Clone Name | bart54f02 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_477795.1| Oryza sativa (japonica cultivar-group), mRNA Length = 804 Score = 192 bits (97), Expect = 8e-46 Identities = 217/257 (84%) Strand = Plus / Plus Query: 264 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 323 |||||||||||||| | ||||||||||||||||||||| ||||| || |||||||| Sbjct: 94 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 153 Query: 324 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 383 || || || ||||| ||||| || | |||||||| || ||||||||||||||| || || Sbjct: 154 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 213 Query: 384 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 443 ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| |||||| Sbjct: 214 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 273 Query: 444 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 503 |||||||| ||||| |||||| |||| ||||| || |||||| |||||| |||| ||| Sbjct: 274 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 333 Query: 504 aaccttctgaggctgtt 520 || ||||| |||||||| Sbjct: 334 aatcttctaaggctgtt 350 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 171 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 225 |||||||||||| ||||||||||||||||||| ||| ||||||||||| |||| Sbjct: 1 atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 55
>dbj|AK061408.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-A10, full insert sequence Length = 1053 Score = 192 bits (97), Expect = 8e-46 Identities = 217/257 (84%) Strand = Plus / Plus Query: 264 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 323 |||||||||||||| | ||||||||||||||||||||| ||||| || |||||||| Sbjct: 173 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 232 Query: 324 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 383 || || || ||||| ||||| || | |||||||| || ||||||||||||||| || || Sbjct: 233 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 292 Query: 384 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 443 ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| |||||| Sbjct: 293 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 352 Query: 444 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 503 |||||||| ||||| |||||| |||| ||||| || |||||| |||||| |||| ||| Sbjct: 353 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 412 Query: 504 aaccttctgaggctgtt 520 || ||||| |||||||| Sbjct: 413 aatcttctaaggctgtt 429 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 171 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 225 |||||||||||| ||||||||||||||||||| ||| ||||||||||| |||| Sbjct: 80 atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 134
>dbj|AK061383.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-H08, full insert sequence Length = 1230 Score = 192 bits (97), Expect = 8e-46 Identities = 217/257 (84%) Strand = Plus / Plus Query: 264 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 323 |||||||||||||| | ||||||||||||||||||||| ||||| || |||||||| Sbjct: 185 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 244 Query: 324 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 383 || || || ||||| ||||| || | |||||||| || ||||||||||||||| || || Sbjct: 245 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 304 Query: 384 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 443 ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| |||||| Sbjct: 305 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 364 Query: 444 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 503 |||||||| ||||| |||||| |||| ||||| || |||||| |||||| |||| ||| Sbjct: 365 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 424 Query: 504 aaccttctgaggctgtt 520 || ||||| |||||||| Sbjct: 425 aatcttctaaggctgtt 441 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 171 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 225 |||||||||||| ||||||||||||||||||| ||| ||||||||||| |||| Sbjct: 92 atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 146
>dbj|AB037153.1| Oryza sativa (japonica cultivar-group) OsRPN12 mRNA for 26S proteasome regulatory particle non-ATPase subunit12, complete cds Length = 1063 Score = 192 bits (97), Expect = 8e-46 Identities = 217/257 (84%) Strand = Plus / Plus Query: 264 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 323 |||||||||||||| | ||||||||||||||||||||| ||||| || |||||||| Sbjct: 169 tcgcagctcaaggtccgcctcaccaagttccccagccttcctccatcatttcagcagaca 228 Query: 324 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 383 || || || ||||| ||||| || | |||||||| || ||||||||||||||| || || Sbjct: 229 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 288 Query: 384 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 443 ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| |||||| Sbjct: 289 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 348 Query: 444 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 503 |||||||| ||||| |||||| |||| ||||| || |||||| |||||| |||| ||| Sbjct: 349 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 408 Query: 504 aaccttctgaggctgtt 520 || ||||| |||||||| Sbjct: 409 aatcttctaaggctgtt 425 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 171 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 225 |||||||||||| ||||||||||||||||||| ||| ||||||||||| |||| Sbjct: 76 atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 130
>gb|BT016262.1| Zea mays clone Contig95 mRNA sequence Length = 1020 Score = 184 bits (93), Expect = 2e-43 Identities = 273/333 (81%) Strand = Plus / Plus Query: 189 gaggtgacgcagctgttcgaacgcttcaaggcggcctgcaagcgcagcgatctcgacgcc 248 |||||||| ||| |||||| |||||||||||||||| | |||| ||| ||| || || Sbjct: 21 gaggtgacccagatgttcgcccgcttcaaggcggcctacgcccgcaacgacctcaacacc 80 Query: 249 tccgcgaccctcctctcgcagctcaaggtgctcctcaccaagttccccagcctccctccg 308 | || ||||||||||||||||||||||| | |||||| | ||||||||||| || || Sbjct: 81 tgcgtcaccctcctctcgcagctcaaggtccatctcacccaattccccagccttccgccc 140 Query: 309 ctcttccagcagacgcccaacgccgtggaggagctcaagctcgcgagggaaatttatgag 368 | || |||||||| || ||| |||||||||||||| || || ||||| ||||||||| Sbjct: 141 ttgtttcagcagacaccgaacattgtggaggagctcaaacttgcaagggacatttatgag 200 Query: 369 catgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggacttctgc 428 ||||| ||| |||||||||||||| | || || |||||||| |||||| | || |||||| Sbjct: 201 catgctgttgttttgagtgtgaaacttgaggaccaagatgcgtttgaacgcgatttctgc 260 Query: 429 cagctcaagccttattacatggacacatgtggcatacttcctccatcttcaatggagtac 488 ||||| ||||||||||||||||| |||||||||||| |||| | || || ||||||| Sbjct: 261 cagctgaagccttattacatggatacatgtggcataattcccgcctcgccagaggagtac 320 Query: 489 ccaatcatggggcttaaccttctgaggctgttg 521 ||||| |||| || || ||||||||||||||| Sbjct: 321 ccaattttgggactcaatcttctgaggctgttg 353
>dbj|AK101316.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034D03, full insert sequence Length = 1218 Score = 184 bits (93), Expect = 2e-43 Identities = 216/257 (84%) Strand = Plus / Plus Query: 264 tcgcagctcaaggtgctcctcaccaagttccccagcctccctccgctcttccagcagacg 323 |||||||||||||| | ||||||||||||||| ||||| ||||| || |||||||| Sbjct: 174 tcgcagctcaaggtccgcctcaccaagttcccaagccttcctccatcatttcagcagaca 233 Query: 324 cccaacgccgtggaggagctcaagctcgcgagggaaatttatgagcatgcagttcttttg 383 || || || ||||| ||||| || | |||||||| || ||||||||||||||| || || Sbjct: 234 ccgaatgcagtggaagagctgaaaattgcgagggacatctatgagcatgcagttgttctg 293 Query: 384 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 443 ||||||||||| ||||| ||||||||||||||||||||||| || || ||||| |||||| Sbjct: 294 agtgtgaaaattgaagaccaagatgcatttgaaagggacttttgtcaactcaaaccttat 353 Query: 444 tacatggacacatgtggcatacttcctccatcttcaatggagtacccaatcatggggctt 503 |||||||| ||||| |||||| |||| ||||| || |||||| |||||| |||| ||| Sbjct: 354 tacatggatacatgcggcataattccaccatcaccacaggagtatccaatcttgggtctt 413 Query: 504 aaccttctgaggctgtt 520 || ||||| |||||||| Sbjct: 414 aatcttctaaggctgtt 430 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Plus Query: 171 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 225 |||||||||||| ||||||||||||||||||| ||| ||||||||||| |||| Sbjct: 81 atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 135
>gb|AY103818.1| Zea mays PCO124949 mRNA sequence Length = 1251 Score = 184 bits (93), Expect = 2e-43 Identities = 273/333 (81%) Strand = Plus / Plus Query: 189 gaggtgacgcagctgttcgaacgcttcaaggcggcctgcaagcgcagcgatctcgacgcc 248 |||||||| ||| |||||| |||||||||||||||| | |||| ||| ||| || || Sbjct: 227 gaggtgacccagatgttcgcccgcttcaaggcggcctacgcccgcaacgacctcaacacc 286 Query: 249 tccgcgaccctcctctcgcagctcaaggtgctcctcaccaagttccccagcctccctccg 308 | || ||||||||||||||||||||||| | |||||| | ||||||||||| || || Sbjct: 287 tgcgtcaccctcctctcgcagctcaaggtccatctcacccaattccccagccttccgccc 346 Query: 309 ctcttccagcagacgcccaacgccgtggaggagctcaagctcgcgagggaaatttatgag 368 | || |||||||| || ||| |||||||||||||| || || ||||| ||||||||| Sbjct: 347 ttgtttcagcagacaccgaacattgtggaggagctcaaacttgcaagggacatttatgag 406 Query: 369 catgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggacttctgc 428 ||||| ||| |||||||||||||| | || || |||||||| |||||| | || |||||| Sbjct: 407 catgctgttgttttgagtgtgaaacttgaggaccaagatgcgtttgaacgcgatttctgc 466 Query: 429 cagctcaagccttattacatggacacatgtggcatacttcctccatcttcaatggagtac 488 ||||| ||||||||||||||||| |||||||||||| |||| | || || ||||||| Sbjct: 467 cagctgaagccttattacatggatacatgtggcataattcccgcctcgccagaggagtac 526 Query: 489 ccaatcatggggcttaaccttctgaggctgttg 521 ||||| |||| || || ||||||||||||||| Sbjct: 527 ccaattttgggactcaatcttctgaggctgttg 559
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 117 bits (59), Expect = 4e-23 Identities = 86/95 (90%) Strand = Plus / Minus Query: 363 tatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggac 422 ||||||||||||||| || ||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 14475455 tatgagcatgcagttgttctgagtgtgaaaattgaagaccaagatgcatttgaaagggac 14475396 Query: 423 ttctgccagctcaagccttattacatggacacatg 457 || || || ||||| |||||||||||||| ||||| Sbjct: 14475395 ttttgtcaactcaaaccttattacatggatacatg 14475361 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 171 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 225 |||||||||||| ||||||||||||||||||| ||| ||||||||||| |||| Sbjct: 14476852 atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 14476798 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 281 cctcaccaagttccccagcctccctcc 307 ||||||||||||||||||||| ||||| Sbjct: 14476273 cctcaccaagttccccagccttcctcc 14476247
>dbj|AP005200.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0673E01 Length = 125909 Score = 117 bits (59), Expect = 4e-23 Identities = 86/95 (90%) Strand = Plus / Minus Query: 363 tatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcatttgaaagggac 422 ||||||||||||||| || ||||||||||||| ||||| ||||||||||||||||||||| Sbjct: 95786 tatgagcatgcagttgttctgagtgtgaaaattgaagaccaagatgcatttgaaagggac 95727 Query: 423 ttctgccagctcaagccttattacatggacacatg 457 || || || ||||| |||||||||||||| ||||| Sbjct: 95726 ttttgtcaactcaaaccttattacatggatacatg 95692 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 171 atggatccgaagttggtggaggtgacgcagctgttcgaacgcttcaaggcggcct 225 |||||||||||| ||||||||||||||||||| ||| ||||||||||| |||| Sbjct: 97183 atggatccgaagctggtggaggtgacgcagctcttctcccgcttcaaggcagcct 97129 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 281 cctcaccaagttccccagcctccctcc 307 ||||||||||||||||||||| ||||| Sbjct: 96604 cctcaccaagttccccagccttcctcc 96578
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007, complete sequence Length = 92741 Score = 52.0 bits (26), Expect = 0.002 Identities = 53/62 (85%) Strand = Plus / Minus Query: 384 agtgtgaaaatggaagatcaagatgcatttgaaagggacttctgccagctcaagccttat 443 |||||||||| || ||||||||||| ||||| ||||| |||| |||||| || |||||| Sbjct: 83685 agtgtgaaaactgaggatcaagatgcctttgagagggatttcttccagctgaaaccttat 83626 Query: 444 ta 445 || Sbjct: 83625 ta 83624
>gb|AC113514.9| Mus musculus chromosome 19, clone RP23-475D11, complete sequence Length = 170366 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 286 ccaagttccccagcctccctcc 307 |||||||||||||||||||||| Sbjct: 125636 ccaagttccccagcctccctcc 125657
>gb|AC116128.15| Mus musculus chromosome 19, clone RP23-95H3, complete sequence Length = 228363 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 286 ccaagttccccagcctccctcc 307 |||||||||||||||||||||| Sbjct: 13756 ccaagttccccagcctccctcc 13777
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 203 gttcgaacgcttcaaggcggcc 224 |||||||||||||||||||||| Sbjct: 4901285 gttcgaacgcttcaaggcggcc 4901264
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 203 gttcgaacgcttcaaggcggcc 224 |||||||||||||||||||||| Sbjct: 4904302 gttcgaacgcttcaaggcggcc 4904281
>ref|NM_105127.2| Arabidopsis thaliana peptidase AT1G64520 mRNA, complete cds Length = 1063 Score = 42.1 bits (21), Expect = 1.8 Identities = 72/89 (80%) Strand = Plus / Plus Query: 354 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 413 ||||| |||||||||||||| ||| || | || || |||| || ||||||||||| ||| Sbjct: 245 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 304 Query: 414 gaaagggacttctgccagctcaagcctta 442 || || || |||| |||||| || ||||| Sbjct: 305 gagagagatttcttccagctgaaacctta 333
>gb|AY230847.1| Arabidopsis thaliana 26S proteasome subunit RPN12 (RPN12) mRNA, RPN12-2 allele, complete cds Length = 1054 Score = 42.1 bits (21), Expect = 1.8 Identities = 72/89 (80%) Strand = Plus / Plus Query: 354 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 413 ||||| |||||||||||||| ||| || | || || |||| || ||||||||||| ||| Sbjct: 217 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 276 Query: 414 gaaagggacttctgccagctcaagcctta 442 || || || |||| |||||| || ||||| Sbjct: 277 gagagagatttcttccagctgaaacctta 305
>gb|AY230846.1| Arabidopsis thaliana 26S proteasome subunit RPN12 (RPN12) mRNA, RPN12-1 allele, complete cds Length = 1038 Score = 42.1 bits (21), Expect = 1.8 Identities = 72/89 (80%) Strand = Plus / Plus Query: 354 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 413 ||||| |||||||||||||| ||| || | || || |||| || ||||||||||| ||| Sbjct: 207 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 266 Query: 414 gaaagggacttctgccagctcaagcctta 442 || || || |||| |||||| || ||||| Sbjct: 267 gagagagatttcttccagctgaaacctta 295
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 205 tcgaacgcttcaaggcggcctgcaagcgc 233 ||||||||||| ||||||| ||||||||| Sbjct: 411439 tcgaacgcttcgaggcggcgtgcaagcgc 411411
>gb|AY143888.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, complete cds Length = 804 Score = 42.1 bits (21), Expect = 1.8 Identities = 72/89 (80%) Strand = Plus / Plus Query: 354 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 413 ||||| |||||||||||||| ||| || | || || |||| || ||||||||||| ||| Sbjct: 184 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 243 Query: 414 gaaagggacttctgccagctcaagcctta 442 || || || |||| |||||| || ||||| Sbjct: 244 gagagagatttcttccagctgaaacctta 272
>emb|AL356234.18| Human DNA sequence from clone RP11-95M15 on chromosome 6 Contains a novel gene and a protein tyrosine phosphatase non-receptor type 11 (Nooan syndrome) (PTPN11) pseudogene, complete sequence Length = 115224 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 401 tcaagatgcatttgaaaggga 421 ||||||||||||||||||||| Sbjct: 56493 tcaagatgcatttgaaaggga 56473
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 328 acgccgtggaggagctcaagctcgc 352 |||||||||| |||||||||||||| Sbjct: 2316349 acgccgtggatgagctcaagctcgc 2316373
>gb|AC104122.2| Homo sapiens chromosome 5 clone RP11-410P18, complete sequence Length = 142636 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 397 aagatcaagatgcatttgaaa 417 ||||||||||||||||||||| Sbjct: 45212 aagatcaagatgcatttgaaa 45192
>gb|AC027323.5| Homo sapiens chromosome 5 clone CTD-2034A10, complete sequence Length = 140016 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 397 aagatcaagatgcatttgaaa 417 ||||||||||||||||||||| Sbjct: 103937 aagatcaagatgcatttgaaa 103917
>gb|AF410265.1|AF410265 Arabidopsis thaliana At1g64520/F1N19_10 mRNA, complete cds Length = 1008 Score = 42.1 bits (21), Expect = 1.8 Identities = 72/89 (80%) Strand = Plus / Plus Query: 354 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 413 ||||| |||||||||||||| ||| || | || || |||| || ||||||||||| ||| Sbjct: 230 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 289 Query: 414 gaaagggacttctgccagctcaagcctta 442 || || || |||| |||||| || ||||| Sbjct: 290 gagagagatttcttccagctgaaacctta 318
>gb|AY039857.1| Arabidopsis thaliana At1g64520/F1N19_10 mRNA, complete cds Length = 953 Score = 42.1 bits (21), Expect = 1.8 Identities = 72/89 (80%) Strand = Plus / Plus Query: 354 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 413 ||||| |||||||||||||| ||| || | || || |||| || ||||||||||| ||| Sbjct: 193 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 252 Query: 414 gaaagggacttctgccagctcaagcctta 442 || || || |||| |||||| || ||||| Sbjct: 253 gagagagatttcttccagctgaaacctta 281
>gb|AC154014.4| Mus musculus 6 BAC RP24-409C18 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 161963 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 376 ttcttttgagtgtgaaaatgg 396 ||||||||||||||||||||| Sbjct: 65231 ttcttttgagtgtgaaaatgg 65251
>emb|BX816010.1|CNS0ABWV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH22ZE10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 960 Score = 42.1 bits (21), Expect = 1.8 Identities = 72/89 (80%) Strand = Plus / Plus Query: 354 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 413 ||||| |||||||||||||| ||| || | || || |||| || ||||||||||| ||| Sbjct: 237 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 296 Query: 414 gaaagggacttctgccagctcaagcctta 442 || || || |||| |||||| || ||||| Sbjct: 297 gagagagatttcttccagctgaaacctta 325
>emb|BX815245.1|CNS0AAGS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS46ZA05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1025 Score = 42.1 bits (21), Expect = 1.8 Identities = 72/89 (80%) Strand = Plus / Plus Query: 354 agggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcattt 413 ||||| |||||||||||||| ||| || | || || |||| || ||||||||||| ||| Sbjct: 226 agggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgctttt 285 Query: 414 gaaagggacttctgccagctcaagcctta 442 || || || |||| |||||| || ||||| Sbjct: 286 gagagagatttcttccagctgaaacctta 314
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 191 ggtgacgcagctgttcgaacgcttc 215 |||||||||| |||||||||||||| Sbjct: 2624545 ggtgacgcagttgttcgaacgcttc 2624521
>emb|AL732474.8| Mouse DNA sequence from clone RP23-180I2 on chromosome 4, complete sequence Length = 151555 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 385 gtgtgaaaatggaagatcaag 405 ||||||||||||||||||||| Sbjct: 65908 gtgtgaaaatggaagatcaag 65888
>emb|AL606917.12| Mouse DNA sequence from clone RP23-25K8 on chromosome 4, complete sequence Length = 52163 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 281 cctcaccaagttccccagcct 301 ||||||||||||||||||||| Sbjct: 48847 cctcaccaagttccccagcct 48867
>emb|CT010576.9| Mouse DNA sequence from clone RP23-193B21 on chromosome 16, complete sequence Length = 208110 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 402 caagatgcatttgaaaggga 421 |||||||||||||||||||| Sbjct: 45956 caagatgcatttgaaaggga 45975
>ref|XM_742921.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g03290) partial mRNA Length = 1701 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 334 tggaggagctcaagctcgcg 353 |||||||||||||||||||| Sbjct: 1111 tggaggagctcaagctcgcg 1130
>ref|XM_804113.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507883.70) partial mRNA Length = 2187 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 52 gcggcgctcgatctcatcat 71 |||||||||||||||||||| Sbjct: 1159 gcggcgctcgatctcatcat 1178
>ref|XM_814008.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506195.70) partial mRNA Length = 2190 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 52 gcggcgctcgatctcatcat 71 |||||||||||||||||||| Sbjct: 1162 gcggcgctcgatctcatcat 1181
>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16 Length = 349876 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 caaggcggcctgcaagcgca 234 |||||||||||||||||||| Sbjct: 326685 caaggcggcctgcaagcgca 326666
>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14 Length = 348014 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 caaggcggcctgcaagcgca 234 |||||||||||||||||||| Sbjct: 239408 caaggcggcctgcaagcgca 239389
>emb|BX640419.1| Bordetella pertussis strain Tohama I, complete genome; segment 9/12 Length = 349672 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 215 caaggcggcctgcaagcgca 234 |||||||||||||||||||| Sbjct: 310663 caaggcggcctgcaagcgca 310682
>emb|BX572598.1| Rhodopseudomonas palustris CGA009 complete genome; segment 6/16 Length = 346879 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 262 tctcgcagctcaaggtgctcctcaccaa 289 |||||| |||||||||||| |||||||| Sbjct: 275383 tctcgctgctcaaggtgctgctcaccaa 275356
>gb|AC010186.6| Homo sapiens 12p12-21.3-21.8 BAC RP11-705C15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 74801 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 401 tcaagatgcatttgaaaggg 420 |||||||||||||||||||| Sbjct: 27171 tcaagatgcatttgaaaggg 27190
>gb|AC009519.4|AC009519 Genomic sequence for Arabidopsis thaliana BAC F1N19 from chromosome I, complete sequence Length = 113172 Score = 40.1 bits (20), Expect = 7.0 Identities = 71/88 (80%) Strand = Plus / Plus Query: 355 gggaaatttatgagcatgcagttcttttgagtgtgaaaatggaagatcaagatgcatttg 414 |||| |||||||||||||| ||| || | || || |||| || ||||||||||| |||| Sbjct: 25525 gggacatttatgagcatgctgttgttctaagcgtcaaaaccgaggatcaagatgcttttg 25584 Query: 415 aaagggacttctgccagctcaagcctta 442 | || || |||| |||||| || ||||| Sbjct: 25585 agagagatttcttccagctgaaacctta 25612 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,644,440 Number of Sequences: 3902068 Number of extensions: 3644440 Number of successful extensions: 71368 Number of sequences better than 10.0: 41 Number of HSP's better than 10.0 without gapping: 41 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 71015 Number of HSP's gapped (non-prelim): 344 length of query: 521 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 498 effective length of database: 17,143,297,704 effective search space: 8537362256592 effective search space used: 8537362256592 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)