a full-...	42	2.1
132	emb|BX070958.1|CNS09QWY Single read from an extremity of a full-...	42	2.1
133	emb|BX070095.1|CNS09Q8Z Single read from an extremity of a full-...	42	2.1
134	emb|BX069941.1|CNS09Q4P Single read from an extremity of a full-...	42	2.1
135	emb|BX069940.1|CNS09Q4O Single read from an extremity of a full-...	42	2.1
136	emb|BX069703.1|CNS09PY3 Single read from an extremity of a full-...	42	2.1
137	emb|BX069702.1|CNS09PY2 Single read from an extremity of a full-...	42	2.1
138	emb|BX060940.1|CNS09J6O Single read from an extremity of a full-...	42	2.1
139	emb|BX060939.1|CNS09J6N Single read from an extremity of a full-...	42	2.1
140	emb|BX069369.1|CNS09POT Single read from an extremity of a full-...	42	2.1
141	emb|BX069368.1|CNS09POS Single read from an extremity of a full-...	42	2.1
142	emb|BX069214.1|CNS09PKI Single read from an extremity of a full-...	42	2.1
143	emb|BX069213.1|CNS09PKH Single read from an extremity of a full-...	42	2.1
144	emb|BX068918.1|CNS09PCA Single read from an extremity of a full-...	42	2.1
145	emb|BX068917.1|CNS09PC9 Single read from an extremity of a full-...	42	2.1
146	emb|BX068891.1|CNS09PBJ Single read from an extremity of a full-...	42	2.1
147	emb|BX068781.1|CNS09P8H Single read from an extremity of a full-...	42	2.1
148	emb|BX068780.1|CNS09P8G Single read from an extremity of a full-...	42	2.1
149	emb|BX068699.1|CNS09P67 Single read from an extremity of a full-...	42	2.1
150	emb|BX068698.1|CNS09P66 Single read from an extremity of a full-...	42	2.1
151	emb|BX068685.1|CNS09P5T Single read from an extremity of a full-...	42	2.1
152	emb|BX068632.1|CNS09P4C Single read from an extremity of a full-...	42	2.1
153	emb|BX068631.1|CNS09P4B Single read from an extremity of a full-...	42	2.1
154	emb|BX068390.1|CNS09OXM Single read from an extremity of a full-...	42	2.1
155	emb|BX068389.1|CNS09OXL Single read from an extremity of a full-...	42	2.1
156	emb|BX068343.1|CNS09OWB Single read from an extremity of a full-...	42	2.1
157	emb|BX068342.1|CNS09OWA Single read from an extremity of a full-...	42	2.1
158	emb|BX068334.1|CNS09OW2 Single read from an extremity of a full-...	42	2.1
159	emb|BX068305.1|CNS09OV9 Single read from an extremity of a full-...	42	2.1
160	emb|BX068304.1|CNS09OV8 Single read from an extremity of a full-...	42	2.1
161	emb|BX068271.1|CNS09OUB Single read from an extremity of a full-...	42	2.1
162	emb|BX068270.1|CNS09OUA Single read from an extremity of a full-...	42	2.1
163	emb|BX068265.1|CNS09OU5 Single read from an extremity of a full-...	42	2.1
164	emb|BX068264.1|CNS09OU4 Single read from an extremity of a full-...	42	2.1
165	emb|BX068004.1|CNS09OMW Single read from an extremity of a full-...	42	2.1
166	emb|BX068003.1|CNS09OMV Single read from an extremity of a full-...	42	2.1
167	emb|BX067731.1|CNS09OFB Single read from an extremity of a full-...	42	2.1
168	emb|BX067730.1|CNS09OFA Single read from an extremity of a full-...	42	2.1
169	emb|BX067102.1|CNS09NXU Single read from an extremity of a full-...	42	2.1
170	emb|BX067101.1|CNS09NXT Single read from an extremity of a full-...	42	2.1
171	emb|BX066999.1|CNS09NUZ Single read from an extremity of a full-...	42	2.1
172	emb|BX066998.1|CNS09NUY Single read from an extremity of a full-...	42	2.1
173	emb|BX066931.1|CNS09NT3 Single read from an extremity of a full-...	42	2.1
174	emb|BX066843.1|CNS09NQN Single read from an extremity of a full-...	42	2.1
175	emb|BX066842.1|CNS09NQM Single read from an extremity of a full-...	42	2.1
176	emb|BX066444.1|CNS09NFK Single read from an extremity of a full-...	42	2.1
177	emb|BX065926.1|CNS09N16 Single read from an extremity of a full-...	42	2.1
178	emb|BX065925.1|CNS09N15 Single read from an extremity of a full-...	42	2.1
179	emb|BX065769.1|CNS09MWT Single read from an extremity of a full-...	42	2.1
180	emb|BX065768.1|CNS09MWS Single read from an extremity of a full-...	42	2.1
181	emb|BX065563.1|CNS09MR3 Single read from an extremity of a full-...	42	2.1
182	emb|BX065562.1|CNS09MR2 Single read from an extremity of a full-...	42	2.1
183	emb|BX065399.1|CNS09MMJ Single read from an extremity of a full-...	42	2.1
184	emb|BX065398.1|CNS09MMI Single read from an extremity of a full-...	42	2.1
185	emb|BX065379.1|CNS09MLZ Single read from an extremity of a full-...	42	2.1
186	emb|BX065287.1|CNS09MJF Single read from an extremity of a full-...	42	2.1
187	emb|BX065286.1|CNS09MJE Single read from an extremity of a full-...	42	2.1
188	emb|BX065104.1|CNS09MEC Single read from an extremity of a full-...	42	2.1
189	emb|BX065103.1|CNS09MEB Single read from an extremity of a full-...	42	2.1
190	emb|BX065085.1|CNS09MDT Single read from an extremity of a full-...	42	2.1
191	emb|BX065080.1|CNS09MDO Single read from an extremity of a full-...	42	2.1
192	emb|BX065079.1|CNS09MDN Single read from an extremity of a full-...	42	2.1
193	emb|BX065033.1|CNS09MCD Single read from an extremity of a full-...	42	2.1
194	emb|BX065032.1|CNS09MCC Single read from an extremity of a full-...	42	2.1
195	emb|BX064041.1|CNS09LKT Single read from an extremity of a full-...	42	2.1
196	emb|BX063680.1|CNS09LAS Single read from an extremity of a full-...	42	2.1
197	emb|BX063679.1|CNS09LAR Single read from an extremity of a full-...	42	2.1
198	emb|BX063678.1|CNS09LAQ Single read from an extremity of a full-...	42	2.1
199	emb|BX063630.1|CNS09L9E Single read from an extremity of a full-...	42	2.1
200	emb|BX063028.1|CNS09KSO Single read from an extremity of a full-...	42	2.1
201	emb|BX063027.1|CNS09KSN Single read from an extremity of a full-...	42	2.1
202	emb|BX062931.1|CNS09KPZ Single read from an extremity of a full-...	42	2.1
203	emb|BX062913.1|CNS09KPH Single read from an extremity of a full-...	42	2.1
204	emb|BX062912.1|CNS09KPG Single read from an extremity of a full-...	42	2.1
205	emb|BX062805.1|CNS09KMH Single read from an extremity of a full-...	42	2.1
206	emb|BX062755.1|CNS09KL3 Single read from an extremity of a full-...	42	2.1
207	emb|BX062625.1|CNS09KHH Single read from an extremity of a full-...	42	2.1
208	emb|BX062624.1|CNS09KHG Single read from an extremity of a full-...	42	2.1
209	emb|BX062166.1|CNS09K4Q Single read from an extremity of a full-...	42	2.1
210	emb|BX062165.1|CNS09K4P Single read from an extremity of a full-...	42	2.1
211	emb|BX062119.1|CNS09K3F Single read from an extremity of a full-...	42	2.1
212	emb|BX062118.1|CNS09K3E Single read from an extremity of a full-...	42	2.1
213	emb|BX062090.1|CNS09K2M Single read from an extremity of a full-...	42	2.1
214	emb|BX061845.1|CNS09JVT Single read from an extremity of a full-...	42	2.1
215	emb|BX061453.1|CNS09JKX Single read from an extremity of a full-...	42	2.1
216	emb|BX061452.1|CNS09JKW Single read from an extremity of a full-...	42	2.1
217	emb|BX061383.1|CNS09JIZ Single read from an extremity of a full-...	42	2.1
218	emb|BX061185.1|CNS09JDH Single read from an extremity of a full-...	42	2.1
219	emb|BX061184.1|CNS09JDG Single read from an extremity of a full-...	42	2.1
220	emb|BX060474.1|CNS09ITQ Single read from an extremity of a full-...	42	2.1
221	emb|BX060315.1|CNS09IPB Single read from an extremity of a full-...	42	2.1
222	emb|BX060156.1|CNS09IKW Single read from an extremity of a full-...	42	2.1
223	emb|BX060073.1|CNS09IIL Single read from an extremity of a full-...	42	2.1
224	emb|BX060072.1|CNS09IIK Single read from an extremity of a full-...	42	2.1
225	emb|BX060047.1|CNS09IHV Single read from an extremity of a full-...	42	2.1
226	emb|BX059980.1|CNS09IG0 Single read from an extremity of a full-...	42	2.1
227	emb|BX059979.1|CNS09IFZ Single read from an extremity of a full-...	42	2.1
228	emb|BX059598.1|CNS09I5E Single read from an extremity of a full-...	42	2.1
229	emb|BX059597.1|CNS09I5D Single read from an extremity of a full-...	42	2.1
230	emb|BX059276.1|CNS09HWG Single read from an extremity of a full-...	42	2.1
231	emb|BX059262.1|CNS09HW2 Single read from an extremity of a full-...	42	2.1
232	emb|BX059230.1|CNS09HV6 Single read from an extremity of a full-...	42	2.1
233	emb|BX058872.1|CNS09HL8 Single read from an extremity of a full-...	42	2.1
234	emb|BX058871.1|CNS09HL7 Single read from an extremity of a full-...	42	2.1
235	emb|BX058808.1|CNS09HJG Single read from an extremity of a full-...	42	2.1
236	emb|BX058807.1|CNS09HJF Single read from an extremity of a full-...	42	2.1
237	emb|BX058560.1|CNS09HCK Single read from an extremity of a full-...	42	2.1
238	emb|BX058281.1|CNS09H4T Single read from an extremity of a full-...	42	2.1
239	emb|BX058280.1|CNS09H4S Single read from an extremity of a full-...	42	2.1
240	emb|BX058269.1|CNS09H4H Single read from an extremity of a full-...	42	2.1
241	emb|BX056753.1|CNS09FYD Single read from an extremity of a full-...	42	2.1
242	emb|BX056601.1|CNS09FU5 Single read from an extremity of a full-...	42	2.1
243	emb|BX057958.1|CNS09GVU Single read from an extremity of a full-...	42	2.1
244	emb|BX057087.1|CNS09G7N Single read from an extremity of a full-...	42	2.1
245	emb|BX056891.1|CNS09G27 Single read from an extremity of a full-...	42	2.1
246	emb|BX056571.1|CNS09FTB Single read from an extremity of a full-...	42	2.1
247	emb|BX056553.1|CNS09FST Single read from an extremity of a full-...	42	2.1
248	emb|BX056552.1|CNS09FSS Single read from an extremity of a full-...	42	2.1
249	emb|BX056479.1|CNS09FQR Single read from an extremity of a full-...	42	2.1
250	emb|BX056478.1|CNS09FQQ Single read from an extremity of a full-...	42	2.1
251	emb|BX056309.1|CNS09FM1 Single read from an extremity of a full-...	42	2.1
252	emb|BX056040.1|CNS09FEK Single read from an extremity of a full-...	42	2.1
253	emb|BX056039.1|CNS09FEJ Single read from an extremity of a full-...	42	2.1
254	emb|BX055740.1|CNS09F68 Single read from an extremity of a full-...	42	2.1
255	emb|BX055724.1|CNS09F5S Single read from an extremity of a full-...	42	2.1
256	emb|BX055723.1|CNS09F5R Single read from an extremity of a full-...	42	2.1
257	emb|BX055717.1|CNS09F5L Single read from an extremity of a full-...	42	2.1
258	emb|BX055643.1|CNS09F3J Single read from an extremity of a full-...	42	2.1
259	emb|BX055642.1|CNS09F3I Single read from an extremity of a full-...	42	2.1
260	emb|BX055566.1|CNS09F1E Single read from an extremity of a full-...	42	2.1
261	emb|BX055565.1|CNS09F1D Single read from an extremity of a full-...	42	2.1
262	emb|BX055542.1|CNS09F0Q Single read from an extremity of a full-...	42	2.1
263	emb|BX055541.1|CNS09F0P Single read from an extremity of a full-...	42	2.1
264	emb|BX055478.1|CNS09EYY Single read from an extremity of a full-...	42	2.1
265	emb|BX055477.1|CNS09EYX Single read from an extremity of a full-...	42	2.1
266	emb|BX055404.1|CNS09EWW Single read from an extremity of a full-...	42	2.1
267	emb|BX055221.1|CNS09ERT Single read from an extremity of a full-...	42	2.1
268	emb|BX053166.1|CNS09D6Q Single read from an extremity of a full-...	42	2.1
269	emb|BX053165.1|CNS09D6P Single read from an extremity of a full-...	42	2.1
270	emb|BX055119.1|CNS09EOZ Single read from an extremity of a full-...	42	2.1
271	emb|BX055118.1|CNS09EOY Single read from an extremity of a full-...	42	2.1
272	emb|BX054551.1|CNS09E97 Single read from an extremity of a full-...	42	2.1
273	emb|BX054550.1|CNS09E96 Single read from an extremity of a full-...	42	2.1
274	emb|BX054490.1|CNS09E7I Single read from an extremity of a full-...	42	2.1
275	emb|BX054489.1|CNS09E7H Single read from an extremity of a full-...	42	2.1
276	emb|BX054096.1|CNS09DWK Single read from an extremity of a full-...	42	2.1
277	emb|BX054095.1|CNS09DWJ Single read from an extremity of a full-...	42	2.1
278	emb|BX053786.1|CNS09DNY Single read from an extremity of a full-...	42	2.1
279	emb|BX052786.1|CNS09CW6 Single read from an extremity of a full-...	42	2.1
280	emb|BX052785.1|CNS09CW5 Single read from an extremity of a full-...	42	2.1
281	emb|BX052679.1|CNS09CT7 Single read from an extremity of a full-...	42	2.1
282	emb|BX052678.1|CNS09CT6 Single read from an extremity of a full-...	42	2.1
283	emb|BX052629.1|CNS09CRT Single read from an extremity of a full-...	42	2.1
284	emb|BX052628.1|CNS09CRS Single read from an extremity of a full-...	42	2.1
285	emb|BX052573.1|CNS09CQ9 Single read from an extremity of a full-...	42	2.1
286	emb|BX052572.1|CNS09CQ8 Single read from an extremity of a full-...	42	2.1
287	emb|BX052510.1|CNS09COI Single read from an extremity of a full-...	42	2.1
288	emb|BX052509.1|CNS09COH Single read from an extremity of a full-...	42	2.1
289	emb|BX052467.1|CNS09CNB Single read from an extremity of a full-...	42	2.1
290	emb|BX052466.1|CNS09CNA Single read from an extremity of a full-...	42	2.1
291	emb|BX051981.1|CNS09C9T Single read from an extremity of a full-...	42	2.1
292	emb|BX051980.1|CNS09C9S Single read from an extremity of a full-...	42	2.1
293	emb|BX051920.1|CNS09C84 Single read from an extremity of a full-...	42	2.1
294	emb|BX051919.1|CNS09C83 Single read from an extremity of a full-...	42	2.1
295	emb|BX051855.1|CNS09C6B Single read from an extremity of a full-...	42	2.1
296	emb|BX051854.1|CNS09C6A Single read from an extremity of a full-...	42	2.1
297	emb|BX050971.1|CNS09BHR Single read from an extremity of a full-...	42	2.1
298	emb|BX050607.1|CNS09B7N Single read from an extremity of a full-...	42	2.1
299	emb|BX050606.1|CNS09B7M Single read from an extremity of a full-...	42	2.1
300	emb|BX050495.1|CNS09B4J Single read from an extremity of a full-...	42	2.1
301	emb|BX049990.1|CNS09AQI Single read from an extremity of a full-...	42	2.1
302	emb|BX049989.1|CNS09AQH Single read from an extremity of a full-...	42	2.1
303	emb|BX049718.1|CNS09AIY Single read from an extremity of a full-...	42	2.1
304	emb|BX049717.1|CNS09AIX Single read from an extremity of a full-...	42	2.1
305	emb|BX031004.1|CNS08W34 Single read from an extremity of a full-...	42	2.1
306	emb|BX031003.1|CNS08W33 Single read from an extremity of a full-...	42	2.1
307	emb|BX049609.1|CNS09AFX Single read from an extremity of a full-...	42	2.1
308	emb|BX049416.1|CNS09AAK Single read from an extremity of a full-...	42	2.1
309	emb|BX049059.1|CNS09A0N Single read from an extremity of a full-...	42	2.1
310	emb|BX049058.1|CNS09A0M Single read from an extremity of a full-...	42	2.1
311	emb|BX048923.1|CNS099WV Single read from an extremity of a full-...	42	2.1
312	emb|BX048922.1|CNS099WU Single read from an extremity of a full-...	42	2.1
313	emb|BX048811.1|CNS099TR Single read from an extremity of a full-...	42	2.1
314	emb|BX048769.1|CNS099SL Single read from an extremity of a full-...	42	2.1
315	emb|BX048134.1|CNS099AY Single read from an extremity of a full-...	42	2.1
316	emb|BX048132.1|CNS099AW Single read from an extremity of a full-...	42	2.1
317	emb|BX048121.1|CNS099AL Single read from an extremity of a full-...	42	2.1
318	emb|BX047755.1|CNS0990F Single read from an extremity of a full-...	42	2.1
319	emb|BX047754.1|CNS0990E Single read from an extremity of a full-...	42	2.1
320	emb|BX047478.1|CNS098SQ Single read from an extremity of a full-...	42	2.1
321	emb|BX047279.1|CNS098N7 Single read from an extremity of a full-...	42	2.1
322	emb|BX047217.1|CNS098LH Single read from an extremity of a full-...	42	2.1
323	emb|BX047216.1|CNS098LG Single read from an extremity of a full-...	42	2.1
324	emb|BX047156.1|CNS098JS Single read from an extremity of a full-...	42	2.1
325	emb|BX047132.1|CNS098J4 Single read from an extremity of a full-...	42	2.1
326	emb|BX047001.1|CNS098FH Single read from an extremity of a full-...	42	2.1
327	emb|BX047000.1|CNS098FG Single read from an extremity of a full-...	42	2.1
328	emb|BX046940.1|CNS098DS Single read from an extremity of a full-...	42	2.1
329	emb|BX046939.1|CNS098DR Single read from an extremity of a full-...	42	2.1
330	emb|BX046929.1|CNS098DH Single read from an extremity of a full-...	42	2.1
331	emb|BX046876.1|CNS098C0 Single read from an extremity of a full-...	42	2.1
332	emb|BX046875.1|CNS098BZ Single read from an extremity of a full-...	42	2.1
333	emb|BX046826.1|CNS098AM Single read from an extremity of a full-...	42	2.1
334	emb|BX046755.1|CNS0988N Single read from an extremity of a full-...	42	2.1
335	emb|BX046690.1|CNS0986U Single read from an extremity of a full-...	42	2.1
336	emb|BX046325.1|CNS097WP Single read from an extremity of a full-...	42	2.1
337	emb|BX046324.1|CNS097WO Single read from an extremity of a full-...	42	2.1
338	emb|BX045863.1|CNS097JV Single read from an extremity of a full-...	42	2.1
339	emb|BX045862.1|CNS097JU Single read from an extremity of a full-...	42	2.1
340	emb|BX045772.1|CNS097HC Single read from an extremity of a full-...	42	2.1
341	emb|BX045658.1|CNS097E6 Single read from an extremity of a full-...	42	2.1
342	emb|BX045647.1|CNS097DV Single read from an extremity of a full-...	42	2.1
343	emb|BX045057.1|CNS096XH Single read from an extremity of a full-...	42	2.1
344	emb|BX045056.1|CNS096XG Single read from an extremity of a full-...	42	2.1
345	emb|BX045292.1|CNS09740 Single read from an extremity of a full-...	42	2.1
346	emb|BX042914.1|CNS0959Y Single read from an extremity of a full-...	42	2.1
347	emb|BX042913.1|CNS0959X Single read from an extremity of a full-...	42	2.1
348	emb|BX044674.1|CNS096MU Single read from an extremity of a full-...	42	2.1
349	emb|BX044233.1|CNS096AL Single read from an extremity of a full-...	42	2.1
350	emb|BX044031.1|CNS0964Z Single read from an extremity of a full-...	42	2.1
351	emb|BX044023.1|CNS0964R Single read from an extremity of a full-...	42	2.1
352	emb|BX044022.1|CNS0964Q Single read from an extremity of a full-...	42	2.1
353	emb|BX043813.1|CNS095YX Single read from an extremity of a full-...	42	2.1
354	emb|BX043812.1|CNS095YW Single read from an extremity of a full-...	42	2.1
355	emb|BX043402.1|CNS095NI Single read from an extremity of a full-...	42	2.1
356	emb|BX043401.1|CNS095NH Single read from an extremity of a full-...	42	2.1
357	emb|BX043362.1|CNS095ME Single read from an extremity of a full-...	42	2.1
358	emb|BX043361.1|CNS095MD Single read from an extremity of a full-...	42	2.1
359	emb|BX043340.1|CNS095LS Single read from an extremity of a full-...	42	2.1
360	emb|BX043586.1|CNS095SM Single read from an extremity of a full-...	42	2.1
361	emb|BX043158.1|CNS095GQ Single read from an extremity of a full-...	42	2.1
362	emb|BX042813.1|CNS09575 Single read from an extremity of a full-...	42	2.1
363	emb|BX042812.1|CNS09574 Single read from an extremity of a full-...	42	2.1
364	emb|BX042751.1|CNS0955F Single read from an extremity of a full-...	42	2.1
365	emb|BX042750.1|CNS0955E Single read from an extremity of a full-...	42	2.1
366	emb|BX042566.1|CNS0950A Single read from an extremity of a full-...	42	2.1
367	emb|BX042373.1|CNS094UX Single read from an extremity of a full-...	42	2.1
368	emb|BX042372.1|CNS094UW Single read from an extremity of a full-...	42	2.1
369	emb|BX042192.1|CNS094PW Single read from an extremity of a full-...	42	2.1
370	emb|BX042191.1|CNS094PV Single read from an extremity of a full-...	42	2.1
371	emb|BX041829.1|CNS094FT Single read from an extremity of a full-...	42	2.1
372	emb|BX041828.1|CNS094FS Single read from an extremity of a full-...	42	2.1
373	emb|BX041998.1|CNS094KI Single read from an extremity of a full-...	42	2.1
374	emb|BX041997.1|CNS094KH Single read from an extremity of a full-...	42	2.1
375	emb|BX041981.1|CNS094K1 Single read from an extremity of a full-...	42	2.1
376	emb|BX041980.1|CNS094K0 Single read from an extremity of a full-...	42	2.1
377	emb|BX041897.1|CNS094HP Single read from an extremity of a full-...	42	2.1
378	emb|BX041870.1|CNS094GY Single read from an extremity of a full-...	42	2.1
379	emb|BX041495.1|CNS0946J Single read from an extremity of a full-...	42	2.1
380	emb|BX041494.1|CNS0946I Single read from an extremity of a full-...	42	2.1
381	emb|BX041372.1|CNS09434 Single read from an extremity of a full-...	42	2.1
382	emb|BX041371.1|CNS09433 Single read from an extremity of a full-...	42	2.1
383	emb|BX041093.1|CNS093VD Single read from an extremity of a full-...	42	2.1
384	emb|BX041092.1|CNS093VC Single read from an extremity of a full-...	42	2.1
385	emb|BX041066.1|CNS093UM Single read from an extremity of a full-...	42	2.1
386	emb|BX041065.1|CNS093UL Single read from an extremity of a full-...	42	2.1
387	emb|BX040893.1|CNS093PT Single read from an extremity of a full-...	42	2.1
388	emb|BX040892.1|CNS093PS Single read from an extremity of a full-...	42	2.1
389	emb|BX040653.1|CNS093J5 Single read from an extremity of a full-...	42	2.1
390	emb|BX040441.1|CNS093D9 Single read from an extremity of a full-...	42	2.1
391	emb|BX040440.1|CNS093D8 Single read from an extremity of a full-...	42	2.1
392	emb|BX040164.1|CNS0935K Single read from an extremity of a full-...	42	2.1
393	emb|BX039306.1|CNS092HQ Single read from an extremity of a full-...	42	2.1
394	emb|BX039244.1|CNS092G0 Single read from an extremity of a full-...	42	2.1
395	emb|BX037982.1|CNS091GY Single read from an extremity of a full-...	42	2.1
396	emb|BX037573.1|CNS0915L Single read from an extremity of a full-...	42	2.1
397	emb|BX037476.1|CNS0912W Single read from an extremity of a full-...	42	2.1
398	emb|BX037438.1|CNS0911U Single read from an extremity of a full-...	42	2.1
399	emb|BX037437.1|CNS0911T Single read from an extremity of a full-...	42	2.1
400	emb|BX036706.1|CNS090HI Single read from an extremity of a full-...	42	2.1
401	emb|BX036673.1|CNS090GL Single read from an extremity of a full-...	42	2.1
402	emb|BX036672.1|CNS090GK Single read from an extremity of a full-...	42	2.1
403	emb|BX034834.1|CNS08Z1I Single read from an extremity of a full-...	42	2.1
404	emb|BX034833.1|CNS08Z1H Single read from an extremity of a full-...	42	2.1
405	emb|BX034965.1|CNS08Z55 Single read from an extremity of a full-...	42	2.1
406	emb|BX034964.1|CNS08Z54 Single read from an extremity of a full-...	42	2.1
407	emb|BX033572.1|CNS08Y2G Single read from an extremity of a full-...	42	2.1
408	emb|BX033571.1|CNS08Y2F Single read from an extremity of a full-...	42	2.1
409	emb|BX032692.1|CNS08XE0 Single read from an extremity of a full-...	42	2.1
410	emb|BX029791.1|CNS08V5F Single read from an extremity of a full-...	42	2.1
411	emb|BX029790.1|CNS08V5E Single read from an extremity of a full-...	42	2.1
412	emb|BX029503.1|CNS08UXF Single read from an extremity of a full-...	42	2.1
413	emb|BX028235.1|CNS08TY7 Single read from an extremity of a full-...	42	2.1
414	emb|BX028234.1|CNS08TY6 Single read from an extremity of a full-...	42	2.1
415	emb|BX028059.1|CNS08TTB Single read from an extremity of a full-...	42	2.1
416	emb|BX027950.1|CNS08TQA Single read from an extremity of a full-...	42	2.1
417	emb|BX026727.1|CNS08SSB Single read from an extremity of a full-...	42	2.1
418	emb|BX026454.1|CNS08SKQ Single read from an extremity of a full-...	42	2.1
419	emb|BX026453.1|CNS08SKP Single read from an extremity of a full-...	42	2.1
420	emb|BX026346.1|CNS08SHQ Single read from an extremity of a full-...	42	2.1
421	emb|BX024700.1|CNS08R80 Single read from an extremity of a full-...	42	2.1
422	emb|BX022475.1|CNS08PI7 Single read from an extremity of a full-...	42	2.1
423	emb|BX022474.1|CNS08PI6 Single read from an extremity of a full-...	42	2.1
424	emb|BX019551.1|CNS08N8Z Single read from an extremity of a full-...	42	2.1
425	emb|BX019550.1|CNS08N8Y Single read from an extremity of a full-...	42	2.1
426	emb|BX021912.1|CNS08P2K Single read from an extremity of a full-...	42	2.1
427	emb|BX016523.1|CNS08KWV Single read from an extremity of a full-...	42	2.1
428	emb|BX016522.1|CNS08KWU Single read from an extremity of a full-...	42	2.1
429	emb|BX015088.1|CNS08JT0 Single read from an extremity of a full-...	42	2.1
430	emb|BX015087.1|CNS08JSZ Single read from an extremity of a full-...	42	2.1
431	emb|BX014828.1|CNS08JLS Single read from an extremity of a full-...	42	2.1
432	emb|BX014827.1|CNS08JLR Single read from an extremity of a full-...	42	2.1
433	emb|BX013943.1|CNS08IX7 Single read from an extremity of a full-...	42	2.1
434	emb|BX013942.1|CNS08IX6 Single read from an extremity of a full-...	42	2.1
435	emb|BX013918.1|CNS08IWI Single read from an extremity of a full-...	42	2.1
436	emb|BX013895.1|CNS08IVV Single read from an extremity of a full-...	42	2.1
437	emb|BX012162.1|CNS08HJQ Single read from an extremity of a full-...	42	2.1
438	emb|BX012161.1|CNS08HJP Single read from an extremity of a full-...	42	2.1
439	emb|BX009966.1|CNS08FUQ Single read from an extremity of a full-...	42	2.1
440	emb|BX009965.1|CNS08FUP Single read from an extremity of a full-...	42	2.1
441	emb|BX006467.1|CNS08D5J Single read from an extremity of a full-...	42	2.1
442	emb|BX006466.1|CNS08D5I Single read from an extremity of a full-...	42	2.1
443	emb|BX005614.1|CNS08CHU Single read from an extremity of a full-...	42	2.1
444	emb|X78549.1|HSBRK H.sapiens brk mRNA for tyrosine kinase	42	2.1
445	emb|X70708.1|TTLYSS T.thermophilus gene for lysyl-tRNA synthetase	42	2.1
446	gb|AC162946.4| Mus musculus BAC clone RP23-38M11 from chromosome...	42	2.1
447	emb|BX294027.1|NCB8G12 Neurospora crassa DNA linkage group V BAC...	42	2.1
448	emb|CR938556.1| Single read from an extremity of a full-length c...	42	2.1
449	emb|AL663060.6| Mouse DNA sequence from clone RP23-239H6 on chro...	42	2.1
450	gb|BC035843.1| Homo sapiens PTK6 protein tyrosine kinase 6, mRNA...	42	2.1
451	emb|CR591121.1| full-length cDNA clone CS0DK009YM03 of HeLa cell...	42	2.1
452	ref|NM_206322.1| Drosophila melanogaster CG33500-PA (CG33500) mR...	42	2.1
453	ref|NM_169716.1| Drosophila melanogaster CG14880-RB, transcript ...	42	2.1
454	ref|NM_165441.1| Drosophila melanogaster scarface CG11066-RA, tr...	42	2.1
455	ref|NM_142281.2| Drosophila melanogaster CG14880-RA, transcript ...	42	2.1
456	ref|NM_141297.1| Drosophila melanogaster CG2926-RA (CG2926), mRNA	42	2.1
457	ref|NM_136593.1| Drosophila melanogaster CG8181-RA (CG8181), mRNA	42	2.1
458	ref|NM_136336.2| Drosophila melanogaster scarface CG11066-RB, tr...	42	2.1
459	gb|AY071083.1| Drosophila melanogaster RE15157 full length cDNA	42	2.1
460	ref|XM_702474.1| PREDICTED: Danio rerio similar to RIKEN cDNA 28...	42	2.1
461	gb|AC007477.6| Drosophila melanogaster, chromosome 2R, region 41...	42	2.1
462	gb|AY047548.1| Drosophila melanogaster GH05918 full length cDNA	42	2.1
463	gb|AC093049.1| Drosophila melanogaster, chromosome 2R, region 45...	42	2.1
464	gb|AY831788.1| Triticum aestivum clone TaE15021G12 low molecular...	42	2.1
465	gb|AY831787.1| Triticum aestivum clone TaE15035A12 low molecular...	42	2.1
466	gb|AY831786.1| Triticum aestivum clone TaE15025G11 low molecular...	42	2.1
467	gb|AY831785.1| Triticum aestivum clone TaE15005D08 low molecular...	42	2.1
468	gb|AY831784.1| Triticum aestivum clone TaE15010F05 low molecular...	42	2.1
469	gb|AY831783.1| Triticum aestivum clone TaE15003G10 low molecular...	42	2.1
470	gb|AY831782.1| Triticum aestivum clone TaE15038B06 low molecular...	42	2.1
471	gb|AY831781.1| Triticum aestivum clone TaE15029D06 low molecular...	42	2.1
472	gb|AY831780.1| Triticum aestivum clone TaE15003D02 low molecular...	42	2.1
473	gb|AY831779.1| Triticum aestivum clone TaE15033G03 low molecular...	42	2.1
474	gb|AY831778.1| Triticum aestivum clone TaE15003B05 low molecular...	42	2.1
475	gb|AY831777.1| Triticum aestivum clone TaE15034F03 low molecular...	42	2.1
476	gb|AC134845.5| Mus musculus BAC clone RP24-424K5 from chromosome...	42	2.1
477	gb|AC007054.24|AC007054 Drosophila melanogaster, chromosome 2R, ...	42	2.1
478	gb|AC009538.4|AC009538 Drosophila melanogaster, chromosome 3R, r...	42	2.1
479	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	42	2.1
480	gb|AC009088.9| Homo sapiens chromosome 16 clone RP11-388M20, com...	42	2.1
481	gb|AC007647.6|AC007647 Drosophila melanogaster, chromosome 3R, r...	42	2.1
482	gb|AC009346.5|AC009346 Drosophila melanogaster, chromosome 3R, r...	42	2.1
483	gb|AC011615.4|AC011615 Drosophila melanogaster, chromosome 3R, r...	42	2.1
484	gb|AC117176.2| Dictyostelium discoideum chromosome 2 map 5018074...	42	2.1
485	gb|AC116960.2| Dictyostelium discoideum chromosome 2 map complem...	42	2.1
486	gb|AC116984.2| Dictyostelium discoideum chromosome 2 map 2567470...	42	2.1
487	dbj|AP003443.4| Oryza sativa (japonica cultivar-group) genomic D...	42	2.1
488	dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic D...	42	2.1
489	gb|AY086154.1| Arabidopsis thaliana clone 21841 mRNA, complete s...	42	2.1
490	gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome	42	2.1
491	gb|AC137635.2| Genomic sequence for Oryza sativa, Nipponbare str...	42	2.1
492	gb|AC105734.2| Oryza sativa (japonica cultivar-group) chromosome...	42	2.1
493	dbj|AP006753.2| Oryza sativa (japonica cultivar-group) genomic D...	42	2.1
494	dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g...	42	2.1
495	dbj|AP003811.2| Oryza sativa (japonica cultivar-group) genomic D...	42	2.1
496	emb|AJ515536.1|AHI515536 Antirrhinum hispanicum slf-S5 gene for ...	42	2.1
497	emb|AL845360.10| Mouse DNA sequence from clone RP23-421L7 on chr...	42	2.1
498	dbj|AP004015.3| Oryza sativa (japonica cultivar-group) genomic D...	42	2.1
499	dbj|AK111021.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.1
500	emb|AM055942.1| Toxoplasma gondii, strain RH, genomic DNA chromo...	42	2.1

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 126/151 (83%), Gaps = 3/151 (1%)
 Strand = Plus / Minus

                                                                            
Query: 336      cgcgcctccctcccgtaccagccggtcctctactccttccacgagctcgccgcagccacc 395
                ||||||||||||||| | | ||| || |||||| | ||||| ||| ||||||  ||||||
Sbjct: 22552735 cgcgcctccctcccggatccgcccgtgctctacccgttccaggaggtcgccggcgccacc 22552676

                                                                            
Query: 396      aacaacttcctcgccaagcgcaacccctccgacgccaccttctggcgctgctccctccgc 455
                ||||||||||||||||||||   | || | | | |||||| ||||| |||| |||| |||
Sbjct: 22552675 aacaacttcctcgccaagcg---cgccccggcctccacctactggccctgcaccctgcgc 22552619

                                               
Query: 456      tcccgccacgccgccctcttccagctccgcc 486
                  |||||||||||||||||||||||||||||
Sbjct: 22552618 ggccgccacgccgccctcttccagctccgcc 22552588



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                    
Query: 207      tcctcctcctccgcggccacggccaccacctcctcc 242
                ||||||||||||||| | ||  ||||||||||||||
Sbjct: 16980316 tcctcctcctccgcgacgaccaccaccacctcctcc 16980281

---

>dbj|AP006162.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:B1331F11
          Length = 132205

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 126/151 (83%), Gaps = 3/151 (1%)
 Strand = Plus / Minus

                                                                         
Query: 336   cgcgcctccctcccgtaccagccggtcctctactccttccacgagctcgccgcagccacc 395
             ||||||||||||||| | | ||| || |||||| | ||||| ||| ||||||  ||||||
Sbjct: 67936 cgcgcctccctcccggatccgcccgtgctctacccgttccaggaggtcgccggcgccacc 67877

                                                                         
Query: 396   aacaacttcctcgccaagcgcaacccctccgacgccaccttctggcgctgctccctccgc 455
             ||||||||||||||||||||   | || | | | |||||| ||||| |||| |||| |||
Sbjct: 67876 aacaacttcctcgccaagcg---cgccccggcctccacctactggccctgcaccctgcgc 67820

                                            
Query: 456   tcccgccacgccgccctcttccagctccgcc 486
               |||||||||||||||||||||||||||||
Sbjct: 67819 ggccgccacgccgccctcttccagctccgcc 67789

---

>dbj|AK066582.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013071J07, full
           insert sequence
          Length = 1315

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 126/151 (83%), Gaps = 3/151 (1%)
 Strand = Plus / Plus

                                                                       
Query: 336 cgcgcctccctcccgtaccagccggtcctctactccttccacgagctcgccgcagccacc 395
           ||||||||||||||| | | ||| || |||||| | ||||| ||| ||||||  ||||||
Sbjct: 297 cgcgcctccctcccggatccgcccgtgctctacccgttccaggaggtcgccggcgccacc 356

                                                                       
Query: 396 aacaacttcctcgccaagcgcaacccctccgacgccaccttctggcgctgctccctccgc 455
           ||||||||||||||||||||   | || | | | |||||| ||||| |||| |||| |||
Sbjct: 357 aacaacttcctcgccaagcg---cgccccggcctccacctactggccctgcaccctgcgc 413

                                          
Query: 456 tcccgccacgccgccctcttccagctccgcc 486
             |||||||||||||||||||||||||||||
Sbjct: 414 ggccgccacgccgccctcttccagctccgcc 444

---

>dbj|AK106416.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-A06, full
           insert sequence
          Length = 1987

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 125/151 (82%), Gaps = 3/151 (1%)
 Strand = Plus / Plus

                                                                       
Query: 336 cgcgcctccctcccgtaccagccggtcctctactccttccacgagctcgccgcagccacc 395
           ||||||||||||||| | | ||| || |||||| | ||||| ||| ||||||  ||||||
Sbjct: 188 cgcgcctccctcccggatccgcccgtgctctacccgttccaggaggtcgccggcgccacc 247

                                                                       
Query: 396 aacaacttcctcgccaagcgcaacccctccgacgccaccttctggcgctgctccctccgc 455
           ||||||||||||||||||||   | || | | | |||||| ||||| |||| || | |||
Sbjct: 248 aacaacttcctcgccaagcg---cgccccggcctccacctactggccctgcaccttgcgc 304

                                          
Query: 456 tcccgccacgccgccctcttccagctccgcc 486
             |||||||||||||||||||||||||||||
Sbjct: 305 ggccgccacgccgccctcttccagctccgcc 335

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 207      tcctcctcctccgcggccacggccaccacctcctcc 242
                |||||||||||||||||| | |||||| ||||||||
Sbjct: 26872592 tcctcctcctccgcggccgccgccacctcctcctcc 26872627



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 505      ccgcggccgcctccgccgcgctcgc 529
                |||||||| ||||||||||||||||
Sbjct: 26346096 ccgcggcctcctccgccgcgctcgc 26346072



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 502      cccccgcggccgcctccgccgcgctcgc 529
                ||||||| |||||| |||||||||||||
Sbjct: 22835251 cccccgccgccgccgccgccgcgctcgc 22835224



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 373     tccacgagctcgccgcagcc 392
               ||||||||||||||||||||
Sbjct: 7792568 tccacgagctcgccgcagcc 7792587

---

>dbj|AP004464.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0665C04
          Length = 177054

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                  
Query: 207    tcctcctcctccgcggccacggccaccacctcctcc 242
              |||||||||||||||||| | |||||| ||||||||
Sbjct: 135382 tcctcctcctccgcggccgccgccacctcctcctcc 135417

---

>dbj|AK121123.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074J24, full
           insert sequence
          Length = 3290

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 207 tcctcctcctccgcggccacggccaccacctcctcc 242
           |||||||||||||||||| | |||||| ||||||||
Sbjct: 154 tcctcctcctccgcggccgccgccacctcctcctcc 119

---

>ref|NM_111697.2| Arabidopsis thaliana unknown protein AT3G08630 mRNA, complete cds
          Length = 1389

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 43   tatcttcttctcctcctccaccg 65
            |||||||||||||||||||||||
Sbjct: 1092 tatcttcttctcctcctccaccg 1070

---

>ref|XM_550107.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 891

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 45  tcttcttctcctcctccaccggc 67
           |||||||||||||||||||||||
Sbjct: 733 tcttcttctcctcctccaccggc 711

---

>ref|XM_469780.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 354

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 370 ccttccacgagctcgccgcagccaccaacaacttc 404
           ||||||||||||||||||| ||||||  |||||||
Sbjct: 185 ccttccacgagctcgccgccgccaccgccaacttc 151

---

>ref|XM_468431.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1275

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 370 ccttccacgagctcgccgcagccaccaacaacttc 404
           ||||||||||||||||||| ||||||  |||||||
Sbjct: 317 ccttccacgagctcgccgccgccaccgccaacttc 351

---

>gb|AF377947.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone
             OSJNBa0032E21, complete sequence
          Length = 137580

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 370   ccttccacgagctcgccgcagccaccaacaacttc 404
             ||||||||||||||||||| ||||||  |||||||
Sbjct: 96927 ccttccacgagctcgccgccgccaccgccaacttc 96893

---

>gb|BT012416.1| Arabidopsis thaliana At3g08630 mRNA, complete cds
          Length = 1020

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 43  tatcttcttctcctcctccaccg 65
           |||||||||||||||||||||||
Sbjct: 981 tatcttcttctcctcctccaccg 959

---

>gb|BT012218.1| Arabidopsis thaliana At3g08630 gene, complete cds
          Length = 1222

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 43   tatcttcttctcctcctccaccg 65
            |||||||||||||||||||||||
Sbjct: 1030 tatcttcttctcctcctccaccg 1008

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                   
Query: 370      ccttccacgagctcgccgcagccaccaacaacttc 404
                ||||||||||||||||||| ||||||  |||||||
Sbjct: 30706856 ccttccacgagctcgccgccgccaccgccaacttc 30706890



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 251      caccaccacaacaacaaccacc 272
                ||||||||||||||||||||||
Sbjct: 29136762 caccaccacaacaacaaccacc 29136783



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 153      gctccttcttcctctcaccgccgccg 178
                |||||||||||||||| |||||||||
Sbjct: 21721113 gctccttcttcctctcgccgccgccg 21721088



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 251     caccaccacaacaacaaccaccggc 275
               |||||||||||| ||||||||||||
Sbjct: 2753418 caccaccacaaccacaaccaccggc 2753394

---

>gb|AC092556.8| Oryza sativa chromosome 3 BAC OSJNBa0047E24 genomic sequence, complete
             sequence
          Length = 157970

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 370   ccttccacgagctcgccgcagccaccaacaacttc 404
             ||||||||||||||||||| ||||||  |||||||
Sbjct: 55534 ccttccacgagctcgccgccgccaccgccaacttc 55500

---

>ref|XM_542999.2| PREDICTED: Canis familiaris similar to zinc fingers and homeoboxes 3
            (LOC485875), mRNA
          Length = 3435

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 208  cctcctcctccgcggccacggccaccacctcctcc 242
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 2089 cctcgtcctccgcagccacagccaccacctcctcc 2055

---

>gb|AC135225.4| Oryza sativa chromosome 3 BAC OJ1112_G08 genomic sequence, complete
             sequence
          Length = 128294

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 370   ccttccacgagctcgccgcagccaccaacaacttc 404
             ||||||||||||||||||| ||||||  |||||||
Sbjct: 15557 ccttccacgagctcgccgccgccaccgccaacttc 15591

---

>emb|AL606601.3|OSJN00029 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0055H05,
              complete sequence
          Length = 152329

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 370    ccttccacgagctcgccgcagccaccaacaacttc 404
              ||||||||||||||||||| ||||||  |||||||
Sbjct: 148426 ccttccacgagctcgccgccgccaccgccaacttc 148392

---

>gb|AC079075.6| Homo sapiens chromosome 15, clone RP11-300G22, complete sequence
          Length = 209955

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 326    ggagggagcgcgcgcctccctcc 348
              |||||||||||||||||||||||
Sbjct: 144896 ggagggagcgcgcgcctccctcc 144874

---

>gb|AC013787.15| Homo sapiens chromosome 15, clone RP11-531E13, complete sequence
          Length = 176304

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 326    ggagggagcgcgcgcctccctcc 348
              |||||||||||||||||||||||
Sbjct: 132414 ggagggagcgcgcgcctccctcc 132436

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 370     ccttccacgagctcgccgcagccaccaacaacttc 404
               ||||||||||||||||||| ||||||  |||||||
Sbjct: 8086302 ccttccacgagctcgccgccgccaccgccaacttc 8086268

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                   
Query: 370      ccttccacgagctcgccgcagccaccaacaacttc 404
                ||||||||||||||||||| ||||||  |||||||
Sbjct: 30798280 ccttccacgagctcgccgccgccaccgccaacttc 30798314



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 251      caccaccacaacaacaaccacc 272
                ||||||||||||||||||||||
Sbjct: 29228184 caccaccacaacaacaaccacc 29228205



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 153      gctccttcttcctctcaccgccgccg 178
                |||||||||||||||| |||||||||
Sbjct: 21714142 gctccttcttcctctcgccgccgccg 21714117



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 251     caccaccacaacaacaaccaccggc 275
               |||||||||||| ||||||||||||
Sbjct: 2753528 caccaccacaaccacaaccaccggc 2753504

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                   
Query: 370      ccttccacgagctcgccgcagccaccaacaacttc 404
                ||||||||||||||||||| ||||||  |||||||
Sbjct: 35223820 ccttccacgagctcgccgccgccaccgccaacttc 35223854



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 449      cctccgctcccgccacgccgcc 470
                ||||||||||||||||||||||
Sbjct: 35286221 cctccgctcccgccacgccgcc 35286242

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                   
Query: 370      ccttccacgagctcgccgcagccaccaacaacttc 404
                ||||||||||||||||||| ||||||  |||||||
Sbjct: 19977219 ccttccacgagctcgccgccgccaccgccaacttc 19977253



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 45      tcttcttctcctcctccaccggc 67
               |||||||||||||||||||||||
Sbjct: 2400103 tcttcttctcctcctccaccggc 2400125



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 207      tcctcctcctccgcggccacggccaccac 235
                |||||||||||||| ||| ||||||||||
Sbjct: 21111530 tcctcctcctccgccgccgcggccaccac 21111502



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 265     caaccaccggcaccggcacc 284
               ||||||||||||||||||||
Sbjct: 1740616 caaccaccggcaccggcacc 1740597

---

>emb|AL606597.4|OSJN00042 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0045P24,
             complete sequence
          Length = 124420

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 370   ccttccacgagctcgccgcagccaccaacaacttc 404
             ||||||||||||||||||| ||||||  |||||||
Sbjct: 19834 ccttccacgagctcgccgccgccaccgccaacttc 19800

---

>emb|BX822126.1|CNS0A5W1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB15ZB06 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1309

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 43   tatcttcttctcctcctccaccg 65
            |||||||||||||||||||||||
Sbjct: 1068 tatcttcttctcctcctccaccg 1046

---

>gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete
             sequence
          Length = 90721

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 43    tatcttcttctcctcctccaccg 65
             |||||||||||||||||||||||
Sbjct: 32846 tatcttcttctcctcctccaccg 32824

---

>dbj|AP004361.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0062A24
          Length = 148362

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 370   ccttccacgagctcgccgcagccaccaacaacttc 404
             ||||||||||||||||||| ||||||  |||||||
Sbjct: 80128 ccttccacgagctcgccgccgccaccgccaacttc 80162

---

>dbj|AP003311.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0024G09
          Length = 175565

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 45     tcttcttctcctcctccaccggc 67
              |||||||||||||||||||||||
Sbjct: 129153 tcttcttctcctcctccaccggc 129175

---

>dbj|AP004878.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0474F11
          Length = 139544

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 370   ccttccacgagctcgccgcagccaccaacaacttc 404
             ||||||||||||||||||| ||||||  |||||||
Sbjct: 35870 ccttccacgagctcgccgccgccaccgccaacttc 35904



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 449   cctccgctcccgccacgccgcc 470
             ||||||||||||||||||||||
Sbjct: 98271 cctccgctcccgccacgccgcc 98292

---

>dbj|AP004048.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1202_E07
          Length = 145014

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 370    ccttccacgagctcgccgcagccaccaacaacttc 404
              ||||||||||||||||||| ||||||  |||||||
Sbjct: 119176 ccttccacgagctcgccgccgccaccgccaacttc 119210

---

>ref|NM_106208.1| Arabidopsis thaliana unknown protein AT1G75550 mRNA, complete cds
          Length = 504

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 205 catcctcctcctccgcggccacggccaccacctcctcc 242
           |||||||||||||| | ||||| |||||| ||||||||
Sbjct: 278 catcctcctcctccaccgccaccgccacctcctcctcc 241

---

>ref|XM_629930.1| Dictyostelium discoideum hypothetical protein (DDB0184068), partial
           mRNA
          Length = 2541

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 251 caccaccacaacaacaaccacc 272
           ||||||||||||||||||||||
Sbjct: 719 caccaccacaacaacaaccacc 740

---

>ref|XM_629783.1| Dictyostelium discoideum hypothetical protein (DDB0231420), partial
           mRNA
          Length = 777

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 251 caccaccacaacaacaaccacc 272
           ||||||||||||||||||||||
Sbjct: 536 caccaccacaacaacaaccacc 557

---

>ref|XM_468447.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1719

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 449 cctccgctcccgccacgccgcc 470
           ||||||||||||||||||||||
Sbjct: 69  cctccgctcccgccacgccgcc 90

---

>gb|AC159381.10| Mus musculus 6 BAC RP24-460E4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 211463

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 500   cacccccgcggccgcctccgcc 521
             ||||||||||||||||||||||
Sbjct: 57773 cacccccgcggccgcctccgcc 57794

---

>ref|XM_463087.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1155

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 153 gctccttcttcctctcaccgccgccg 178
           |||||||||||||||| |||||||||
Sbjct: 643 gctccttcttcctctcgccgccgccg 618

---

>ref|NM_196163.1| Oryza sativa (japonica cultivar-group) putative homeodomain leucine
           zipper protein (OSJNBa0095C06.14), mRNA
          Length = 888

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 448 ccctccgctcccgccacgccgccctc 473
           |||||||||||||||||| |||||||
Sbjct: 353 ccctccgctcccgccacgacgccctc 378

---

>ref|XM_469589.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2415

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 251 caccaccacaacaacaaccacc 272
           ||||||||||||||||||||||
Sbjct: 34  caccaccacaacaacaaccacc 13

---

>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06
            map near C10769, complete sequence
          Length = 194856

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 251  caccaccacaacaacaaccacc 272
            ||||||||||||||||||||||
Sbjct: 2529 caccaccacaacaacaaccacc 2508

---

>emb|CR974571.9| Mouse DNA sequence from clone RP23-145P19 on chromosome 12, complete
              sequence
          Length = 219782

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 251    caccaccacaacaacaaccacc 272
              ||||||||||||||||||||||
Sbjct: 147422 caccaccacaacaacaaccacc 147401



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 251    caccaccacaacaacaacca 270
              ||||||||||||||||||||
Sbjct: 147404 caccaccacaacaacaacca 147385

---

>ref|XM_568769.1| Cryptococcus neoformans var. neoformans JEC21 nuclear pore protein
           seh1 (CNB00270) partial mRNA
          Length = 1293

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 191 cggcaccggcacagcatcctcctcctccgcggccacgg 228
           ||||||||||||||| ||||||||  |||||| |||||
Sbjct: 537 cggcaccggcacagcgtcctcctctgccgcgggcacgg 574

---

>emb|CT009545.5| M.truncatula DNA sequence from clone MTH2-107B14 on chromosome 3,
             complete sequence
          Length = 96467

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 142   ccaccaccactgctccttcttcctct 167
             ||||||||| ||||||||||||||||
Sbjct: 16166 ccaccaccagtgctccttcttcctct 16191

---

>gb|AC137921.2| Oryza sativa chromosome 3 BAC OSJNBa0027H16 genomic sequence, complete
              sequence
          Length = 163108

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 153    gctccttcttcctctcaccgccgccg 178
              |||||||||||||||| |||||||||
Sbjct: 109358 gctccttcttcctctcgccgccgccg 109333

---

>gb|AC137997.2| Oryza sativa chromosome 3 BAC OJ1499_D04 genomic sequence, complete
             sequence
          Length = 91084

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 251   caccaccacaacaacaaccacc 272
             ||||||||||||||||||||||
Sbjct: 34614 caccaccacaacaacaaccacc 34593

---

>gb|AC006651.2| Caenorhabditis elegans fosmid H06I04, complete sequence
          Length = 47880

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 214   cctccgcggccacggccaccacctcc 239
             ||||| ||||||||||||||||||||
Sbjct: 32542 cctccacggccacggccaccacctcc 32517

---

>gb|AY346329.1| Oryza sativa (indica cultivar-group) homeodomain leucine-zipper
           protein Hox8 mRNA, complete cds
          Length = 1272

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 448 ccctccgctcccgccacgccgccctc 473
           |||||||||||||||||| |||||||
Sbjct: 545 ccctccgctcccgccacgacgccctc 570

---

>gb|CP000317.1| Polaromonas sp. JS666 plasmid 1, complete sequence
          Length = 360405

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 472    tcttccagctccgcccgctccc 493
              ||||||||||||||||||||||
Sbjct: 297391 tcttccagctccgcccgctccc 297370

---

>gb|BC057510.1| Danio rerio zgc:66306, mRNA (cDNA clone MGC:66306 IMAGE:5600418),
           complete cds
          Length = 3764

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 45  tcttcttctcctcctccaccgg 66
           ||||||||||||||||||||||
Sbjct: 954 tcttcttctcctcctccaccgg 975

---

>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete
             sequence
          Length = 1632307

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 191   cggcaccggcacagcatcctcctcctccgcggccacgg 228
             ||||||||||||||| ||||||||  |||||| |||||
Sbjct: 78236 cggcaccggcacagcgtcctcctctgccgcgggcacgg 78273

---

>ref|NM_200662.1| Danio rerio zgc:66306 (zgc:66306), mRNA
          Length = 3764

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 45  tcttcttctcctcctccaccgg 66
           ||||||||||||||||||||||
Sbjct: 954 tcttcttctcctcctccaccgg 975

---

>gb|AC010033.8| Drosophila melanogaster 3L BAC RP98-3I5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 188653

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 251    caccaccacaacaacaaccacc 272
              ||||||||||||||||||||||
Sbjct: 111861 caccaccacaacaacaaccacc 111840



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 251    caccaccacaacaacaaccacc 272
              ||||||||||||||||||||||
Sbjct: 108298 caccaccacaacaacaaccacc 108277



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 251    caccaccacaacaacaaccacc 272
              ||||||||||||||||||||||
Sbjct: 107180 caccaccacaacaacaaccacc 107159



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 251   caccaccacaacaacaaccacc 272
             ||||||||||||||||||||||
Sbjct: 40334 caccaccacaacaacaaccacc 40313



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 251   caccaccacaacaacaaccac 271
             |||||||||||||||||||||
Sbjct: 38548 caccaccacaacaacaaccac 38568

---

>tpg|BK002084.1| TPA: TPA_inf: Drosophila melanogaster HDC09626 (HDC09626) gene,
           complete cds
          Length = 267

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 251 caccaccacaacaacaaccacc 272
           ||||||||||||||||||||||
Sbjct: 184 caccaccacaacaacaaccacc 163

---

>ref|NM_206329.1| Drosophila melanogaster CG33269-PA (CG33269) mRNA, complete cds
          Length = 267

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 251 caccaccacaacaacaaccacc 272
           ||||||||||||||||||||||
Sbjct: 84  caccaccacaacaacaaccacc 105

---

>ref|NM_206328.1| Drosophila melanogaster CG33270-PA (CG33270) mRNA, complete cds
          Length = 267

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 251 caccaccacaacaacaaccacc 272
           ||||||||||||||||||||||
Sbjct: 84  caccaccacaacaacaaccacc 105

---

>ref|NM_206327.1| Drosophila melanogaster CG33271-PA (CG33271) mRNA, complete cds
          Length = 267

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 251 caccaccacaacaacaaccacc 272
           ||||||||||||||||||||||
Sbjct: 84  caccaccacaacaacaaccacc 105

---

>ref|NM_206323.1| Drosophila melanogaster CG33272-PA (CG33272) mRNA, complete cds
          Length = 267

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 251 caccaccacaacaacaaccacc 272
           ||||||||||||||||||||||
Sbjct: 84  caccaccacaacaacaaccacc 105

---

>gb|AC079935.3| Genomic sequence for Oryza sativa (japonica cultivar-group) cultivar
              Nipponbare clone OSJNBa0095C06, from Chromosome 10,
              complete sequence
          Length = 156159

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 448    ccctccgctcccgccacgccgccctc 473
              |||||||||||||||||| |||||||
Sbjct: 110676 ccctccgctcccgccacgacgccctc 110701

---

>gb|AC153362.4| Mus musculus BAC clone RP23-92N20 from chromosome 10, complete sequence
          Length = 214898

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 251    caccaccacaacaacaaccacc 272
              ||||||||||||||||||||||
Sbjct: 196686 caccaccacaacaacaaccacc 196665

---

>ref|NM_065254.3| Caenorhabditis elegans H06I04.3a (H06I04.3) mRNA, complete cds
          Length = 2739

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 214  cctccgcggccacggccaccacctcc 239
            ||||| ||||||||||||||||||||
Sbjct: 2503 cctccacggccacggccaccacctcc 2478

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 448      ccctccgctcccgccacgccgccctc 473
                |||||||||||||||||| |||||||
Sbjct: 11526683 ccctccgctcccgccacgacgccctc 11526708

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 217      ccgcggccacggccaccacctcctcc 242
                |||| |||||||||||||||||||||
Sbjct: 20175476 ccgccgccacggccaccacctcctcc 20175451



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 49      cttctcctcctccaccggcg 68
               ||||||||||||||||||||
Sbjct: 4395285 cttctcctcctccaccggcg 4395304

---

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 508     cggccgcctccgccgcgctcgc 529
               ||||||||||||||||||||||
Sbjct: 4041244 cggccgcctccgccgcgctcgc 4041223

---

>gb|AY190960.1| Drosophila pseudoobscura clone DPSF01_12_K22 (D1411) genomic sequence
          Length = 45873

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 250   gcaccaccacaacaacaaccac 271
             ||||||||||||||||||||||
Sbjct: 32484 gcaccaccacaacaacaaccac 32505

---

>gb|AC006434.5|AC006434 Genomic sequence for Arabidopsis thaliana BAC F10A5, complete sequence
          Length = 129547

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 205   catcctcctcctccgcggccacggccaccacctcctcc 242
             |||||||||||||| | ||||| |||||| ||||||||
Sbjct: 89652 catcctcctcctccaccgccaccgccacctcctcctcc 89615

---

>dbj|AP004020.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1119_A01
          Length = 108727

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 449   cctccgctcccgccacgccgcc 470
             ||||||||||||||||||||||
Sbjct: 36555 cctccgctcccgccacgccgcc 36576

---

>dbj|AP003608.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0007G12
          Length = 111819

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 217   ccgcggccacggccaccacctcctcc 242
             |||| |||||||||||||||||||||
Sbjct: 41476 ccgccgccacggccaccacctcctcc 41451

---

>dbj|AK101749.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061P20, full
            insert sequence
          Length = 1815

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 153  gctccttcttcctctcaccgccgccg 178
            |||||||||||||||| |||||||||
Sbjct: 1269 gctccttcttcctctcgccgccgccg 1244

---

>gb|AE003544.4| Drosophila melanogaster chromosome 3L, section 41 of 83 of the complete
              sequence
          Length = 280378

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 251    caccaccacaacaacaaccacc 272
              ||||||||||||||||||||||
Sbjct: 130309 caccaccacaacaacaaccacc 130288



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 251    caccaccacaacaacaaccacc 272
              ||||||||||||||||||||||
Sbjct: 126746 caccaccacaacaacaaccacc 126725



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 251    caccaccacaacaacaaccacc 272
              ||||||||||||||||||||||
Sbjct: 125628 caccaccacaacaacaaccacc 125607



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 251   caccaccacaacaacaaccacc 272
             ||||||||||||||||||||||
Sbjct: 58782 caccaccacaacaacaaccacc 58761



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 251   caccaccacaacaacaaccac 271
             |||||||||||||||||||||
Sbjct: 56996 caccaccacaacaacaaccac 57016

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 448      ccctccgctcccgccacgccgccctc 473
                |||||||||||||||||| |||||||
Sbjct: 11533123 ccctccgctcccgccacgacgccctc 11533148

---

>gb|AC004438.1|AC004438 Drosophila melanogaster DNA sequence (P1 DS03786 (D63)), complete
             sequence
          Length = 83340

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 251   caccaccacaacaacaaccacc 272
             ||||||||||||||||||||||
Sbjct: 18572 caccaccacaacaacaaccacc 18593



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 251   caccaccacaacaacaaccac 271
             |||||||||||||||||||||
Sbjct: 20358 caccaccacaacaacaaccac 20338

---

>emb|AL669913.15| Mouse DNA sequence from clone RP23-479C2 on chromosome 2, complete
              sequence
          Length = 184221

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 251    caccaccacaacaacaaccacc 272
              ||||||||||||||||||||||
Sbjct: 150800 caccaccacaacaacaaccacc 150821

---

>dbj|AP006552.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT28G12, TM0107,
             complete sequence
          Length = 97172

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 251   caccaccacaacaacaaccacc 272
             ||||||||||||||||||||||
Sbjct: 53365 caccaccacaacaacaaccacc 53386

---

>dbj|AP006551.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT35D17, TM0104,
             complete sequence
          Length = 96208

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 251   caccaccacaacaacaaccacc 272
             ||||||||||||||||||||||
Sbjct: 73469 caccaccacaacaacaaccacc 73490

---

>gb|AC142105.7| Mus musculus BAC clone RP24-240E7 from chromosome 10, complete sequence
          Length = 163869

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 251   caccaccacaacaacaaccacc 272
             ||||||||||||||||||||||
Sbjct: 40840 caccaccacaacaacaaccacc 40819

---

>emb|AL844513.8| Mouse DNA sequence from clone RP23-132A3 on chromosome 2, complete
             sequence
          Length = 131184

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 251   caccaccacaacaacaaccacc 272
             ||||||||||||||||||||||
Sbjct: 43420 caccaccacaacaacaaccacc 43441



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 251   caccaccacaacaacaaccacc 272
             ||||||||||||||||||||||
Sbjct: 43321 caccaccacaacaacaaccacc 43342

---

>emb|X01918.1|DMSGS378 Drosophila 68C glue gene cluster
          Length = 6751

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 251  caccaccacaacaacaaccacc 272
            ||||||||||||||||||||||
Sbjct: 2757 caccaccacaacaacaaccacc 2736



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 251 caccaccacaacaacaaccac 271
           |||||||||||||||||||||
Sbjct: 971 caccaccacaacaacaaccac 991

---

>gb|M14650.1|DROGBR D.melanogaster glue gene cluster 68C boundary region
          Length = 1900

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 251  caccaccacaacaacaaccacc 272
            ||||||||||||||||||||||
Sbjct: 1846 caccaccacaacaacaaccacc 1867

---

>gb|AY841017.1| Aegilops triuncialis low-molecular-weight glutenin subunit
           (LMW-At1) gene, complete cds
          Length = 1065

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 252 accaccacaacaacaaccacc 272
           |||||||||||||||||||||
Sbjct: 114 accaccacaacaacaaccacc 134

---

>gb|AY841014.1| Aegilops tauschii low-molecular-weight glutenin subunit (LMW-D2)
           gene, complete cds
          Length = 972

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 252 accaccacaacaacaaccacc 272
           |||||||||||||||||||||
Sbjct: 114 accaccacaacaacaaccacc 134

---

>gb|AY841013.1| Aegilops tauschii low-molecular-weight glutenin subunit (LMW-D1)
           gene, complete cds
          Length = 1065

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 252 accaccacaacaacaaccacc 272
           |||||||||||||||||||||
Sbjct: 114 accaccacaacaacaaccacc 134

---

>gb|AC107851.17| Mus musculus chromosome 9, clone RP23-451B4, complete sequence
          Length = 190253

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 251   caccaccacaacaacaaccac 271
             |||||||||||||||||||||
Sbjct: 25201 caccaccacaacaacaaccac 25221

---

>gb|AY829369.1| Secale sylvestre clone S16-23 low molecular weight glutenin subunit
           gene, complete cds
          Length = 840

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 252 accaccacaacaacaaccacc 272
           |||||||||||||||||||||
Sbjct: 114 accaccacaacaacaaccacc 134

---

>gb|AY829368.1| Secale sylvestre clone S16-12 low molecular weight glutenin subunit
           gene, complete cds
          Length = 1065

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 252 accaccacaacaacaaccacc 272
           |||||||||||||||||||||
Sbjct: 114 accaccacaacaacaaccacc 134

---

>ref|XM_641784.1| Dictyostelium discoideum hypothetical protein (DDB0189962), partial
            mRNA
          Length = 4563

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 251  caccaccacaacaacaaccac 271
            |||||||||||||||||||||
Sbjct: 1796 caccaccacaacaacaaccac 1816



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 252  accaccacaacaacaaccac 271
            ||||||||||||||||||||
Sbjct: 1824 accaccacaacaacaaccac 1843

---

>ref|XM_641505.1| Dictyostelium discoideum putative BRD family protein kinase
            (DDB0220693), partial mRNA
          Length = 4737

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 252  accaccacaacaacaaccacc 272
            |||||||||||||||||||||
Sbjct: 1932 accaccacaacaacaaccacc 1952

---

>ref|XM_640949.1| Dictyostelium discoideum hypothetical protein (DDB0190332), partial
           mRNA
          Length = 867

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 251 caccaccacaacaacaaccac 271
           |||||||||||||||||||||
Sbjct: 722 caccaccacaacaacaaccac 742

---

>ref|XM_639826.1| Dictyostelium discoideum hypothetical protein (DDB0168938), partial
           mRNA
          Length = 2283

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 251 caccaccacaacaacaaccac 271
           |||||||||||||||||||||
Sbjct: 264 caccaccacaacaacaaccac 284

---

>ref|XM_639952.1| Dictyostelium discoideum cAMP-binding protein (DDB0185022), partial
           mRNA
          Length = 1002

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 250 gcaccaccacaacaacaacca 270
           |||||||||||||||||||||
Sbjct: 280 gcaccaccacaacaacaacca 300

---

>ref|XM_639951.1| Dictyostelium discoideum cAMP-binding protein (DDB0185022), partial
           mRNA
          Length = 891

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 250 gcaccaccacaacaacaacca 270
           |||||||||||||||||||||
Sbjct: 169 gcaccaccacaacaacaacca 189

---

>ref|XM_639278.1| Dictyostelium discoideum hypothetical protein (DDB0217424), partial
           mRNA
          Length = 1002

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 250 gcaccaccacaacaacaacca 270
           |||||||||||||||||||||
Sbjct: 280 gcaccaccacaacaacaacca 300

---

>ref|XM_638325.1| Dictyostelium discoideum hypothetical protein (DDB0167308), partial
           mRNA
          Length = 2736

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 251 caccaccacaacaacaaccac 271
           |||||||||||||||||||||
Sbjct: 53  caccaccacaacaacaaccac 73

---

>ref|XM_514781.1| PREDICTED: Pan troglodytes similar to PTK6 protein tyrosine kinase
           6; breast tumor kinase; protein-tyrosine kinase BRK
           (LOC458409), mRNA
          Length = 1637

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 141 cccaccaccactgctccttcttcct 165
           |||||||||||||||||| ||||||
Sbjct: 337 cccaccaccactgctcctccttcct 313

---

>ref|XM_629675.1| Dictyostelium discoideum hypothetical protein (DDB0184304), partial
            mRNA
          Length = 2310

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 252  accaccacaacaacaaccacc 272
            |||||||||||||||||||||
Sbjct: 1000 accaccacaacaacaaccacc 1020

---

>ref|XM_629551.1| Dictyostelium discoideum hypothetical protein (DDB0184504), partial
           mRNA
          Length = 2277

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 251 caccaccacaacaacaaccac 271
           |||||||||||||||||||||
Sbjct: 725 caccaccacaacaacaaccac 745

---

>gb|AC139867.4| Mus musculus BAC clone RP23-430P22 from chromosome 1, complete sequence
          Length = 224730

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 251   caccaccacaacaacaaccac 271
             |||||||||||||||||||||
Sbjct: 39568 caccaccacaacaacaaccac 39588

---

>gb|AC167812.4| Mus musculus BAC clone RP24-299F5 from chromosome 18, complete sequence
          Length = 193523

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 505   ccgcggccgcctccgccgcgc 525
             |||||||||||||||||||||
Sbjct: 25908 ccgcggccgcctccgccgcgc 25928

---

>ref|XM_483462.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 543

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 505 ccgcggccgcctccgccgcgctcgc 529
           |||||||| ||||||||||||||||
Sbjct: 144 ccgcggcctcctccgccgcgctcgc 120

---

>ref|NM_193483.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 207 tcctcctcctccgcggccacggccaccac 235
           |||||||||||||| ||| ||||||||||
Sbjct: 271 tcctcctcctccgccgccgcggccaccac 299

---

>ref|XM_470239.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 936

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 251 caccaccacaacaacaaccaccggc 275
           |||||||||||| ||||||||||||
Sbjct: 625 caccaccacaaccacaaccaccggc 649

---

>ref|XM_478543.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 402

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 390 gccaccaacaacttcctcgcc 410
           |||||||||||||||||||||
Sbjct: 35  gccaccaacaacttcctcgcc 15

---

>gb|AY585355.1| Aegilops tauschii low molecular weight glutenin subunit LMW.S7
           precursor gene, complete cds
          Length = 1562

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 252 accaccacaacaacaaccacc 272
           |||||||||||||||||||||
Sbjct: 596 accaccacaacaacaaccacc 616

---

>gb|AY020570.1| Oryza sativa microsatellite MRG2895 containing (GT)X16, closest to
           marker G1149, genomic sequence
          Length = 232

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 505 ccgcggccgcctccgccgcgctcgc 529
           |||||||| ||||||||||||||||
Sbjct: 41  ccgcggcctcctccgccgcgctcgc 65

---

>gb|BT015281.1| Drosophila melanogaster LD08594 full insert cDNA
          Length = 4936

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 251  caccaccacaacaacaaccac 271
            |||||||||||||||||||||
Sbjct: 1588 caccaccacaacaacaaccac 1608

---

>gb|AC132345.4| Mus musculus BAC clone RP24-177P9 from chromosome 9, complete sequence
          Length = 183638

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 251    caccaccacaacaacaaccac 271
              |||||||||||||||||||||
Sbjct: 160950 caccaccacaacaacaaccac 160970

---

>ref|XM_952350.1| Neurospora crassa OR74A hypothetical protein (NCU07218.1) partial
            mRNA
          Length = 1563

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 251  caccaccacaacaacaaccac 271
            |||||||||||||||||||||
Sbjct: 1342 caccaccacaacaacaaccac 1362

---

>ref|XM_327503.1| Neurospora crassa OR74A hypothetical protein (NCU07218.1) partial
            mRNA
          Length = 1563

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 251  caccaccacaacaacaaccac 271
            |||||||||||||||||||||
Sbjct: 1342 caccaccacaacaacaaccac 1362

---

>ref|XM_708012.1| Candida albicans SC5314 hypothetical protein (CaO19.8342), mRNA
          Length = 2229

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 251 caccaccacaacaacaaccac 271
           |||||||||||||||||||||
Sbjct: 92  caccaccacaacaacaaccac 112

---

>ref|XM_707989.1| Candida albicans SC5314 hypothetical protein (CaO19.723), mRNA
          Length = 2223

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 251 caccaccacaacaacaaccac 271
           |||||||||||||||||||||
Sbjct: 95  caccaccacaacaacaaccac 115

---

>ref|XM_706959.1| Candida albicans SC5314 G1 cyclin (CaO19.10172), mRNA
          Length = 1116

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 251  caccaccacaacaacaaccac 271
            |||||||||||||||||||||
Sbjct: 1023 caccaccacaacaacaaccac 1043

---

>ref|XM_706938.1| Candida albicans SC5314 G1 cyclin (CaO19.2649), mRNA
          Length = 1122

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 251  caccaccacaacaacaaccac 271
            |||||||||||||||||||||
Sbjct: 1029 caccaccacaacaacaaccac 1049

---

>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome
          Length = 6397126

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 394     ccaacaacttcctcgccaagc 414
               |||||||||||||||||||||
Sbjct: 6035020 ccaacaacttcctcgccaagc 6035000

---

>gb|BT011124.1| Drosophila melanogaster LD09942 full insert cDNA
          Length = 4958

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 251  caccaccacaacaacaaccac 271
            |||||||||||||||||||||
Sbjct: 1610 caccaccacaacaacaaccac 1630

---

>gb|AC145753.1| Genomic sequence for Medicago truncatula, clone MTABa0058M19, complete
             sequence
          Length = 101565

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 251   caccaccacaacaacaaccac 271
             |||||||||||||||||||||
Sbjct: 51577 caccaccacaacaacaaccac 51557

---

>emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K14 on chromosome 20 Contains the
             C20orf148 gene for a novel tyrosine kinase, the PTK6 gene
             for protein tyrosine kinase 6, a novel gene, the EEF1A2
             gene for eukaryotic translation elongation factor 1 alpha
             2, the 5' end of the KCNQ2 gene for potassium
             voltage-gated channel (KQT-like subfamily member 2), the
             gene for peroxisomal proliferator-activated receptor A
             interacting complex 285 (PRIC285)(FLJ00244, KIAA1769), the
             C20orf149 gene, the gene for novel protein MGC5356
             (MGC5356), the gene for a novel protein (LOC200213), a
             novel gene and thirteen CpG islands, complete sequence
          Length = 113196

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 141   cccaccaccactgctccttcttcct 165
             |||||||||||||||||| ||||||
Sbjct: 66181 cccaccaccactgctcctccttcct 66205

---

>gb|AY214450.1| Triticum aestivum low-molecular-weight glutenin subunit mRNA,
           partial cds
          Length = 1050

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 252 accaccacaacaacaaccacc 272
           |||||||||||||||||||||
Sbjct: 114 accaccacaacaacaaccacc 134

---

>emb|BX072054.1|CNS09RRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 263

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 70  cgcaccaccacaacaacaacc 90

---

>emb|BX072011.1|CNS09RQ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 702

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 205 cgcaccaccacaacaacaacc 225

---

>emb|BX072010.1|CNS09RQ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 773

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 736 cgcaccaccacaacaacaacc 716

---

>emb|BX071935.1|CNS09RO3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 185 cgcaccaccacaacaacaacc 205

---

>emb|BX071934.1|CNS09RO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 721 cgcaccaccacaacaacaacc 701

---

>emb|BX071886.1|CNS09RMQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 182 cgcaccaccacaacaacaacc 202

---

>emb|BX071885.1|CNS09RMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 593 cgcaccaccacaacaacaacc 573

---

>emb|BX071198.1|CNS09R3M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 178 cgcaccaccacaacaacaacc 198

---

>emb|BX071197.1|CNS09R3L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 711 cgcaccaccacaacaacaacc 691

---

>emb|BX071134.1|CNS09R1U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 150

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 109 cgcaccaccacaacaacaacc 129

---

>emb|BX071327.1|CNS09R77 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 234

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 130 cgcaccaccacaacaacaacc 150

---

>emb|BX071326.1|CNS09R76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 711 cgcaccaccacaacaacaacc 691

---

>emb|BX071022.1|CNS09QYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 193 cgcaccaccacaacaacaacc 213

---

>emb|BX071021.1|CNS09QYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 726 cgcaccaccacaacaacaacc 706

---

>emb|BX070958.1|CNS09QWY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 191 cgcaccaccacaacaacaacc 211

---

>emb|BX070095.1|CNS09Q8Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 230

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 64  cgcaccaccacaacaacaacc 84

---

>emb|BX069941.1|CNS09Q4P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 184 cgcaccaccacaacaacaacc 204

---

>emb|BX069940.1|CNS09Q4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 696 cgcaccaccacaacaacaacc 676

---

>emb|BX069703.1|CNS09PY3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 163 cgcaccaccacaacaacaacc 183

---

>emb|BX069702.1|CNS09PY2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 705 cgcaccaccacaacaacaacc 685

---

>emb|BX060940.1|CNS09J6O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 392

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 119 cgcaccaccacaacaacaacc 139

---

>emb|BX060939.1|CNS09J6N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 705 cgcaccaccacaacaacaacc 685

---

>emb|BX069369.1|CNS09POT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 577

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 208 cgcaccaccacaacaacaacc 228

---

>emb|BX069368.1|CNS09POS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 732 cgcaccaccacaacaacaacc 712

---

>emb|BX069214.1|CNS09PKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 212 cgcaccaccacaacaacaacc 232

---

>emb|BX069213.1|CNS09PKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 722 cgcaccaccacaacaacaacc 702

---

>emb|BX068918.1|CNS09PCA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 214 cgcaccaccacaacaacaacc 234

---

>emb|BX068917.1|CNS09PC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 745 cgcaccaccacaacaacaacc 725

---

>emb|BX068891.1|CNS09PBJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 705 cgcaccaccacaacaacaacc 685

---

>emb|BX068781.1|CNS09P8H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 514

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 218 cgcaccaccacaacaacaacc 238

---

>emb|BX068780.1|CNS09P8G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 730 cgcaccaccacaacaacaacc 710

---

>emb|BX068699.1|CNS09P67 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 206 cgcaccaccacaacaacaacc 226

---

>emb|BX068698.1|CNS09P66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 715 cgcaccaccacaacaacaacc 695

---

>emb|BX068685.1|CNS09P5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 42  cgcaccaccacaacaacaacc 62

---

>emb|BX068632.1|CNS09P4C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 172 cgcaccaccacaacaacaacc 192

---

>emb|BX068631.1|CNS09P4B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 724 cgcaccaccacaacaacaacc 704

---

>emb|BX068390.1|CNS09OXM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 193 cgcaccaccacaacaacaacc 213

---

>emb|BX068389.1|CNS09OXL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 724 cgcaccaccacaacaacaacc 704

---

>emb|BX068343.1|CNS09OWB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 158 cgcaccaccacaacaacaacc 178

---

>emb|BX068342.1|CNS09OWA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 701 cgcaccaccacaacaacaacc 681

---

>emb|BX068334.1|CNS09OW2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 717 cgcaccaccacaacaacaacc 697

---

>emb|BX068305.1|CNS09OV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 336

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 72  cgcaccaccacaacaacaacc 92

---

>emb|BX068304.1|CNS09OV8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 729 cgcaccaccacaacaacaacc 709

---

>emb|BX068271.1|CNS09OUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 118 cgcaccaccacaacaacaacc 138

---

>emb|BX068270.1|CNS09OUA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 712 cgcaccaccacaacaacaacc 692

---

>emb|BX068265.1|CNS09OU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 182 cgcaccaccacaacaacaacc 202

---

>emb|BX068264.1|CNS09OU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 719 cgcaccaccacaacaacaacc 699

---

>emb|BX068004.1|CNS09OMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 832

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 171 cgcaccaccacaacaacaacc 191

---

>emb|BX068003.1|CNS09OMV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 822

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 699 cgcaccaccacaacaacaacc 679

---

>emb|BX067731.1|CNS09OFB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 193 cgcaccaccacaacaacaacc 213

---

>emb|BX067730.1|CNS09OFA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 721 cgcaccaccacaacaacaacc 701

---

>emb|BX067102.1|CNS09NXU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 564

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 209 cgcaccaccacaacaacaacc 229

---

>emb|BX067101.1|CNS09NXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 729 cgcaccaccacaacaacaacc 709

---

>emb|BX066999.1|CNS09NUZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 201 cgcaccaccacaacaacaacc 221

---

>emb|BX066998.1|CNS09NUY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 723 cgcaccaccacaacaacaacc 703

---

>emb|BX066931.1|CNS09NT3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 720 cgcaccaccacaacaacaacc 700

---

>emb|BX066843.1|CNS09NQN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 200 cgcaccaccacaacaacaacc 220

---

>emb|BX066842.1|CNS09NQM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 728 cgcaccaccacaacaacaacc 708

---

>emb|BX066444.1|CNS09NFK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 715 cgcaccaccacaacaacaacc 695

---

>emb|BX065926.1|CNS09N16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 508

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 195 cgcaccaccacaacaacaacc 215

---

>emb|BX065925.1|CNS09N15 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 712 cgcaccaccacaacaacaacc 692

---

>emb|BX065769.1|CNS09MWT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 190 cgcaccaccacaacaacaacc 210

---

>emb|BX065768.1|CNS09MWS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 727 cgcaccaccacaacaacaacc 707

---

>emb|BX065563.1|CNS09MR3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 172 cgcaccaccacaacaacaacc 192

---

>emb|BX065562.1|CNS09MR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 752 cgcaccaccacaacaacaacc 732

---

>emb|BX065399.1|CNS09MMJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 180 cgcaccaccacaacaacaacc 200

---

>emb|BX065398.1|CNS09MMI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 706 cgcaccaccacaacaacaacc 686

---

>emb|BX065379.1|CNS09MLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 196 cgcaccaccacaacaacaacc 216

---

>emb|BX065287.1|CNS09MJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 181 cgcaccaccacaacaacaacc 201

---

>emb|BX065286.1|CNS09MJE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 709 cgcaccaccacaacaacaacc 689

---

>emb|BX065104.1|CNS09MEC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 178 cgcaccaccacaacaacaacc 198

---

>emb|BX065103.1|CNS09MEB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 708 cgcaccaccacaacaacaacc 688

---

>emb|BX065085.1|CNS09MDT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 681

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 540 cgcaccaccacaacaacaacc 520

---

>emb|BX065080.1|CNS09MDO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 173 cgcaccaccacaacaacaacc 193

---

>emb|BX065079.1|CNS09MDN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 710 cgcaccaccacaacaacaacc 690

---

>emb|BX065033.1|CNS09MCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 173 cgcaccaccacaacaacaacc 193

---

>emb|BX065032.1|CNS09MCC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 701 cgcaccaccacaacaacaacc 681

---

>emb|BX064041.1|CNS09LKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 726 cgcaccaccacaacaacaacc 706

---

>emb|BX063680.1|CNS09LAS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 590 cgcaccaccacaacaacaacc 570

---

>emb|BX063679.1|CNS09LAR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 183 cgcaccaccacaacaacaacc 203

---

>emb|BX063678.1|CNS09LAQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 705 cgcaccaccacaacaacaacc 685

---

>emb|BX063630.1|CNS09L9E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 555

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 195 cgcaccaccacaacaacaacc 215

---

>emb|BX063028.1|CNS09KSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 184 cgcaccaccacaacaacaacc 204

---

>emb|BX063027.1|CNS09KSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 839 cgcaccaccacaacaacaacc 819

---

>emb|BX062931.1|CNS09KPZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 485

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 192 cgcaccaccacaacaacaacc 212

---

>emb|BX062913.1|CNS09KPH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 181 cgcaccaccacaacaacaacc 201

---

>emb|BX062912.1|CNS09KPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 713 cgcaccaccacaacaacaacc 693

---

>emb|BX062805.1|CNS09KMH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 718 cgcaccaccacaacaacaacc 698

---

>emb|BX062755.1|CNS09KL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 695

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 579 cgcaccaccacaacaacaacc 559

---

>emb|BX062625.1|CNS09KHH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 176 cgcaccaccacaacaacaacc 196

---

>emb|BX062624.1|CNS09KHG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 709 cgcaccaccacaacaacaacc 689

---

>emb|BX062166.1|CNS09K4Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 188 cgcaccaccacaacaacaacc 208

---

>emb|BX062165.1|CNS09K4P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 719 cgcaccaccacaacaacaacc 699

---

>emb|BX062119.1|CNS09K3F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 169 cgcaccaccacaacaacaacc 189

---

>emb|BX062118.1|CNS09K3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 715 cgcaccaccacaacaacaacc 695

---

>emb|BX062090.1|CNS09K2M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 684 cgcaccaccacaacaacaacc 664

---

>emb|BX061845.1|CNS09JVT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 206 cgcaccaccacaacaacaacc 226

---

>emb|BX061453.1|CNS09JKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 76  cgcaccaccacaacaacaacc 96

---

>emb|BX061452.1|CNS09JKW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 621 cgcaccaccacaacaacaacc 601

---

>emb|BX061383.1|CNS09JIZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 702 cgcaccaccacaacaacaacc 682

---

>emb|BX061185.1|CNS09JDH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 281

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 188 cgcaccaccacaacaacaacc 208

---

>emb|BX061184.1|CNS09JDG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 709 cgcaccaccacaacaacaacc 689

---

>emb|BX060474.1|CNS09ITQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 730 cgcaccaccacaacaacaacc 710

---

>emb|BX060315.1|CNS09IPB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 124 cgcaccaccacaacaacaacc 144

---

>emb|BX060156.1|CNS09IKW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 241

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 154 cgcaccaccacaacaacaacc 174

---

>emb|BX060073.1|CNS09IIL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 473

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 187 cgcaccaccacaacaacaacc 207

---

>emb|BX060072.1|CNS09IIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1043

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 965 cgcaccaccacaacaacaacc 945

---

>emb|BX060047.1|CNS09IHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 445

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 180 cgcaccaccacaacaacaacc 200

---

>emb|BX059980.1|CNS09IG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 197 cgcaccaccacaacaacaacc 217

---

>emb|BX059979.1|CNS09IFZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 723 cgcaccaccacaacaacaacc 703

---

>emb|BX059598.1|CNS09I5E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 184 cgcaccaccacaacaacaacc 204

---

>emb|BX059597.1|CNS09I5D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 721 cgcaccaccacaacaacaacc 701

---

>emb|BX059276.1|CNS09HWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 702 cgcaccaccacaacaacaacc 682

---

>emb|BX059262.1|CNS09HW2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 728 cgcaccaccacaacaacaacc 708

---

>emb|BX059230.1|CNS09HV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 709 cgcaccaccacaacaacaacc 689

---

>emb|BX058872.1|CNS09HL8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 155 cgcaccaccacaacaacaacc 175

---

>emb|BX058871.1|CNS09HL7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 692 cgcaccaccacaacaacaacc 672

---

>emb|BX058808.1|CNS09HJG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 167 cgcaccaccacaacaacaacc 187

---

>emb|BX058807.1|CNS09HJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 691 cgcaccaccacaacaacaacc 671

---

>emb|BX058560.1|CNS09HCK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 172 cgcaccaccacaacaacaacc 192

---

>emb|BX058281.1|CNS09H4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 191 cgcaccaccacaacaacaacc 211

---

>emb|BX058280.1|CNS09H4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 726 cgcaccaccacaacaacaacc 706

---

>emb|BX058269.1|CNS09H4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 738

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 655 cgcaccaccacaacaacaacc 635

---

>emb|BX056753.1|CNS09FYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 187 cgcaccaccacaacaacaacc 207

---

>emb|BX056601.1|CNS09FU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 686 cgcaccaccacaacaacaacc 666

---

>emb|BX057958.1|CNS09GVU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 699 cgcaccaccacaacaacaacc 679

---

>emb|BX057087.1|CNS09G7N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 177 cgcaccaccacaacaacaacc 197

---

>emb|BX056891.1|CNS09G27 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 720 cgcaccaccacaacaacaacc 700

---

>emb|BX056571.1|CNS09FTB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 653 cgcaccaccacaacaacaacc 633

---

>emb|BX056553.1|CNS09FST Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 182 cgcaccaccacaacaacaacc 202

---

>emb|BX056552.1|CNS09FSS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 689 cgcaccaccacaacaacaacc 669

---

>emb|BX056479.1|CNS09FQR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 177 cgcaccaccacaacaacaacc 197

---

>emb|BX056478.1|CNS09FQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 249 cgcaccaccacaacaacaacc 269
           |||||||||||||||||||||
Sbjct: 699 cgcaccaccacaacaacaacc 679


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,172,702
Number of Sequences: 3902068
Number of extensions: 7172702
Number of successful extensions: 209468
Number of sequences better than 10.0: 673
Number of HSP's better than 10.0 without gapping: 688
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 201984
Number of HSP's gapped (non-prelim): 7463
length of query: 598
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 575
effective length of database: 17,143,297,704
effective search space: 9857396179800
effective search space used: 9857396179800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---