>emb|CR956433.5| Pig DNA sequence from clone CH242-96L23 on chromosome 7, complete
             sequence
          Length = 81700

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 98    gctgcttctgatcatcttgtctagttcctgcctcctg 134
             |||| |||| ||||||||||||  |||||||||||||
Sbjct: 32565 gctgattctcatcatcttgtctctttcctgcctcctg 32529

>gb|AY510455.1| Aspergillus flavus isolate AF36 aflatoxin biosynthesis gene cluster,
             complete sequence
          Length = 78264

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tgctccggacacaaggtgat 247
             ||||||||||||||||||||
Sbjct: 61064 tgctccggacacaaggtgat 61045

>emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome
          Length = 1395502

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    gtgcaaatgcaggtgctgga 155
              ||||||||||||||||||||
Sbjct: 351547 gtgcaaatgcaggtgctgga 351528

>emb|Z98745.1|HS29K1 Human DNA sequence from clone RP1-29K1 on chromosome 6p21.3-22.2.
             Contains the gene for KIAA0426 (C2H2 type zinc finger
             protein), the gene for a novel C2H2 type zinc finger
             protein, a COX11 (COX11 (yeast) homolog, cytochrome c
             oxidase assembly protein) pseudogene, the olfactory
             receptor 2E1 pseudogene OR2E1P, the 3' end of a glutathion
             peroxidase pseudogene, ESTs, STSs, GSS and three CpG
             islands, complete sequence
          Length = 128779

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 125   ctgcctcctgagtgcaaatg 144
             ||||||||||||||||||||
Sbjct: 93717 ctgcctcctgagtgcaaatg 93698

>gb|AE012386.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 294
           of 460 of the complete genome
          Length = 10029

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 144 gcaggtgctggagatcacca 163
           ||||||||||||||||||||
Sbjct: 552 gcaggtgctggagatcacca 533

>dbj|AB196490.1| Aspergillus oryzae DNA, aflatoxin biosynthesis gene cluster, complete
             sequence, strain: RIB40
          Length = 89641

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tgctccggacacaaggtgat 247
             ||||||||||||||||||||
Sbjct: 71154 tgctccggacacaaggtgat 71135

>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 228   tgctccggacacaaggtgat 247
             ||||||||||||||||||||
Sbjct: 77649 tgctccggacacaaggtgat 77630

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 144     gcaggtgctggagatcacca 163
               ||||||||||||||||||||
Sbjct: 1672800 gcaggtgctggagatcacca 1672819

>gb|AC154307.2| Mus musculus BAC clone RP23-377C12 from chromosome 9, complete sequence
          Length = 186985

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    ctgcttctgatcatcttgtc 118
             ||||||||||||||||||||
Sbjct: 91321 ctgcttctgatcatcttgtc 91340

>gb|AC005678.1|AC005678 Homo sapiens PAC clone RP11-569I24 from 7, complete sequence
          Length = 187543

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 125    ctgcctcctgagtgcaaatg 144
              ||||||||||||||||||||
Sbjct: 138748 ctgcctcctgagtgcaaatg 138729

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 65      cgtgaccgtgaagggctccg 84
               ||||||||||||||||||||
Sbjct: 4617409 cgtgaccgtgaagggctccg 4617390

>emb|BX004856.5| Zebrafish DNA sequence from clone CH211-166O17 in linkage group 5,
             complete sequence
          Length = 124886

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 114   ttgtctagttcctgcctcct 133
             ||||||||||||||||||||
Sbjct: 40808 ttgtctagttcctgcctcct 40789


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,276,860
Number of Sequences: 3902068
Number of extensions: 3276860
Number of successful extensions: 88139
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88041
Number of HSP's gapped (non-prelim): 98
length of query: 421
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 399
effective length of database: 17,147,199,772
effective search space: 6841732709028
effective search space used: 6841732709028
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)