ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart53b12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_476420.1| Oryza sativa (japonica cultivar-group), mRNA 163 6e-37
2dbj|AK070421.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 6e-37
3dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 109 8e-21
4dbj|AP004262.2| Oryza sativa (japonica cultivar-group) genomic D... 109 8e-21
5ref|XM_469887.1| Oryza sativa (japonica cultivar-group), mRNA 90 7e-15
6dbj|AK105625.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 7e-15
7gb|BT016414.1| Zea mays clone Contig247 mRNA sequence 86 1e-13
8gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 74 4e-10
9gb|AC099043.6| Oryza sativa chromosome 3 BAC OSJNBa0079B15 genom... 74 4e-10
10dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
11ref|XM_633891.1| Dictyostelium discoideum hypothetical protein (... 50 0.006
12gb|AY023290.1| Oryza sativa microsatellite MRG5615 containing (G... 50 0.006
13gb|AC126410.12| Mus musculus chromosome 5, clone RP23-368H6, com... 50 0.006
14dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
15gb|AC138666.6| Mus musculus chromosome 5, clone RP24-140D11, com... 50 0.006
16gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 50 0.006
17emb|AL844880.3|CNS08CB3 Oryza sativa chromosome 12, . BAC OSJNBb... 50 0.006
18gb|AC153582.10| Mus musculus 6 BAC RP23-432M19 (Roswell Park Can... 48 0.025
19gb|AC156279.5| Mus musculus 6 BAC RP24-244D20 (Roswell Park Canc... 48 0.025
20gb|AC153838.6| Mus musculus 6 BAC RP23-82B24 (Roswell Park Cance... 48 0.025
21emb|AL929445.8| Mouse DNA sequence from clone RP23-185M22 on chr... 48 0.025
22emb|AL808103.8| Mouse DNA sequence from clone RP23-301G2 on chro... 48 0.025
23gb|AC168269.3| Mus musculus BAC clone RP23-193M17 from chromosom... 46 0.100
24gb|AC160992.2| Mus musculus BAC clone RP23-147I23 from chromosom... 46 0.100
25ref|NM_001002763.1| Bos taurus cadherin 1, type 1, E-cadherin (e... 46 0.100
26gb|AC113548.22| Mus musculus chromosome 9, clone RP23-268F15, co... 46 0.100
27gb|AC140300.3| Mus musculus BAC clone RP23-373O10 from chromosom... 46 0.100
28ref|NM_009864.1| Mus musculus cadherin 1 (Cdh1), mRNA 46 0.100
29gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome... 46 0.100
30gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, co... 46 0.100
31gb|AY508164.1| Bos taurus e-cadherin (CDH1) mRNA, complete cds 46 0.100
32gb|AC122355.4| Mus musculus BAC clone RP23-401L7 from chromosome... 46 0.100
33gb|AC024608.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 46 0.100
34gb|AC074359.2| Mus musculus strain C57BL6/J chromosome 5 clone R... 46 0.100
35gb|AC079760.6| Homo sapiens BAC clone RP11-142A5 from 7, complet... 46 0.100
36gb|AC095042.3| Homo sapiens BAC clone RP11-115N4 from 7, complet... 46 0.100
37gb|BC098501.1| Mus musculus cadherin 1, mRNA (cDNA clone MGC:107... 46 0.100
38ref|XM_778244.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.100
39emb|AL121828.17|HSDJ892M9 Human DNA sequence from clone RP5-892M... 46 0.100
40ref|XM_795053.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 46 0.100
41gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete s... 46 0.100
42gb|AC098567.4| Genomic sequence for Mus musculus, clone RP23-198... 46 0.100
43gb|AC022483.7| Homo sapiens BAC clone RP11-533F5 from 4, complet... 46 0.100
44gb|AC093302.2| Homo sapiens chromosome 5 clone RP11-60A8, comple... 46 0.100
45dbj|AK166267.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD... 46 0.100
46dbj|AK076369.1| Mus musculus 10 days neonate skin cDNA, RIKEN fu... 46 0.100
47gb|AC132132.4| Mus musculus BAC clone RP23-235K2 from 8, complet... 46 0.100
48emb|X60974.1|MMUVEX14 M.musculus uvomorulin exon 14 46 0.100
49dbj|AB037667.1| Bos taurus mRNA for E-cadherin, partial cds 46 0.100
50gb|AC155316.6| Mus musculus BAC clone RP23-181P9 from chromosome... 46 0.100
51gb|AC147500.6| Mus musculus BAC clone RP24-281C21 from chromosom... 46 0.100
52emb|X06339.1|MMUVOM Mouse mRNA for uvomorulin cell adhesion mole... 46 0.100
53emb|X06115.1|MMECADH Mouse mRNA for E-cadherin (= uvomorulin, = ... 46 0.100
54gb|AC160244.11| Mus musculus chromosome 5, clone RP24-212G3, com... 44 0.39
55ref|XM_466597.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.39
56ref|XM_466596.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.39
57gb|AC157931.11| Mus musculus chromosome 5, clone RP24-159I10, co... 44 0.39
58gb|AY145461.1| Bemisia tabaci microsatellite Bem23 sequence 44 0.39
59gb|AC164440.4| Mus musculus BAC clone RP23-27B3 from chromosome ... 44 0.39
60gb|AC119908.16| Mus musculus chromosome 7, clone RP24-240G4, com... 44 0.39
61gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence 44 0.39
62gb|AC068006.10| Mus musculus chromosome 7, clone RP23-6I17, comp... 44 0.39
63gb|AC137967.14| Mus musculus chromosome 10, clone RP24-323I24, c... 44 0.39
64gb|AC167141.2| Mus musculus BAC clone RP23-313L4 from chromosome... 44 0.39
65gb|AC165293.2| Mus musculus BAC clone RP23-268A5 from chromosome... 44 0.39
66gb|AC164581.7| Mus musculus 10 BAC RP23-45O2 (Roswell Park Cance... 44 0.39
67gb|AC121849.3| Mus musculus BAC clone RP24-90K18 from chromosome... 44 0.39
68ref|XM_992125.1| PREDICTED: Mus musculus similar to olfactory re... 44 0.39
69ref|XM_001001853.1| PREDICTED: Mus musculus hypothetical protein... 44 0.39
70gb|AC129080.6| Mus musculus BAC clone RP24-226L20 from chromosom... 44 0.39
71gb|AC130539.3| Mus musculus BAC clone RP23-455J15 from chromosom... 44 0.39
72gb|AC129079.5| Mus musculus BAC clone RP24-126J17 from chromosom... 44 0.39
73gb|AC123924.4| Mus musculus BAC clone RP24-292A3 from chromosome... 44 0.39
74gb|AC124421.4| Mus musculus BAC clone RP24-323H7 from chromosome... 44 0.39
75gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosom... 44 0.39
76gb|AC130818.3| Mus musculus BAC clone RP23-89F9 from chromosome ... 44 0.39
77gb|AC129609.3| Mus musculus BAC clone RP23-194H4 from chromosome... 44 0.39
78gb|AC127257.3| Mus musculus BAC clone RP24-296O9 from chromosome... 44 0.39
79gb|AC091092.3| Papio anubis clone RP41-191D8, complete sequence 44 0.39
80gb|AC098712.3| Mus musculus BAC clone RP23-2A21 from 10, complet... 44 0.39
81gb|AC131751.2| Mus musculus BAC clone RP23-19P8 from 10, complet... 44 0.39
82gb|AC129602.3| Mus musculus BAC clone RP23-37L24 from 16, comple... 44 0.39
83gb|AC122215.4| Mus musculus BAC clone RP23-106M18 from 16, compl... 44 0.39
84gb|AC102613.7| Mus musculus chromosome 1, clone RP23-418C16, com... 44 0.39
85gb|AC146218.2| Pan troglodytes BAC clone CH251-267E2 from Y, com... 44 0.39
86gb|AC092100.5| Homo sapiens BAC clone RP11-666G4 from 7, complet... 44 0.39
87gb|AC073316.6| Homo sapiens BAC clone RP11-191P7 from 7, complet... 44 0.39
88gb|AC136717.10| Mus musculus chromosome 7, clone RP23-48C24, com... 44 0.39
89gb|AC145985.2| Pan troglodytes BAC clone RP43-17I24 from 7, comp... 44 0.39
90gb|AC153656.4| Mus musculus BAC clone RP23-428O19 from chromosom... 44 0.39
91gb|AC012526.35| Mus musculus strain 129S6/SvEvTac clone rp21-671... 44 0.39
92gb|AC165252.2| Mus musculus BAC clone RP23-355O12 from chromosom... 44 0.39
93gb|AC126071.5| Rattus norvegicus 10 BAC CH230-209B21 (Children's... 44 0.39
94emb|AL589645.10| Human DNA sequence from clone RP11-251H13 on ch... 44 0.39
95gb|AC158956.6| Mus musculus chromosome 3, clone RP23-370F14, com... 44 0.39
96gb|AC113189.11| Homo sapiens chromosome 17, clone RP11-104H15, c... 44 0.39
97emb|AL354720.14| Human DNA sequence from clone RP11-505F3 on chr... 44 0.39
98emb|AL158164.15| Human DNA sequence from clone RP11-414K1 on chr... 44 0.39
99emb|AL050342.42|HSDJ655K7 Human DNA sequence from clone RP4-655K... 44 0.39
100gb|AC162861.2| Mus musculus chromosome 1, clone RP23-236B21, com... 44 0.39
101ref|XM_783208.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.39
102gb|AC026954.14| Homo sapiens chromosome 17, clone RP11-542C16, c... 44 0.39
103emb|AL713870.26| Mouse DNA sequence from clone RP24-239D8 on chr... 44 0.39
104emb|AJ276505.2|MMU276505 Mus musculus genomic fragment, 281000 b... 44 0.39
105gb|AC091002.54| Mus musculus strain C57BL/6J clone rp23-7n16 map... 44 0.39
106gb|AC157019.8| Mus musculus 10 BAC RP24-377N13 (Roswell Park Can... 44 0.39
107emb|AL645566.15| Mouse DNA sequence from clone RP23-398M13 on ch... 44 0.39
108emb|AL663051.15| Mouse DNA sequence from clone RP23-450J13 on ch... 44 0.39
109emb|AL691470.17| Mouse DNA sequence from clone RP23-160F12 on ch... 44 0.39
110emb|AL603702.14| Mouse DNA sequence from clone RP23-406A14 on ch... 44 0.39
111gb|AC157551.6| Mus musculus chromosome 5, clone RP24-270K7, comp... 44 0.39
112emb|AL593857.10| Mouse DNA sequence from clone RP23-439H2 on chr... 44 0.39
113dbj|BS000535.1| Pan troglodytes chromosome Y clone:PTB-096E06, c... 44 0.39
114dbj|AB231934.1| Rosa hybrid cultivar Asami Red DNA, microsatelli... 44 0.39
115gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 44 0.39
116gb|AC120838.10| Pan troglodytes clone ch251-239a19, complete seq... 44 0.39
117gb|AC164572.4| Mus musculus 6 BAC RP24-89J17 (Roswell Park Cance... 44 0.39
118gb|AC099670.2| Homo sapiens chromosome 1 clone RP11-84O12, compl... 44 0.39
119gb|AC003060.1| Mus musculus Chromosome 16 BAC Clone 72k21 Synten... 44 0.39
120emb|CR405704.4| Mouse DNA sequence from clone RP23-395B7 on chro... 44 0.39
121gb|DP000036.1| Papio anubis target 106 genomic scaffold 44 0.39
122gb|AC118231.9| Mus musculus chromosome 5, clone RP23-462J24, com... 44 0.39
123gb|AC151535.2| Mus musculus BAC clone RP23-213M8 from chromosome... 44 0.39
124gb|AC158299.7| Mus musculus chromosome 7, clone RP24-271L24, com... 44 0.39
125gb|AC157498.2| Pan troglodytes BAC clone CH251-412M6 from chromo... 44 0.39
126gb|AC161372.2| Mus musculus BAC clone RP23-326G14 from chromosom... 44 0.39
127gb|AC084822.36| Mus musculus strain C57BL/6J clone rp23-47o21 ma... 44 0.39
128gb|AC008078.11| Homo sapiens chromosome 15 clone b2176l16 map 15... 44 0.39
129gb|AC010999.6|AC010999 Homo sapiens chromosome 15 clone RP11-323... 44 0.39
130gb|AF374195.1|AF374195 Mus musculus ribosomal protein L6 (Rpl6) ... 44 0.39
131dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.39
132gb|AC095380.1| Homo sapiens PCR product GAP1622 from Y, complete... 44 0.39
133emb|AL603782.5| Mouse DNA sequence from clone RP23-480M4 on chro... 44 0.39
134gb|AC097474.3| Homo sapiens BAC clone RP11-93I21 from 4, complet... 44 0.39
135gb|AC100810.18| Homo sapiens chromosome 8, clone CTD-2336O2, com... 44 0.39
136gb|AC154530.2| Mus musculus BAC clone RP23-467F17 from chromosom... 44 0.39
137gb|AC153136.3| Mus musculus BAC clone RP24-191P11 from chromosom... 44 0.39
138gb|AC009976.4|AC009976 Homo sapiens BAC clone RP11-509B6 from Y,... 44 0.39
139gb|AC019257.3| Homo sapiens chromosome 8, clone RP11-439C15, com... 44 0.39
140gb|AC068448.10| Homo sapiens chromosome 15, clone RP11-624A21, c... 44 0.39
141gb|AC019159.8| Homo sapiens BAC clone RP11-56O18 from 2, complet... 44 0.39
142emb|BX682541.5| Mouse DNA sequence from clone RP23-349P20 on chr... 44 0.39
143emb|BX813335.2| Mouse DNA sequence from clone RP24-375E5 on chro... 44 0.39
144dbj|AP005385.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.39
145dbj|AP004124.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.39
146emb|AL731647.13| Mouse DNA sequence from clone RP23-226L1 on chr... 44 0.39
147emb|AL929537.17| Mouse DNA sequence from clone RP23-147E9 on chr... 44 0.39
148dbj|AK073602.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.39
149ref|NG_004636.1| Homo sapiens chromosome Y palindromes P4 and P5... 44 0.39
150emb|AL391833.10| Human DNA sequence from clone RP11-307K1 on chr... 44 0.39
151gb|AC140381.3| Mus musculus BAC clone RP23-176M4 from 10, comple... 44 0.39
152dbj|AK064340.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.39
153gb|AC156277.6| Mus musculus 6 BAC RP24-309B5 (Roswell Park Cance... 44 0.39
154gb|AC153949.3| Mus musculus 10 BAC RP24-366H8 (Roswell Park Canc... 44 0.39
155gb|AC151531.3| Mus musculus BAC clone RP24-387D22 from chromosom... 44 0.39
156gb|AY610413.1| Sus scrofa clone rjej03b_a4.y1.abd, mRNA sequence 44 0.39
157gb|AC110037.13| Mus musculus chromosome 5, clone RP23-257E17, co... 44 0.39
158gb|AC121139.20| Mus musculus chromosome 5, clone RP23-429G1, com... 44 0.39
159emb|CT010490.10| Mouse DNA sequence from clone RP23-148P12 on ch... 44 0.39
160emb|AL844517.6| Mouse DNA sequence from clone RP23-453K8 on chro... 44 0.39
161emb|CT025540.12| Mouse DNA sequence from clone RP24-280B23 on ch... 44 0.39
162gb|AC132224.3| Mus musculus BAC clone RP24-554P12 from 1, comple... 44 0.39
163gb|AC133520.4| Mus musculus BAC clone RP23-185G9 from 8, complet... 44 0.39
164gb|AC132431.3| Mus musculus BAC clone RP23-211M23 from 6, comple... 44 0.39
165gb|AC145559.4| Mus musculus BAC clone RP23-371A1 from 5, complet... 44 0.39
166gb|AC125463.4| Mus musculus BAC clone RP23-106G8 from 8, complet... 44 0.39
167dbj|AP005202.3| Homo sapiens genomic DNA, chromosome 18 clone:CT... 44 0.39
168gb|AC159126.4| Mus musculus chromosome 8, clone RP23-182M11, com... 44 0.39
169gb|AC156836.6| Mus musculus BAC clone RP23-88L11 from chromosome... 44 0.39
170emb|AL928662.5| Mouse DNA sequence from clone RP23-379M5 on chro... 44 0.39
171emb|AL713875.14| Mouse DNA sequence from clone RP23-17N7 on chro... 44 0.39
172emb|AL607084.14| Mouse DNA sequence from clone RP23-272N19 on ch... 44 0.39
173emb|AL807764.9| Mouse DNA sequence from clone RP23-400F8 on chro... 44 0.39
174gb|AC122116.9| Mus musculus chromosome 7, clone RP23-449M8, comp... 44 0.39
175gb|AC109618.12| Mus musculus chromosome 8, clone RP23-478L3, com... 44 0.39
176gb|AC119202.6| Mus musculus chromosome 8, clone RP24-185N3, comp... 44 0.39
177emb|AL670246.13| Mouse DNA sequence from clone RP23-2O18 on chro... 44 0.39
178emb|AL606969.26| Mouse DNA sequence from clone RP23-331P21 on ch... 44 0.39
179emb|AL731735.14| Mouse DNA sequence from clone RP23-139P21 on ch... 44 0.39
180gb|AC123656.9| Mus musculus chromosome 15, clone RP23-188M21, co... 42 1.6
181gb|AC138355.17| Mus musculus chromosome 8, clone RP24-281G1, com... 42 1.6
182ref|XM_550352.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.6
183gb|AC154520.3| Mus musculus BAC clone RP23-471P16 from chromosom... 42 1.6
184gb|AC168217.2| Mus musculus BAC clone RP24-498P8 from chromosome... 42 1.6
185ref|XM_464727.1| Oryza sativa (japonica cultivar-group), mRNA 42 1.6
186gb|AC138204.7| Mus musculus chromosome 3, clone RP23-381G8, comp... 42 1.6
187gb|U65590.1|HSU65590 Homo sapiens IL-1 receptor antagonist IL-1R... 42 1.6
188gb|AC161416.2| Mus musculus BAC clone RP23-306A2 from chromosome... 42 1.6
189gb|AC161375.4| Mus musculus BAC clone RP23-297A22 from chromosom... 42 1.6
190gb|AC161260.2| Mus musculus BAC clone RP23-448A11 from chromosom... 42 1.6
191gb|AC136645.2| Rattus norvegicus 7 BAC CH230-156H17 (Children's ... 42 1.6
192gb|AC097023.6| Rattus norvegicus BAC CH230-35L12 (Children's Hos... 42 1.6
193ref|NM_173841.1| Homo sapiens interleukin 1 receptor antagonist ... 42 1.6
194gb|AC115924.11| Mus musculus chromosome 15, clone RP24-511O11, c... 42 1.6
195gb|AC140303.3| Mus musculus BAC clone RP23-381H21 from chromosom... 42 1.6
196gb|AC183296.3| Pan troglodytes BAC clone CH251-352A17 from chrom... 42 1.6
197gb|BC068441.1| Homo sapiens interleukin 1 receptor antagonist, m... 42 1.6
198gb|AC141888.4| Mus musculus BAC clone RP23-462H3 from chromosome... 42 1.6
199gb|AC140927.2| Mus musculus BAC clone RP23-409D19 from chromosom... 42 1.6
200gb|AC091458.5| Mus musculus chromosome 12, clone RP23-68M8, comp... 42 1.6
201gb|AY392150.1| Schistosoma haematobium nicotinic acetylcholine r... 42 1.6
202gb|AC036145.11| Mus musculus chromosome 5, clone RP23-439C22, co... 42 1.6
203gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, com... 42 1.6
204ref|XM_001002052.1| PREDICTED: Mus musculus gamma-aminobutyric a... 42 1.6
205ref|XM_001002044.1| PREDICTED: Mus musculus gamma-aminobutyric a... 42 1.6
206gb|AC147052.2| Pan troglodytes BAC clone RP43-143G1 from 7, comp... 42 1.6
207emb|CT009519.4| Mouse DNA sequence from clone RP23-145L1 on chro... 42 1.6
208gb|AC127690.4| Mus musculus BAC clone RP24-215A3 from chromosome... 42 1.6
209gb|AC122015.3| Mus musculus BAC clone RP24-358M18 from chromosom... 42 1.6
210gb|AC132251.3| Mus musculus BAC clone RP24-447I16 from chromosom... 42 1.6
211gb|AC131794.3| Mus musculus BAC clone RP24-486P14 from chromosom... 42 1.6
212gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome... 42 1.6
213gb|AC111008.6| Mus musculus BAC clone RP23-415J21 from chromosom... 42 1.6
214gb|AC125093.4| Mus musculus BAC clone RP24-176F8 from chromosome... 42 1.6
215ref|XM_537420.2| PREDICTED: Canis familiaris similar to melanoma... 42 1.6
216gb|AC122840.3| Mus musculus BAC clone RP23-193M8 from 13, comple... 42 1.6
217gb|AC122280.4| Mus musculus BAC clone RP23-239I12 from 17, compl... 42 1.6
218gb|AC112144.4| Mus musculus BAC clone RP23-32B4 from 19, complet... 42 1.6
219gb|AC124169.3| Mus musculus BAC clone RP23-151G15 from 19, compl... 42 1.6
220gb|AC119996.7| Mus musculus chromosome 19, clone RP24-120D1, com... 42 1.6
221gb|AC146125.2| Pan troglodytes BAC clone RP43-4K13 from 7, compl... 42 1.6
222gb|AC159149.10| Mus musculus 10 BAC RP23-56F17 (Roswell Park Can... 42 1.6
223emb|AL590434.16| Human DNA sequence from clone RP11-181E22 on ch... 42 1.6
224emb|AL354680.14| Human DNA sequence from clone RP11-536F8 on chr... 42 1.6
225emb|AL136171.17| Human DNA sequence from clone RP4-584N17 on chr... 42 1.6
226gb|AY263168.1| Takifugu rubripes Tmc2-related protein 2 mRNA, pa... 42 1.6
227gb|AC105586.5| Rattus norvegicus 3 BAC CH230-239D4 (Children's H... 42 1.6
228gb|AC119275.12| Mus musculus chromosome 8, clone RP24-459A4, com... 42 1.6
229gb|AC159194.3| Mus musculus BAC clone RP23-469D18 from chromosom... 42 1.6
230emb|AL596110.15| Mouse DNA sequence from clone RP23-330N10 on ch... 42 1.6
231gb|AC153012.4| Mus musculus BAC clone RP23-302F19 from chromosom... 42 1.6
232emb|AL645611.9| Mouse DNA sequence from clone RP23-432O24 on chr... 42 1.6
233emb|AL669968.10| Mouse DNA sequence from clone RP23-475F22 on ch... 42 1.6
234gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, comp... 42 1.6
235emb|AL844601.4| Mouse DNA sequence from clone RP23-245J22 on chr... 42 1.6
236gb|AC161503.4| Mus musculus chromosome 8, clone RP23-81C3, compl... 42 1.6
237gb|AC011195.14| Homo sapiens chromosome 17, clone CTD-2200P10, c... 42 1.6
238gb|AC100183.11| Mus musculus chromosome 3, clone RP23-54L16, com... 42 1.6
239gb|AC158757.6| Mus musculus chromosome 5, clone RP23-64D3, compl... 42 1.6
240gb|AC087763.10| Homo sapiens chromosome 8, clone RP11-62H7, comp... 42 1.6
241gb|AC120104.4| Homo sapiens 12 BAC RP11-638F21 (Roswell Park Can... 42 1.6
242gb|AC106740.3| Homo sapiens chromosome 5 clone RP11-100E22, comp... 42 1.6
243gb|AC019084.9| Homo sapiens BAC clone RP11-354O2 from 7, complet... 42 1.6
244ref|XM_686676.1| PREDICTED: Danio rerio similar to LOC496799 pro... 42 1.6
245emb|BX470167.7| Zebrafish DNA sequence from clone DKEYP-86G2 in ... 42 1.6
246gb|AC159320.3| Mus musculus BAC clone RP23-51A12 from chromosome... 42 1.6
247dbj|AK048165.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 42 1.6
248dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
249dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
250gb|AC079181.3|AC079181 Mus musculus strain C57BL/6J chromosome 1... 42 1.6
251gb|AC157519.2| Mus musculus BAC clone RP23-202O17 from chromosom... 42 1.6
252gb|AC016724.11| Homo sapiens BAC clone RP11-339F22 from 2, compl... 42 1.6
253gb|AC024704.9| Homo sapiens BAC clone RP11-97J14 from 2, complet... 42 1.6
254gb|AC004961.2|AC004961 Homo sapiens PAC clone RP5-1098J4 from 7,... 42 1.6
255gb|AY196903.1| Homo sapiens interleukin 1 receptor antagonist (I... 42 1.6
256gb|AF134488.1|AF134488 Cavia porcellus leukotriene B4 receptor m... 42 1.6
257gb|AC018634.3|AC018634 Human Chromosome 7 clone RP11-243E12, com... 42 1.6
258gb|AC104038.9| Homo sapiens chromosome 11, clone RP11-746C23, co... 42 1.6
259gb|AC107881.16| Homo sapiens chromosome 11, clone CTD-2007B22, c... 42 1.6
260gb|AC146612.2| Mus musculus BAC clone RP23-56K8 from chromosome ... 42 1.6
261gb|AC126684.4| Mus musculus BAC clone RP23-68L2 from chromosome ... 42 1.6
262dbj|AP004779.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
263dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
264gb|AC112933.16| Mus musculus chromosome 5, clone RP24-418J2, com... 42 1.6
265emb|AL954172.9| Zebrafish DNA sequence from clone CH211-220D9 in... 42 1.6
266dbj|AP005551.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
267emb|AL954182.18| Zebrafish DNA sequence from clone CH211-205N18 ... 42 1.6
268gb|AC158677.2| Mus musculus 6 BAC RP23-175H4 (Roswell Park Cance... 42 1.6
269gb|AC154005.4| Mus musculus 6 BAC RP24-82B18 (Roswell Park Cance... 42 1.6
270dbj|BS000030.1| Pan troglodytes chromosome 22 clone:PTB-025P20, ... 42 1.6
271dbj|AK073970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
272dbj|AK067205.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
273gb|AC132387.4| Mus musculus BAC clone RP23-440M14 from 1, comple... 42 1.6
274gb|AC137678.11| Mus musculus chromosome 9, clone RP24-484G16, co... 42 1.6
275tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ... 42 1.6
276tpe|BN000002.1|HSA000002 TPA: TPA_exp: Homo sapiens complete int... 42 1.6
277gb|AC169186.4| Erinaceus europaeus, clone XX-29994857F23, comple... 42 1.6
278gb|AC155637.4| Mus musculus 10 BAC RP24-227O16 (Roswell Park Can... 42 1.6
279gb|AC114602.16| Mus musculus chromosome 8, clone RP23-339B16, co... 42 1.6
280gb|AC165322.12| Mus musculus chromosome 1, clone RP23-127J15, co... 42 1.6
281dbj|AP001005.6| Homo sapiens genomic DNA, chromosome 18 clone:RP... 42 1.6
282emb|CR956397.19| Pig DNA sequence from clone CH242-259E5 on chro... 42 1.6
283emb|AL732610.16| Zebrafish DNA sequence from clone CH211-12N8, c... 42 1.6
284emb|X84348.1|HSIL1RAII H.sapiens mRNA for intracellular IL-1 rec... 42 1.6
285gb|AC134825.5| Mus musculus BAC clone RP24-456L17 from 9, comple... 42 1.6
286gb|AF057168.1|AF057168 Homo sapiens type II interleukin-1 recept... 42 1.6
287gb|AC132444.3| Mus musculus BAC clone RP23-160D6 from 8, complet... 42 1.6
288gb|AC132466.4| Mus musculus BAC clone RP23-68N22 from 16, comple... 42 1.6
289gb|AC138721.4| Mus musculus BAC clone RP23-157G22 from 6, comple... 42 1.6
290gb|AC130533.2| Mus musculus BAC clone RP23-211B19 from 8, comple... 42 1.6
291gb|AC132397.4| Mus musculus BAC clone RP23-397C5 from 5, complet... 42 1.6
292dbj|AP006444.1| Brassica napus mitochondrial DNA, complete genome 42 1.6
293gb|U31447.1|HEU31447 Heliocidaris erythrogramma HEHBOX6 (HeHbox6... 42 1.6
294emb|AL831781.8| Mouse DNA sequence from clone RP23-307O24 on chr... 42 1.6
295gb|AC172860.1| Brassica rapa subsp. pekinensis clone KBrB042G11,... 42 1.6
296emb|AL583885.17| Mouse DNA sequence from clone RP23-323K24 on ch... 42 1.6
297emb|AL591208.24| Mouse DNA sequence from clone RP23-149I2 on chr... 42 1.6
298emb|AL772224.2| Mouse DNA sequence from clone RP23-131N18 on chr... 42 1.6
299dbj|AB005049.1| Cavia porcellus mRNA for LTB4 receptor, complete... 42 1.6
300dbj|AB017043.1| Rattus norvegicus gene for hepatocyte nuclear fa... 42 1.6
301emb|AL772386.4| Mouse DNA sequence from clone RP23-89G22 on chro... 42 1.6
302emb|AL645484.14| Mouse DNA sequence from clone RP23-38A10 on chr... 42 1.6
303emb|AL669977.8| Mouse DNA sequence from clone RP23-197M19 on chr... 42 1.6
304gb|AC117827.6| Mus musculus chromosome 1, clone RP24-88L2, compl... 40 6.1
305gb|AC118200.8| Mus musculus chromosome 5, clone RP23-330E5, comp... 40 6.1
306ref|NM_017088.2| Rattus norvegicus guanosine diphosphate dissoci... 40 6.1
307ref|NM_001035680.1| Arabidopsis thaliana unknown protein AT3G241... 40 6.1
308ref|NM_113323.3| Arabidopsis thaliana unknown protein AT3G24180 ... 40 6.1
309ref|NM_102945.2| Arabidopsis thaliana unknown protein AT1G32120 ... 40 6.1
310ref|NM_101871.2| Arabidopsis thaliana unknown protein AT1G20180 ... 40 6.1
311gb|AC157927.5| Mus musculus chromosome 3, clone RP24-85O24, comp... 40 6.1
312gb|AC107774.8| Mus musculus chromosome 5, clone RP23-99A9, compl... 40 6.1
313gb|AC121821.3| Mus musculus chromosome 18 clone RP23-461O23, com... 40 6.1
314ref|XM_493901.1| Oryza sativa (japonica cultivar-group), predic... 40 6.1
315ref|XM_493826.1| Oryza sativa (japonica cultivar-group), predic... 40 6.1
316gb|AC165975.4| Mus musculus BAC clone RP23-3L23 from chromosome ... 40 6.1
317ref|XM_523898.1| PREDICTED: Pan troglodytes cadherin 2, type 1 (... 40 6.1
318gb|AC163617.5| Mus musculus BAC clone RP23-115O21 from chromosom... 40 6.1
319gb|AC161793.9| Mus musculus chromosome 7, clone RP23-80J7, compl... 40 6.1
320gb|AC113536.10| Mus musculus chromosome 17, clone RP23-77L13, co... 40 6.1
321gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cance... 40 6.1
322gb|AC112953.15| Mus musculus chromosome 7, clone RP23-44J21, com... 40 6.1
323gb|AC161510.10| Mus musculus chromosome 5, clone RP23-7M16, comp... 40 6.1
324gb|AC169697.1| Rhesus Macaque BAC CH250-38L23 (Children's Hospi... 40 6.1
325gb|AE017353.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 6.1
326gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 40 6.1
327gb|AC093473.6| Mus musculus chromosome 5, clone RP23-54H12, comp... 40 6.1
328gb|AC105982.10| Mus musculus chromosome 15, clone RP24-159I1, co... 40 6.1
329gb|AC158943.9| Mus musculus chromosome 1, clone RP24-272N10, com... 40 6.1
330gb|AC150004.3| Mus musculus chromosome 7, clone RP24-368P9, comp... 40 6.1
331gb|AC027184.15| Mus musculus chromosome 14, clone RP23-138C14, c... 40 6.1
332gb|AC102413.8| Mus musculus chromosome 3, clone RP24-462F18, com... 40 6.1
333gb|AC115728.11| Mus musculus chromosome 5, clone RP23-31J24, com... 40 6.1
334gb|AC149778.2| Bos taurus BAC CH240-9E7 (Children's Hospital Oa... 40 6.1
335gb|AC129700.8| Rattus norvegicus 4 BAC CH230-10L17 (Children's H... 40 6.1
336gb|AC102999.7| Rattus norvegicus 7 BAC CH230-33J22 (Children's H... 40 6.1
337gb|AC094668.10| Rattus norvegicus BAC CH230-5F18 (Children's Ho... 40 6.1
338ref|XM_365395.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.1
339ref|XM_365410.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 6.1
340ref|NM_007664.2| Mus musculus cadherin 2 (Cdh2), mRNA 40 6.1
341gb|AC127266.4| Mus musculus BAC clone RP24-347B12 from chromosom... 40 6.1
342gb|AY630760.1| Arabidopsis thaliana hypothetical protein (At1G20... 40 6.1
343gb|BC072538.1| Rattus norvegicus guanosine diphosphate dissociat... 40 6.1
344ref|XM_322280.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.1
345ref|XM_951325.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.1
346ref|XM_955059.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.1
347ref|XM_330791.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.1
348gb|AC166779.3| Mus musculus chromosome 18, clone RP23-399N10, co... 40 6.1
349gb|AC148008.2| Mus musculus BAC clone RP23-253C14 from chromosom... 40 6.1
350ref|NM_001792.2| Homo sapiens cadherin 2, type 1, N-cadherin (ne... 40 6.1
351gb|AC102420.10| Mus musculus chromosome 8, clone RP24-553O21, co... 40 6.1
352gb|AC147374.4| Mus musculus BAC clone RP24-230D18 from chromosom... 40 6.1
353gb|AC144794.2| Mus musculus BAC clone RP24-463B6 from chromosome... 40 6.1
354ref|NM_005707.1| Homo sapiens programmed cell death 7 (PDCD7), mRNA 40 6.1
355gb|AC102091.7| Mus musculus chromosome 18, clone RP23-9K20, comp... 40 6.1
356gb|AY191612.1| Pan troglodytes Rho-associated protein kinase (RO... 40 6.1
357gb|AC164306.3| Mus musculus BAC clone RP23-190A21 from chromosom... 40 6.1
358gb|AC132284.5| Mus musculus BAC clone RP24-351O18 from chromosom... 40 6.1
359gb|AC154330.2| Mus musculus BAC clone RP23-286H23 from chromosom... 40 6.1
360gb|AC141882.3| Mus musculus BAC clone RP24-177O3 from chromosome... 40 6.1
361ref|XM_983109.1| PREDICTED: Mus musculus cadherin 2 (Cdh2), mRNA 40 6.1
362ref|XR_001936.1| PREDICTED: Mus musculus hypothetical protein LO... 40 6.1
363gb|BC060449.1| Xenopus laevis hypothetical protein MGC68473, mRN... 40 6.1
364ref|XM_848353.1| PREDICTED: Canis familiaris similar to programm... 40 6.1
365ref|XR_003822.1| PREDICTED: Mus musculus hypothetical protein LO... 40 6.1
366ref|XM_990877.1| PREDICTED: Mus musculus hypothetical protein LO... 40 6.1
367ref|XM_991796.1| PREDICTED: Mus musculus hypothetical protein LO... 40 6.1
368gb|AC096226.12| Rattus norvegicus 18 BAC CH230-26M18 (Children's... 40 6.1
369gb|AC145474.2| Rattus norvegicus chromosome 1 clone RP32-113N8 m... 40 6.1
370ref|XM_863518.1| PREDICTED: Canis familiaris similar to DNA-dire... 40 6.1
371ref|XM_849548.1| PREDICTED: Canis familiaris similar to DNA-dire... 40 6.1
372ref|XM_750560.1| Aspergillus fumigatus Af293 hypothetical protei... 40 6.1
373ref|XM_750561.1| Aspergillus fumigatus Af293 hypothetical protei... 40 6.1
374ref|XM_568478.1| Cryptococcus neoformans var. neoformans JEC21 e... 40 6.1
375emb|CT009677.9| Mouse DNA sequence from clone CH29-485N6 on chro... 40 6.1
376emb|CT009659.6| Mouse DNA sequence from clone CH29-604F11 on chr... 40 6.1
377gb|AC123848.4| Mus musculus BAC clone RP23-459I1 from chromosome... 40 6.1
378gb|AC121819.3| Mus musculus BAC clone RP23-460F21 from chromosom... 40 6.1
379gb|AC134559.5| Mus musculus BAC clone RP24-332C4 from chromosome... 40 6.1
380gb|AC121907.3| Mus musculus BAC clone RP24-176G20 from chromosom... 40 6.1
381gb|AC131109.3| Mus musculus BAC clone RP23-362M7 from chromosome... 40 6.1
382gb|AC121786.3| Mus musculus BAC clone RP23-387F9 from chromosome... 40 6.1
383gb|AC126255.3| Mus musculus BAC clone RP24-218F22 from chromosom... 40 6.1
384gb|AC124424.4| Mus musculus BAC clone RP24-230J3 from chromosome... 40 6.1
385gb|AC126040.3| Mus musculus BAC clone RP24-258K7 from chromosome... 40 6.1
386gb|AC125139.4| Mus musculus BAC clone RP24-326G1 from chromosome... 40 6.1
387gb|AC123795.4| Mus musculus BAC clone RP24-317K11 from chromosom... 40 6.1
388gb|AC125154.3| Mus musculus BAC clone RP24-380C2 from chromosome... 40 6.1
389gb|AC125181.4| Mus musculus BAC clone RP23-324L6 from chromosome... 40 6.1
390ref|XM_863514.1| PREDICTED: Canis familiaris similar to Cdc42 bi... 40 6.1
391ref|XM_863513.1| PREDICTED: Canis familiaris similar to Cdc42 bi... 40 6.1
392ref|XM_863511.1| PREDICTED: Canis familiaris similar to Cdc42 bi... 40 6.1
393ref|XM_547990.2| PREDICTED: Canis familiaris similar to Cdc42 bi... 40 6.1
394gb|AC123949.5| Mus musculus BAC clone RP23-119H13 from 14, compl... 40 6.1
395emb|CR855278.2| Platypus DNA sequence from clone XX-235F6, compl... 40 6.1
396gb|AC124605.4| Mus musculus BAC clone RP23-82A23 from 3, complet... 40 6.1
397gb|AC133889.9| Mus musculus chromosome 16, clone RP23-380I13, co... 40 6.1
398gb|AC117199.3| Mus musculus BAC clone RP23-134L22 from 10, compl... 40 6.1
399gb|AC121872.2| Mus musculus BAC clone RP24-122E10 from 12, compl... 40 6.1
400gb|AC111013.3| Mus musculus BAC clone RP24-223F21 from 3, comple... 40 6.1
401ref|XM_537293.2| PREDICTED: Canis familiaris neural cadherin (NC... 40 6.1
402gb|AC098745.4| Mus musculus BAC clone RP23-122P16 from 18, compl... 40 6.1
403ref|XM_536807.2| PREDICTED: Canis familiaris cadherin 1 (CDH1), ... 40 6.1
404gb|AC120509.3| Oryza sativa chromosome 3 BAC OSJNBb0081K01 genom... 40 6.1
405gb|AC117581.8| Mus musculus chromosome 3, clone RP23-105M18, com... 40 6.1
406gb|AC102792.7| Mus musculus chromosome 7, clone RP23-370I17, com... 40 6.1
407gb|AC101527.12| Mus musculus chromosome 15, clone RP23-191D20, c... 40 6.1
408ref|XM_661506.1| Cryptosporidium hominis TU502 hypothetical prot... 40 6.1
409gb|AC164403.5| Mus musculus chromosome 7, clone RP23-477O13, com... 40 6.1
410gb|AC114403.15| Mus musculus chromosome 1, clone RP23-197H1, com... 40 6.1
411gb|AC164433.4| Mus musculus BAC clone RP23-357G5 from chromosome... 40 6.1
412gb|BC099763.1| Rattus norvegicus guanosine diphosphate dissociat... 40 6.1
413gb|DQ446265.1| Arabidopsis thaliana clone pENTR221-At1g20180 hyp... 40 6.1
414emb|BX004827.18| Human DNA sequence from clone RP13-391G2 on chr... 40 6.1
415emb|AL732314.18| Human DNA sequence from clone RP13-465B17 on ch... 40 6.1
416emb|AL683812.12| Human DNA sequence from clone RP5-1014E24 on ch... 40 6.1
417emb|AL596178.4| Human DNA sequence from clone RP11-236L13 on chr... 40 6.1
418emb|AL513284.12| Human DNA sequence from clone RP11-518D3 on chr... 40 6.1
419emb|AL391297.6| Human DNA sequence from clone RP4-598G3 on chrom... 40 6.1
420emb|AL357932.15| Human DNA sequence from clone RP11-435N12 on ch... 40 6.1
421emb|AL358133.11| Human DNA sequence from clone RP11-810I22 on ch... 40 6.1
422emb|AL356986.11| Human DNA sequence from clone RP11-395N6 on chr... 40 6.1
423emb|AL161738.15| Human DNA sequence from clone RP11-549G1 on chr... 40 6.1
424emb|AL157699.13| Human DNA sequence from clone RP13-55H22 on chr... 40 6.1
425emb|AL031665.19|HS545L17 Human DNA sequence from clone RP4-545L1... 40 6.1
426gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 ma... 40 6.1
427ref|XM_961798.1| PREDICTED: Tribolium castaneum similar to Phosp... 40 6.1
428gb|AY113877.1| Arabidopsis thaliana putative protein kinase (At1... 40 6.1
429gb|AY065402.1| Arabidopsis thaliana unknown protein (At3g24180) ... 40 6.1
430emb|X67427.1|PSPTXAG Pisum sativum ptxA gene 40 6.1
431emb|X57548.1|HSNCADHER Human mRNA for N-cadherin 40 6.1
432gb|AY035076.1| Arabidopsis thaliana putative protein kinase (At1... 40 6.1
433emb|X54315.1|HSNCAD Human mRNA for N-cadherin 40 6.1
434emb|X53615.1|BTCADHN B.taurus mRNA for N-cadherin 40 6.1
435gb|AC015933.9| Homo sapiens chromosome 18, clone CTD-2023G8, com... 40 6.1
436emb|AL663076.17| Mouse DNA sequence from clone RP23-6I12 on chro... 40 6.1
437gb|AC153839.10| Mus musculus 6 BAC RP23-93A21 (Roswell Park Canc... 40 6.1
438gb|AC153993.23| Mus musculus 6 BAC RP24-568N16 (Roswell Park Can... 40 6.1
439gb|AC164663.5| Mus musculus 10 BAC RP23-44F24 (Roswell Park Canc... 40 6.1
440gb|BC092464.1| Homo sapiens programmed cell death 7, mRNA (cDNA ... 40 6.1
441gb|BC036470.1| Homo sapiens cadherin 2, type 1, N-cadherin (neur... 40 6.1
442emb|AJ236416.1|HIM236416 Human immunodeficiency virus type 1 par... 40 6.1
443emb|AJ236404.1|HIM236404 Human immunodeficiency virus type 1 par... 40 6.1
444emb|AJ133069.1|HIM133069 Human immunodeficiency virus type 1 env... 40 6.1
445emb|CR938710.1| Medicago truncatula chromosome 5 clone mth2-170k... 40 6.1
446emb|AL662875.14| Mouse DNA sequence from clone RP23-67E18 on chr... 40 6.1
447emb|AL731694.12| Mouse DNA sequence from clone RP23-138G17 on ch... 40 6.1
448gb|BC022107.1| Mus musculus cadherin 2, mRNA (cDNA clone MGC:361... 40 6.1
449gb|AC025483.7| Homo sapiens chromosome 15, clone RP11-398I10, co... 40 6.1
450emb|CR859259.1| Pongo pygmaeus mRNA; cDNA DKFZp459D081 (from clo... 40 6.1
451emb|CR858840.1| Pongo pygmaeus mRNA; cDNA DKFZp469B1218 (from cl... 40 6.1
452gb|AC152452.3| Mus musculus BAC clone RP24-279M22 from chromosom... 40 6.1
453gb|AC158802.3| Mus musculus 10 BAC RP24-328C19 (Roswell Park Can... 40 6.1
454gb|AC108685.4| Homo sapiens X BAC RP11-323F16 (Roswell Park Canc... 40 6.1
455gb|AC104162.2| Homo sapiens chromosome 3 clone RP11-50F24, compl... 40 6.1
456gb|AC023742.4| Drosophila melanogaster X BAC RP98-43C24 (Roswell... 40 6.1
457gb|AC183297.3| Pan troglodytes BAC clone CH251-300E12 from chrom... 40 6.1
458dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co... 40 6.1
459gb|AC098719.3| Mus musculus clone RP23-2M3, complete sequence 40 6.1
460dbj|AK096970.1| Homo sapiens cDNA FLJ39651 fis, clone SMINT20051... 40 6.1
461gb|AC110015.5| Homo sapiens chromosome 18, clone RP11-104H13, co... 40 6.1
462gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.1
463dbj|AP005827.1| Mus musculus genomic DNA, chromosome 16 clone:RP... 40 6.1
464gb|AC105273.2| Homo sapiens chromosome 1 clone RP4-716B13, compl... 40 6.1
465gb|AC114981.2| Homo sapiens chromosome 5 clone RP11-81B23, compl... 40 6.1
466gb|AC106744.2| Homo sapiens chromosome 5 clone RP11-124N3, compl... 40 6.1
467gb|AC084091.5| Homo sapiens chromosome 8, clone CTD-2532E22, com... 40 6.1
468gb|AC100783.2| Homo sapiens chromosome 18, clone RP11-141I4, com... 40 6.1
469gb|AC091867.3| Homo sapiens chromosome 5 clone CTD-2365E22, comp... 40 6.1
470gb|AF462592.1| Hemibagrus nemurus clone PCTB1-2 microsatellite s... 40 6.1
471dbj|AK146981.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 40 6.1
472gb|AC093163.4| Homo sapiens BAC clone RP11-774M20 from 4, comple... 40 6.1
473ref|XM_692368.1| PREDICTED: Danio rerio similar to UPF2 regulato... 40 6.1
474gb|AC021000.9| Homo sapiens chromosome 8, clone RP11-381I2, comp... 40 6.1
475dbj|AK156645.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 6.1
476gb|CP000249.1| Frankia sp. CcI3, complete genome 40 6.1
477gb|DP000043.1| Macaca mulatta target 106 genomic scaffold 40 6.1
478gb|AC161418.4| Mus musculus BAC clone RP23-325K2 from chromosome... 40 6.1
479gb|AC153596.5| Mus musculus 6 BAC RP23-305C1 (Roswell Park Cance... 40 6.1
480gb|AC145069.9| Mus musculus chromosome 3, clone RP23-82B2, compl... 40 6.1
481gb|AF135026.1|AF135026 Homo sapiens kallikrein-like protein 3 (K... 40 6.1
482gb|S42303.1| N-cadherin [human, umbilical vein endothelial cells... 40 6.1
483gb|AC013553.14| Homo sapiens chromosome 15, clone RP11-325L12, c... 40 6.1
484dbj|AK032826.1| Mus musculus 12 days embryo male wolffian duct i... 40 6.1
485gb|AC153020.5| Mus musculus BAC clone RP23-88P1 from chromosome ... 40 6.1
486gb|AC155313.2| Mus musculus BAC clone RP23-349D10 from chromosom... 40 6.1
487gb|AC140486.4| Mus musculus BAC clone RP24-134B9 from chromosome... 40 6.1
488gb|AC153150.5| Mus musculus BAC clone RP23-181B14 from chromosom... 40 6.1
489gb|AC137898.6| Homo sapiens chromosome 17, clone RP11-101O21, co... 40 6.1
490gb|AC008532.7| Homo sapiens chromosome 19 clone CTC-483I11, comp... 40 6.1
491tpg|BK005196.1| TPA: TPA_exp: Homo sapiens U11/U12 snRNP 59K mRN... 40 6.1
492dbj|AK048151.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 6.1
493gb|AC021019.5|AC021019 Homo sapiens BAC clone RP11-496J3 from 6,... 40 6.1
494gb|AC151052.4| Mus musculus BAC clone RP24-72K12 from chromosome... 40 6.1
495dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
496dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
497gb|BT006013.1| Drosophila melanogaster LD11736 full insert cDNA 40 6.1
498emb|BX829422.1|CNS0A1YA Arabidopsis thaliana Full-length cDNA Co... 40 6.1
499gb|AC108029.3| Homo sapiens BAC clone RP11-88J6 from 4, complete... 40 6.1
500gb|AC013449.8| Homo sapiens BAC clone RP11-558C24 from 2, comple... 40 6.1

>ref|XM_476420.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1473

 Score =  163 bits (82), Expect = 6e-37
 Identities = 121/134 (90%)
 Strand = Plus / Plus

                                                                       
Query: 188 ccgccatggacgactgtatccggaggctggaggaggagaagagcaagatcgaggtgttcc 247
           |||||||||  ||||| ||||||||||| |||||||||| | ||||||||||||| ||||
Sbjct: 226 ccgccatgggtgactgcatccggaggctcgaggaggagatgggcaagatcgaggtcttcc 285

                                                                       
Query: 248 ggcgcgagctccccctctgcgcacgcctcctcgctgacgtgattgatgtgatgaagaagg 307
           | |||||||||||||||||||  ||||||||||| ||||||||||||||||||||| |||
Sbjct: 286 gccgcgagctccccctctgcgtccgcctcctcgccgacgtgattgatgtgatgaaggagg 345

                         
Query: 308 aggtggaggagaag 321
           |||||||| |||||
Sbjct: 346 aggtggagaagaag 359



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 41/41 (100%)
 Strand = Plus / Plus

                                                    
Query: 367 ggcgacaagagcaactggatgagcaccgcgcagctctggac 407
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 396 ggcgacaagagcaactggatgagcaccgcgcagctctggac 436



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 125 tgagcctggatttgaagatgttcgcggccaagagc 159
           ||||||||||| | ||||||||||| |||||||||
Sbjct: 157 tgagcctggatctcaagatgttcgccgccaagagc 191



to top

>dbj|AK070421.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023048M12, full
           insert sequence
          Length = 1473

 Score =  163 bits (82), Expect = 6e-37
 Identities = 121/134 (90%)
 Strand = Plus / Plus

                                                                       
Query: 188 ccgccatggacgactgtatccggaggctggaggaggagaagagcaagatcgaggtgttcc 247
           |||||||||  ||||| ||||||||||| |||||||||| | ||||||||||||| ||||
Sbjct: 226 ccgccatgggtgactgcatccggaggctcgaggaggagatgggcaagatcgaggtcttcc 285

                                                                       
Query: 248 ggcgcgagctccccctctgcgcacgcctcctcgctgacgtgattgatgtgatgaagaagg 307
           | |||||||||||||||||||  ||||||||||| ||||||||||||||||||||| |||
Sbjct: 286 gccgcgagctccccctctgcgtccgcctcctcgccgacgtgattgatgtgatgaaggagg 345

                         
Query: 308 aggtggaggagaag 321
           |||||||| |||||
Sbjct: 346 aggtggagaagaag 359



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 41/41 (100%)
 Strand = Plus / Plus

                                                    
Query: 367 ggcgacaagagcaactggatgagcaccgcgcagctctggac 407
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 396 ggcgacaagagcaactggatgagcaccgcgcagctctggac 436



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 125 tgagcctggatttgaagatgttcgcggccaagagc 159
           ||||||||||| | ||||||||||| |||||||||
Sbjct: 157 tgagcctggatctcaagatgttcgccgccaagagc 191



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score =  109 bits (55), Expect = 8e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                           
Query: 188     ccgccatggacgactgtatccggaggctggaggaggagaagagcaagatcgaggtgttcc 247
               |||||||||  ||||| ||||||||||| |||||||||| | ||||||||||||| ||||
Sbjct: 1045267 ccgccatgggtgactgcatccggaggctcgaggaggagatgggcaagatcgaggtcttcc 1045326

                                                      
Query: 248     ggcgcgagctccccctctgcgcacgcctcctcgctgacg 286
               | |||||||||||||||||||  ||||||||||| ||||
Sbjct: 1045327 gccgcgagctccccctctgcgtccgcctcctcgccgacg 1045365



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 41/41 (100%)
 Strand = Plus / Plus

                                                        
Query: 367     ggcgacaagagcaactggatgagcaccgcgcagctctggac 407
               |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1045528 ggcgacaagagcaactggatgagcaccgcgcagctctggac 1045568



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                   
Query: 286     gtgattgatgtgatgaagaaggaggtggaggagaag 321
               |||||||||||||||||| ||||||||||| |||||
Sbjct: 1045456 gtgattgatgtgatgaaggaggaggtggagaagaag 1045491



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 125     tgagcctggatttgaagatgttcgcggccaagagc 159
               ||||||||||| | ||||||||||| |||||||||
Sbjct: 1045198 tgagcctggatctcaagatgttcgccgccaagagc 1045232



to top

>dbj|AP004262.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0022B05
          Length = 151317

 Score =  109 bits (55), Expect = 8e-21
 Identities = 88/99 (88%)
 Strand = Plus / Plus

                                                                         
Query: 188   ccgccatggacgactgtatccggaggctggaggaggagaagagcaagatcgaggtgttcc 247
             |||||||||  ||||| ||||||||||| |||||||||| | ||||||||||||| ||||
Sbjct: 42855 ccgccatgggtgactgcatccggaggctcgaggaggagatgggcaagatcgaggtcttcc 42914

                                                    
Query: 248   ggcgcgagctccccctctgcgcacgcctcctcgctgacg 286
             | |||||||||||||||||||  ||||||||||| ||||
Sbjct: 42915 gccgcgagctccccctctgcgtccgcctcctcgccgacg 42953



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 41/41 (100%)
 Strand = Plus / Plus

                                                      
Query: 367   ggcgacaagagcaactggatgagcaccgcgcagctctggac 407
             |||||||||||||||||||||||||||||||||||||||||
Sbjct: 43116 ggcgacaagagcaactggatgagcaccgcgcagctctggac 43156



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                 
Query: 286   gtgattgatgtgatgaagaaggaggtggaggagaag 321
             |||||||||||||||||| ||||||||||| |||||
Sbjct: 43044 gtgattgatgtgatgaaggaggaggtggagaagaag 43079



 Score = 46.1 bits (23), Expect = 0.100
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 125   tgagcctggatttgaagatgttcgcggccaagagc 159
             ||||||||||| | ||||||||||| |||||||||
Sbjct: 42786 tgagcctggatctcaagatgttcgccgccaagagc 42820



to top

>ref|XM_469887.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1047

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 72/81 (88%)
 Strand = Plus / Plus

                                                                       
Query: 230 gcaagatcgaggtgttccggcgcgagctccccctctgcgcacgcctcctcgctgacgtga 289
           ||||||||||| ||||| ||||||||||||| |||||||| ||||||||||| |||||||
Sbjct: 155 gcaagatcgagatgttcaggcgcgagctcccgctctgcgcccgcctcctcgccgacgtga 214

                                
Query: 290 ttgatgtgatgaagaaggagg 310
           | ||  |||||||| ||||||
Sbjct: 215 tcgagctgatgaaggaggagg 235



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 367 ggcgacaagagcaactggatgagcaccgcgcagctctgg 405
           ||||||||||  || ||||||||||||||||||||||||
Sbjct: 286 ggcgacaagacgaaatggatgagcaccgcgcagctctgg 324



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 121 gatttgagcctggatttgaagatgttcgcggc 152
           ||||||||||||||  ||||||||||||||||
Sbjct: 37  gatttgagcctggacctgaagatgttcgcggc 68



to top

>dbj|AK105625.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-C11, full
           insert sequence
          Length = 1496

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 72/81 (88%)
 Strand = Plus / Plus

                                                                       
Query: 230 gcaagatcgaggtgttccggcgcgagctccccctctgcgcacgcctcctcgctgacgtga 289
           ||||||||||| ||||| ||||||||||||| |||||||| ||||||||||| |||||||
Sbjct: 295 gcaagatcgagatgttcaggcgcgagctcccgctctgcgcccgcctcctcgccgacgtga 354

                                
Query: 290 ttgatgtgatgaagaaggagg 310
           | ||  |||||||| ||||||
Sbjct: 355 tcgagctgatgaaggaggagg 375



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                  
Query: 367 ggcgacaagagcaactggatgagcaccgcgcagctctgg 405
           ||||||||||  || ||||||||||||||||||||||||
Sbjct: 426 ggcgacaagacgaaatggatgagcaccgcgcagctctgg 464



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 121 gatttgagcctggatttgaagatgttcgcggc 152
           ||||||||||||||  ||||||||||||||||
Sbjct: 177 gatttgagcctggacctgaagatgttcgcggc 208



to top

>gb|BT016414.1| Zea mays clone Contig247 mRNA sequence
          Length = 1385

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 178 gcgccggcggccgccatggacgactgtatccggaggctggaggaggagaagagcaagatc 237
           ||||||||| | | |||||||| ||| |||||  | || |||||||||  | ||||||||
Sbjct: 170 gcgccggcgccggacatggacgcctgcatccgccgcctcgaggaggagcggggcaagatc 229

                                                                       
Query: 238 gaggtgttccggcgcgagctccccctctgcgcacgcctcctcgctgacgtgattgatgtg 297
           ||| |||||  ||| ||||| || |||||||| ||||||||||| |||||||| ||||||
Sbjct: 230 gagatgttcaagcgggagctgccgctctgcgcgcgcctcctcgcagacgtgatcgatgtg 289

                      
Query: 298 atgaagaagga 308
           |||||| ||||
Sbjct: 290 atgaaggagga 300



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 350 aggaggacgccggcgcaggcgacaagagcaactggatgagcaccgcgcagctctggaccg 409
           ||||||||| || ||| || |||||||||||  |||||||||| ||||||||||||||||
Sbjct: 321 aggaggacggcgccgccggggacaagagcaaggggatgagcacggcgcagctctggaccg 380

                 
Query: 410 gcgatt 415
           | ||||
Sbjct: 381 gagatt 386



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 103 gagatcggcatgggcgcagatttgagcctggat 135
           |||||||| |||||||| |||||||||||||||
Sbjct: 86  gagatcgggatgggcgccgatttgagcctggat 118



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                         
Query: 230      gcaagatcgaggtgttccggcgcgagctccccctctgcgcacgcctcctcgctgacg 286
                ||||||||||| ||||| ||||||||||||| |||||||| ||||||||||| ||||
Sbjct: 31340280 gcaagatcgagatgttcaggcgcgagctcccgctctgcgcccgcctcctcgccgacg 31340336



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 367      ggcgacaagagcaactggatgagcaccgcgcagctctgg 405
                ||||||||||  || ||||||||||||||||||||||||
Sbjct: 31340512 ggcgacaagacgaaatggatgagcaccgcgcagctctgg 31340550



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 121      gatttgagcctggatttgaagatgttcgcggc 152
                ||||||||||||||  ||||||||||||||||
Sbjct: 31340162 gatttgagcctggacctgaagatgttcgcggc 31340193



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 307      gaggtggaggagaagaagag 326
                ||||||||||||||||||||
Sbjct: 30908438 gaggtggaggagaagaagag 30908457



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 306     ggaggtggaggagaagaaga 325
               ||||||||||||||||||||
Sbjct: 1732188 ggaggtggaggagaagaaga 1732207



to top

>gb|AC099043.6| Oryza sativa chromosome 3 BAC OSJNBa0079B15 genomic sequence, complete
              sequence
          Length = 159091

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                       
Query: 230    gcaagatcgaggtgttccggcgcgagctccccctctgcgcacgcctcctcgctgacg 286
              ||||||||||| ||||| ||||||||||||| |||||||| ||||||||||| ||||
Sbjct: 155520 gcaagatcgagatgttcaggcgcgagctcccgctctgcgcccgcctcctcgccgacg 155464



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                     
Query: 367    ggcgacaagagcaactggatgagcaccgcgcagctctgg 405
              ||||||||||  || ||||||||||||||||||||||||
Sbjct: 155288 ggcgacaagacgaaatggatgagcaccgcgcagctctgg 155250



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 121    gatttgagcctggatttgaagatgttcgcggc 152
              ||||||||||||||  ||||||||||||||||
Sbjct: 155638 gatttgagcctggacctgaagatgttcgcggc 155607



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                         
Query: 230      gcaagatcgaggtgttccggcgcgagctccccctctgcgcacgcctcctcgctgacg 286
                ||||||||||| ||||| ||||||||||||| |||||||| ||||||||||| ||||
Sbjct: 31430796 gcaagatcgagatgttcaggcgcgagctcccgctctgcgcccgcctcctcgccgacg 31430852



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 367      ggcgacaagagcaactggatgagcaccgcgcagctctgg 405
                ||||||||||  || ||||||||||||||||||||||||
Sbjct: 31431028 ggcgacaagacgaaatggatgagcaccgcgcagctctgg 31431066



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 121      gatttgagcctggatttgaagatgttcgcggc 152
                ||||||||||||||  ||||||||||||||||
Sbjct: 31430678 gatttgagcctggacctgaagatgttcgcggc 31430709



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 307      gaggtggaggagaagaagag 326
                ||||||||||||||||||||
Sbjct: 30998961 gaggtggaggagaagaagag 30998980



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 306     ggaggtggaggagaagaaga 325
               ||||||||||||||||||||
Sbjct: 1732186 ggaggtggaggagaagaaga 1732205



to top

>ref|XM_633891.1| Dictyostelium discoideum hypothetical protein (DDB0185647), partial
           mRNA
          Length = 3963

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 295 gtgatgaagaaggaggtggaggagaagaa 323
           |||||||||||||||| ||||||||||||
Sbjct: 271 gtgatgaagaaggaggaggaggagaagaa 243



to top

>gb|AY023290.1| Oryza sativa microsatellite MRG5615 containing (GGC)X9, closest to
           marker G148, genomic sequence
          Length = 227

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                    
Query: 205 atccggaggctggaggaggagaagagcaagatcgaggtgttccggcgcgagctcccc 261
           |||||||| || ||||  ||||||  |||||| ||||||||||| ||||||||||||
Sbjct: 144 atccggagcctcgaggccgagaaggccaagatggaggtgttccgccgcgagctcccc 200



to top

>gb|AC126410.12| Mus musculus chromosome 5, clone RP23-368H6, complete sequence
          Length = 187058

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 300   gaagaaggaggtggaggagaagaagagag 328
             ||||||||||| |||||||||||||||||
Sbjct: 45167 gaagaaggaggaggaggagaagaagagag 45195



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                         
Query: 205      atccggaggctggaggaggagaagagcaagatcgaggtgttccggcgcgagctcccc 261
                |||||||| || ||||  ||||||  |||||| ||||||||||| ||||||||||||
Sbjct: 24508908 atccggagcctcgaggccgagaaggccaagatggaggtgttccgccgcgagctcccc 24508964



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 299      tgaagaaggaggtggaggagaagaagag 326
                |||||||| ||||||||||| |||||||
Sbjct: 19199802 tgaagaagaaggtggaggaggagaagag 19199829



to top

>gb|AC138666.6| Mus musculus chromosome 5, clone RP24-140D11, complete sequence
          Length = 209938

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 300    gaagaaggaggtggaggagaagaagagag 328
              ||||||||||| |||||||||||||||||
Sbjct: 206169 gaagaaggaggaggaggagaagaagagag 206197



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                         
Query: 205      atccggaggctggaggaggagaagagcaagatcgaggtgttccggcgcgagctcccc 261
                |||||||| || ||||  ||||||  |||||| ||||||||||| ||||||||||||
Sbjct: 24437114 atccggagcctcgaggccgagaaggccaagatggaggtgttccgccgcgagctcccc 24437170



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 299      tgaagaaggaggtggaggagaagaagag 326
                |||||||| ||||||||||| |||||||
Sbjct: 19126029 tgaagaagaaggtggaggaggagaagag 19126056



to top

>emb|AL844880.3|CNS08CB3 Oryza sativa chromosome 12, . BAC OSJNBb0049H14 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 120071

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 205   atccggaggctggaggaggagaagagcaagatcgaggtgttccggcgcgagctcccc 261
             |||||||| || ||||  ||||||  |||||| ||||||||||| ||||||||||||
Sbjct: 79939 atccggagcctcgaggccgagaaggccaagatggaggtgttccgccgcgagctcccc 79995



to top

>gb|AC153582.10| Mus musculus 6 BAC RP23-432M19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 204239

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 300   gaagaaggaggtggaggagaagaagaga 327
             ||||||||||| ||||||||||||||||
Sbjct: 77440 gaagaaggaggaggaggagaagaagaga 77467



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 300    gaagaaggaggtggaggagaagaagaga 327
              ||||||| ||| ||||||||||||||||
Sbjct: 118541 gaagaagaaggaggaggagaagaagaga 118568



to top

>gb|AC156279.5| Mus musculus 6 BAC RP24-244D20 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 152395

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 300   gaagaaggaggtggaggagaagaagaga 327
             ||||||||||| ||||||||||||||||
Sbjct: 88794 gaagaaggaggaggaggagaagaagaga 88767



to top

>gb|AC153838.6| Mus musculus 6 BAC RP23-82B24 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 217672

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 300    gaagaaggaggtggaggagaagaagaga 327
              ||||||||||| ||||||||||||||||
Sbjct: 196099 gaagaaggaggaggaggagaagaagaga 196072



to top

>emb|AL929445.8| Mouse DNA sequence from clone RP23-185M22 on chromosome 4, complete
             sequence
          Length = 203623

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 298   atgaagaaggaggtggaggagaagaaga 325
             ||||||||||||| ||||||||||||||
Sbjct: 99603 atgaagaaggaggaggaggagaagaaga 99630



to top

>emb|AL808103.8| Mouse DNA sequence from clone RP23-301G2 on chromosome 4, complete
             sequence
          Length = 232070

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 300   gaagaaggaggtggaggagaagaa 323
             ||||||||||||||||||||||||
Sbjct: 11874 gaagaaggaggtggaggagaagaa 11897



to top

>gb|AC168269.3| Mus musculus BAC clone RP23-193M17 from chromosome 17, complete sequence
          Length = 223337

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 297    gatgaagaaggaggtggaggagaagaa 323
              |||||||||||||| ||||||||||||
Sbjct: 184949 gatgaagaaggaggaggaggagaagaa 184975



to top

>gb|AC160992.2| Mus musculus BAC clone RP23-147I23 from chromosome 9, complete sequence
          Length = 215980

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 300    gaagaaggaggtggaggagaagaagag 326
              ||||||||||| |||||||||||||||
Sbjct: 209440 gaagaaggaggaggaggagaagaagag 209414



to top

>ref|NM_001002763.1| Bos taurus cadherin 1, type 1, E-cadherin (epithelial) (CDH1), mRNA
          Length = 2649

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 296  tgatgaagaaggaggtggaggagaaga 322
            |||||||||||||||||||| ||||||
Sbjct: 2265 tgatgaagaaggaggtggagaagaaga 2291



to top

>gb|AC113548.22| Mus musculus chromosome 9, clone RP23-268F15, complete sequence
          Length = 195273

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 300   gaagaaggaggtggaggagaagaagag 326
             ||||||||||| |||||||||||||||
Sbjct: 30366 gaagaaggaggaggaggagaagaagag 30340



to top

>gb|AC140300.3| Mus musculus BAC clone RP23-373O10 from chromosome 17, complete
            sequence
          Length = 189769

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 297  gatgaagaaggaggtggaggagaagaa 323
            |||||||||||||| ||||||||||||
Sbjct: 3759 gatgaagaaggaggaggaggagaagaa 3785



to top

>ref|NM_009864.1| Mus musculus cadherin 1 (Cdh1), mRNA
          Length = 4413

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 296  tgatgaagaaggaggtggaggagaaga 322
            |||||||||||||||||||| ||||||
Sbjct: 2398 tgatgaagaaggaggtggagaagaaga 2424



to top

>gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome 16, complete sequence
          Length = 193532

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 301    aagaaggaggtggaggagaagaagaga 327
              |||||||||| ||||||||||||||||
Sbjct: 105772 aagaaggaggaggaggagaagaagaga 105746



to top

>gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, complete sequence
          Length = 123569

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 301   aagaaggaggtggaggagaagaagaga 327
             |||||||||| ||||||||||||||||
Sbjct: 88218 aagaaggaggaggaggagaagaagaga 88244



to top

>gb|AY508164.1| Bos taurus e-cadherin (CDH1) mRNA, complete cds
          Length = 2649

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 296  tgatgaagaaggaggtggaggagaaga 322
            |||||||||||||||||||| ||||||
Sbjct: 2265 tgatgaagaaggaggtggagaagaaga 2291



to top

>gb|AC122355.4| Mus musculus BAC clone RP23-401L7 from chromosome 14, complete sequence
          Length = 198831

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 301   aagaaggaggtggaggagaagaagaga 327
             |||||||||| ||||||||||||||||
Sbjct: 63240 aagaaggagggggaggagaagaagaga 63214



to top

>gb|AC024608.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-333I24, complete
             sequence
          Length = 215829

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 300   gaagaaggaggtggaggagaagaagag 326
             ||||||||||| |||||||||||||||
Sbjct: 20095 gaagaaggaggaggaggagaagaagag 20069



to top

>gb|AC074359.2| Mus musculus strain C57BL6/J chromosome 5 clone RP23-289J24, complete
             sequence
          Length = 106041

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 300   gaagaaggaggtggaggagaagaagag 326
             ||||||||||| |||||||||||||||
Sbjct: 89016 gaagaaggaggaggaggagaagaagag 88990



to top

>gb|AC079760.6| Homo sapiens BAC clone RP11-142A5 from 7, complete sequence
          Length = 129808

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 300  gaagaaggaggtggaggagaagaagag 326
            ||||||||||| |||||||||||||||
Sbjct: 1995 gaagaaggaggaggaggagaagaagag 1969



to top

>gb|AC095042.3| Homo sapiens BAC clone RP11-115N4 from 7, complete sequence
          Length = 53783

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 300   gaagaaggaggtggaggagaagaagag 326
             ||||||||||| |||||||||||||||
Sbjct: 53778 gaagaaggaggaggaggagaagaagag 53752



to top

>gb|BC098501.1| Mus musculus cadherin 1, mRNA (cDNA clone MGC:107495 IMAGE:30023851),
            complete cds
          Length = 3314

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 296  tgatgaagaaggaggtggaggagaaga 322
            |||||||||||||||||||| ||||||
Sbjct: 2387 tgatgaagaaggaggtggagaagaaga 2413



to top

>ref|XM_778244.1| PREDICTED: Strongylocentrotus purpuratus similar to calcium binding
           atopy-related autoantigen 1 (LOC578055), mRNA
          Length = 1500

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 295 gtgatgaagaaggaggtggaggagaagaaga 325
           |||||||||||||||| |||| |||||||||
Sbjct: 281 gtgatgaagaaggaggaggagaagaagaaga 311



to top

>emb|AL121828.17|HSDJ892M9 Human DNA sequence from clone RP5-892M9 on chromosome 20 Contains GSSs
             and STSs, complete sequence
          Length = 61921

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 297   gatgaagaaggaggtggaggagaagaa 323
             |||||||||||||| ||||||||||||
Sbjct: 33362 gatgaagaaggaggaggaggagaagaa 33388



to top

>ref|XM_795053.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC581735 (LOC581735), mRNA
          Length = 147

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 299 tgaagaaggaggtggaggagaagaaga 325
           |||||||||||| ||||||||||||||
Sbjct: 38  tgaagaaggaggaggaggagaagaaga 64



to top

>gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete sequence
          Length = 150117

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 300   gaagaaggaggtggaggagaagaagag 326
             ||||||||||| |||||||||||||||
Sbjct: 56189 gaagaaggaggaggaggagaagaagag 56163



to top

>gb|AC098567.4| Genomic sequence for Mus musculus, clone RP23-198E6, from chromosome
             17, complete sequence
          Length = 185277

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 297   gatgaagaaggaggtggaggagaagaa 323
             |||||||||||||| ||||||||||||
Sbjct: 43247 gatgaagaaggaggaggaggagaagaa 43221



to top

>gb|AC022483.7| Homo sapiens BAC clone RP11-533F5 from 4, complete sequence
          Length = 205640

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 300   gaagaaggaggtggaggagaagaagag 326
             |||| ||||||||||||||||||||||
Sbjct: 56456 gaaggaggaggtggaggagaagaagag 56482



to top

>gb|AC093302.2| Homo sapiens chromosome 5 clone RP11-60A8, complete sequence
          Length = 179385

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 300    gaagaaggaggtggaggagaagaagag 326
              ||||||||||| |||||||||||||||
Sbjct: 114690 gaagaaggaggaggaggagaagaagag 114664



to top

>dbj|AK166267.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN full-length
            enriched library, clone:G830027A10 product:cadherin 1,
            full insert sequence
          Length = 3021

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 296  tgatgaagaaggaggtggaggagaaga 322
            |||||||||||||||||||| ||||||
Sbjct: 2400 tgatgaagaaggaggtggagaagaaga 2426



to top

>dbj|AK076369.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched
            library, clone:4732469F18 product:cadherin 1, full insert
            sequence
          Length = 4415

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 296  tgatgaagaaggaggtggaggagaaga 322
            |||||||||||||||||||| ||||||
Sbjct: 2400 tgatgaagaaggaggtggagaagaaga 2426



to top

>gb|AC132132.4| Mus musculus BAC clone RP23-235K2 from 8, complete sequence
          Length = 198321

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 296    tgatgaagaaggaggtggaggagaaga 322
              |||||||||||||||||||| ||||||
Sbjct: 194808 tgatgaagaaggaggtggagaagaaga 194834



to top

>emb|X60974.1|MMUVEX14 M.musculus uvomorulin exon 14
          Length = 151

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 296 tgatgaagaaggaggtggaggagaaga 322
           |||||||||||||||||||| ||||||
Sbjct: 115 tgatgaagaaggaggtggagaagaaga 141



to top

>dbj|AB037667.1| Bos taurus mRNA for E-cadherin, partial cds
          Length = 198

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 296 tgatgaagaaggaggtggaggagaaga 322
           |||||||||||||||||||| ||||||
Sbjct: 54  tgatgaagaaggaggtggagaagaaga 80



to top

>gb|AC155316.6| Mus musculus BAC clone RP23-181P9 from chromosome 5, complete sequence
          Length = 204809

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 300    gaagaaggaggtggaggagaagaagag 326
              ||||||||||| |||||||||||||||
Sbjct: 103670 gaagaaggaggaggaggagaagaagag 103644



to top

>gb|AC147500.6| Mus musculus BAC clone RP24-281C21 from chromosome 8, complete sequence
          Length = 185450

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 296    tgatgaagaaggaggtggaggagaaga 322
              |||||||||||||||||||| ||||||
Sbjct: 173676 tgatgaagaaggaggtggagaagaaga 173650



to top

>emb|X06339.1|MMUVOM Mouse mRNA for uvomorulin cell adhesion molecule
          Length = 2486

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 296  tgatgaagaaggaggtggaggagaaga 322
            |||||||||||||||||||| ||||||
Sbjct: 1752 tgatgaagaaggaggtggagaagaaga 1778



to top

>emb|X06115.1|MMECADH Mouse mRNA for E-cadherin (= uvomorulin, = L-CAM, = cell-CAM 120/80,
            = Arc-1)
          Length = 4362

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 296  tgatgaagaaggaggtggaggagaaga 322
            |||||||||||||||||||| ||||||
Sbjct: 2339 tgatgaagaaggaggtggagaagaaga 2365



to top

>gb|AC160244.11| Mus musculus chromosome 5, clone RP24-212G3, complete sequence
          Length = 150276

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 133609 gaagaaggaggaggaggagaagaaga 133634



to top

>ref|XM_466597.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1136

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 209 ggaggctggaggaggagaagag 230
           ||||||||||||||||||||||
Sbjct: 531 ggaggctggaggaggagaagag 552



to top

>ref|XM_466596.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1467

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 209 ggaggctggaggaggagaagag 230
           ||||||||||||||||||||||
Sbjct: 859 ggaggctggaggaggagaagag 880



to top

>gb|AC157931.11| Mus musculus chromosome 5, clone RP24-159I10, complete sequence
          Length = 147518

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 126170 gaagaaggaggaggaggagaagaaga 126145



to top

>gb|AY145461.1| Bemisia tabaci microsatellite Bem23 sequence
          Length = 227

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 300 gaagaaggaggtggaggagaagaaga 325
           ||||||||||| ||||||||||||||
Sbjct: 164 gaagaaggaggaggaggagaagaaga 189



to top

>gb|AC164440.4| Mus musculus BAC clone RP23-27B3 from chromosome 3, complete sequence
          Length = 218926

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 175525 gaagaaggaggaggaggagaagaaga 175500



to top

>gb|AC119908.16| Mus musculus chromosome 7, clone RP24-240G4, complete sequence
          Length = 190369

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 4475 gaagaaggaggaggaggagaagaaga 4500



to top

>gb|AY661658.1| Sorghum bicolor clone BAC 796all, complete sequence
          Length = 103167

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 381   ctggatgagcaccgcgcagctctgga 406
             |||||||||| |||||||||||||||
Sbjct: 60469 ctggatgagctccgcgcagctctgga 60494



to top

>gb|AC068006.10| Mus musculus chromosome 7, clone RP23-6I17, complete sequence
          Length = 203141

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 145554 gaagaaggaggaggaggagaagaaga 145579



to top

>gb|AC137967.14| Mus musculus chromosome 10, clone RP24-323I24, complete sequence
          Length = 199669

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 298    atgaagaaggaggtggaggagaagaa 323
              ||||||||||||| ||||||||||||
Sbjct: 185836 atgaagaaggaggaggaggagaagaa 185861



to top

>gb|AC167141.2| Mus musculus BAC clone RP23-313L4 from chromosome 16, complete sequence
          Length = 192972

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 109262 gaagaaggaggaggaggagaagaaga 109287



to top

>gb|AC165293.2| Mus musculus BAC clone RP23-268A5 from chromosome 12, complete sequence
          Length = 179330

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 302    agaaggaggtggaggagaagaagaga 327
              |||||||||||||||||||| |||||
Sbjct: 118990 agaaggaggtggaggagaaggagaga 119015



to top

>gb|AC164581.7| Mus musculus 10 BAC RP23-45O2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 199422

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 129239 gaagaaggaggaggaggagaagaaga 129264



to top

>gb|AC121849.3| Mus musculus BAC clone RP24-90K18 from chromosome 6, complete sequence
          Length = 205721

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 297   gatgaagaaggaggtggaggagaagaagag 326
             |||||||||||||  |||||||||||||||
Sbjct: 39269 gatgaagaaggagaaggaggagaagaagag 39240



to top

>ref|XM_992125.1| PREDICTED: Mus musculus similar to olfactory receptor 775
           (LOC672253), mRNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 300 gaagaaggaggtggaggagaagaaga 325
           ||||||||||| ||||||||||||||
Sbjct: 441 gaagaaggaggaggaggagaagaaga 466



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 300 gaagaaggaggtggaggagaagaag 324
           ||||||||||| |||||||||||||
Sbjct: 519 gaagaaggaggaggaggagaagaag 543



to top

>ref|XM_001001853.1| PREDICTED: Mus musculus hypothetical protein LOC668505 (LOC668505),
           mRNA
          Length = 486

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 300 gaagaaggaggtggaggagaagaaga 325
           ||||||||||| ||||||||||||||
Sbjct: 315 gaagaaggaggaggaggagaagaaga 340



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 300 gaagaaggaggtggaggagaagaag 324
           ||||||||||| |||||||||||||
Sbjct: 393 gaagaaggaggaggaggagaagaag 417



to top

>gb|AC129080.6| Mus musculus BAC clone RP24-226L20 from chromosome 5, complete sequence
          Length = 156781

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 49681 gaagaaggaggaggaggagaagaaga 49706



to top

>gb|AC130539.3| Mus musculus BAC clone RP23-455J15 from chromosome 9, complete sequence
          Length = 179156

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 56434 gaagaaggaggaggaggagaagaaga 56409



to top

>gb|AC129079.5| Mus musculus BAC clone RP24-126J17 from chromosome 7, complete sequence
          Length = 180663

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 24563 gaagaaggaggaggaggagaagaaga 24538



to top

>gb|AC123924.4| Mus musculus BAC clone RP24-292A3 from chromosome 16, complete
           sequence
          Length = 159639

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 300 gaagaaggaggtggaggagaagaaga 325
           ||||||||||| ||||||||||||||
Sbjct: 496 gaagaaggaggaggaggagaagaaga 521



to top

>gb|AC124421.4| Mus musculus BAC clone RP24-323H7 from chromosome 10, complete sequence
          Length = 187081

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 88066 gaagaaggaggaggaggagaagaaga 88041



to top

>gb|AC125400.4| Mus musculus BAC clone RP24-380E10 from chromosome 10, complete
             sequence
          Length = 154681

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 84018 gaagaaggaggaggaggagaagaaga 84043



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 300   gaagaaggaggtggaggagaagaagaga 327
             ||||||||||| | ||||||||||||||
Sbjct: 84346 gaagaaggaggagaaggagaagaagaga 84373



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 300   gaagaaggaggtggaggagaagaagaga 327
             ||||||||||| | ||||||||||||||
Sbjct: 84180 gaagaaggaggagaaggagaagaagaga 84207



to top

>gb|AC130818.3| Mus musculus BAC clone RP23-89F9 from chromosome 8, complete sequence
          Length = 220285

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 210868 gaagaaggaggaggaggagaagaaga 210843



to top

>gb|AC129609.3| Mus musculus BAC clone RP23-194H4 from chromosome 7, complete
            sequence
          Length = 225829

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 1815 gaagaaggaggaggaggagaagaaga 1840



to top

>gb|AC127257.3| Mus musculus BAC clone RP24-296O9 from chromosome 3, complete sequence
          Length = 166030

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 47258 gaagaaggaggaggaggagaagaaga 47233



to top

>gb|AC091092.3| Papio anubis clone RP41-191D8, complete sequence
          Length = 167732

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 27647 gaagaaggaggaggaggagaagaaga 27622



to top

>gb|AC098712.3| Mus musculus BAC clone RP23-2A21 from 10, complete sequence
          Length = 205054

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 298    atgaagaaggaggtggaggagaagaa 323
              ||||||||||||| ||||||||||||
Sbjct: 114507 atgaagaaggaggaggaggagaagaa 114532



to top

>gb|AC131751.2| Mus musculus BAC clone RP23-19P8 from 10, complete sequence
          Length = 185680

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 94567 gaagaaggaggaggaggagaagaaga 94542



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||| |||||||||||||
Sbjct: 94489 gaagaaggaggaggaggagaagaag 94465



to top

>gb|AC129602.3| Mus musculus BAC clone RP23-37L24 from 16, complete sequence
          Length = 185729

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 143642 gaagaaggaggaggaggagaagaaga 143667



to top

>gb|AC122215.4| Mus musculus BAC clone RP23-106M18 from 16, complete sequence
          Length = 195086

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 127438 gaagaaggaggaggaggagaagaaga 127413



to top

>gb|AC102613.7| Mus musculus chromosome 1, clone RP23-418C16, complete sequence
          Length = 201275

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 106037 gaagaaggaggaggaggagaagaaga 106062



to top

>gb|AC146218.2| Pan troglodytes BAC clone CH251-267E2 from Y, complete sequence
          Length = 203014

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 176904 gaagaaggaggaggaggagaagaaga 176879



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 176880 gaagaaggaggaggaggagaagaaga 176855



to top

>gb|AC092100.5| Homo sapiens BAC clone RP11-666G4 from 7, complete sequence
          Length = 122099

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 59658 gaagaaggaggaggaggagaagaaga 59683



to top

>gb|AC073316.6| Homo sapiens BAC clone RP11-191P7 from 7, complete sequence
          Length = 148930

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 133570 gaagaaggaggaggaggagaagaaga 133595



to top

>gb|AC136717.10| Mus musculus chromosome 7, clone RP23-48C24, complete sequence
          Length = 222854

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 155574 gaagaaggaggaggaggagaagaaga 155549



to top

>gb|AC145985.2| Pan troglodytes BAC clone RP43-17I24 from 7, complete sequence
          Length = 162953

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 308   aggtggaggagaagaagagagg 329
             ||||||||||||||||||||||
Sbjct: 51969 aggtggaggagaagaagagagg 51990



to top

>gb|AC153656.4| Mus musculus BAC clone RP23-428O19 from chromosome 1, complete sequence
          Length = 196584

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 74900 gaagaaggaggaggaggagaagaaga 74875



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 59663 gaagaaggaggaggaggagaagaaga 59688



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||| |||||||||||||
Sbjct: 74918 gaagaaggaggaggaggagaagaag 74894



to top

>gb|AC012526.35| Mus musculus strain 129S6/SvEvTac clone rp21-671i11 map 16, complete
              sequence
          Length = 186272

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 106727 gaagaaggaggaggaggagaagaaga 106752



to top

>gb|AC165252.2| Mus musculus BAC clone RP23-355O12 from chromosome 16, complete
             sequence
          Length = 178619

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 99099 gaagaaggaggaggaggagaagaaga 99124



to top

>gb|AC126071.5| Rattus norvegicus 10 BAC CH230-209B21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 227741

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 37855 gaagaaggaggaggaggagaagaaga 37830



to top

>emb|AL589645.10| Human DNA sequence from clone RP11-251H13 on chromosome 9, complete
             sequence
          Length = 48323

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 11584 gaagaaggaggaggaggagaagaaga 11559



to top

>gb|AC158956.6| Mus musculus chromosome 3, clone RP23-370F14, complete sequence
          Length = 174060

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 296   tgatgaagaaggaggtggaggagaag 321
             ||||||||||||||| ||||||||||
Sbjct: 79037 tgatgaagaaggaggaggaggagaag 79012



to top

>gb|AC113189.11| Homo sapiens chromosome 17, clone RP11-104H15, complete sequence
          Length = 184349

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 7595 gaagaaggaggaggaggagaagaaga 7620



to top

>emb|AL354720.14| Human DNA sequence from clone RP11-505F3 on chromosome 13 Contains the 3'
              end of the gene for progesterone-induced blocking factor 1
              (PIBF1), a proteasome (prosome, macropain) 26S subunit,
              non-ATPase, 10 (PSMD10) pseudogene, the KLF5 gene for
              Kruppel-like factor 5 (intestinal)(CKLF, IKLF, BTEB2), a
              fatty acid binding protein 5 (psoriasis-associated)
              (FABP5)(EFABP, E-FABP, PAFABP, PA-FABP) pseudogene and a
              CpG island, complete sequence
          Length = 199882

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 169443 gaagaaggaggaggaggagaagaaga 169418



to top

>emb|AL158164.15| Human DNA sequence from clone RP11-414K1 on chromosome 10 Contains the
             3' end of the gene for the likely ortholog of mouse
             sialyltransferase 8-VI (alpha-2 8-sialytransferase)
             (ST8SIA-VI), a novel gene and the 5' end of a novel gene,
             complete sequence
          Length = 151289

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 97377 gaagaaggaggaggaggagaagaaga 97402



to top

>emb|AL050342.42|HSDJ655K7 Human DNA sequence from clone RP4-655K7 on chromosome 1p35.3-36.13
             Contains part of a gene encoding a novel protein,,
             complete sequence
          Length = 116857

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 96123 gaagaaggaggaggaggagaagaaga 96098



to top

>gb|AC162861.2| Mus musculus chromosome 1, clone RP23-236B21, complete sequence
          Length = 151717

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 4343 gaagaaggaggaggaggagaagaaga 4318



to top

>ref|XM_783208.1| PREDICTED: Strongylocentrotus purpuratus similar to
           mitogen-activated protein kinase kinase kinase 9
           (LOC583292), partial mRNA
          Length = 1145

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 300 gaagaaggaggtggaggagaagaaga 325
           ||||||||||| ||||||||||||||
Sbjct: 141 gaagaaggaggaggaggagaagaaga 166



to top

>gb|AC026954.14| Homo sapiens chromosome 17, clone RP11-542C16, complete sequence
          Length = 101029

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 79019 gaagaaggaggaggaggagaagaaga 79044



to top

>emb|AL713870.26| Mouse DNA sequence from clone RP24-239D8 on chromosome 11 Contains the
             5' end of the Slc36a3 gene for solute carrier family 36
             (proton/amino acid symporter) member 3, two novel genes,
             the Tramd1 gene for tramdorin 1 (transmembrane domain rich
             protein), the Slc36a1 gene for solute carrier family 36
             (proton/amino acid symporter) member 1 and the gene for
             the ortholog of human and rat FAT tumor suppressor homolog
             2 (Drosophila) FAT2, complete sequence
          Length = 188782

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 50028 gaagaaggaggaggaggagaagaaga 50053



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 295   gtgatgaagaaggaggtggaggagaagaagagag 328
             |||| |||| |||||| |||||||||||||||||
Sbjct: 30384 gtgaagaaggaggaggaggaggagaagaagagag 30417



to top

>emb|AJ276505.2|MMU276505 Mus musculus genomic fragment, 281000 bp, chromosome 7
          Length = 281000

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 77326 gaagaaggaggaggaggagaagaaga 77301



to top

>gb|AC091002.54| Mus musculus strain C57BL/6J clone rp23-7n16 map 16, complete sequence
          Length = 217939

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 33326 gaagaaggaggaggaggagaagaaga 33301



to top

>gb|AC157019.8| Mus musculus 10 BAC RP24-377N13 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 233155

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 296    tgatgaagaaggaggtggaggagaag 321
              ||||||||||||||| ||||||||||
Sbjct: 161835 tgatgaagaaggaggaggaggagaag 161860



to top

>emb|AL645566.15| Mouse DNA sequence from clone RP23-398M13 on chromosome 11 Contains a
             CpG island, complete sequence
          Length = 192808

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 24807 gaagaaggaggaggaggagaagaaga 24832



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 24479 gaagaaggaggaggaggagaagaaga 24504



to top

>emb|AL663051.15| Mouse DNA sequence from clone RP23-450J13 on chromosome 11 Contains the
             5' end of the gene for a novel protein and a CpG island,
             complete sequence
          Length = 156183

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 301   aagaaggaggtggaggagaagaagag 326
             |||||||||| |||||||||||||||
Sbjct: 82501 aagaaggaggaggaggagaagaagag 82526



to top

>emb|AL691470.17| Mouse DNA sequence from clone RP23-160F12 on chromosome 11 Contains the
             3' end of gene FLJ13305, a novel gene, a novel gene
             (1700061J23Rik) and a CpG island, complete sequence
          Length = 195614

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 93748 gaagaaggaggaggaggagaagaaga 93723



to top

>emb|AL603702.14| Mouse DNA sequence from clone RP23-406A14 on chromosome 11 Contains a
            protease (prosome, macropain) 26S subunit ATPase 1
            (Psmc1) pseudogene and a CpG island, complete sequence
          Length = 197265

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 9837 gaagaaggaggaggaggagaagaaga 9812



to top

>gb|AC157551.6| Mus musculus chromosome 5, clone RP24-270K7, complete sequence
          Length = 171680

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 124837 gaagaaggaggaggaggagaagaaga 124812



to top

>emb|AL593857.10| Mouse DNA sequence from clone RP23-439H2 on chromosome 2, complete
              sequence
          Length = 206452

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 162226 gaagaaggaggaggaggagaagaaga 162201



to top

>dbj|BS000535.1| Pan troglodytes chromosome Y clone:PTB-096E06, complete sequences
          Length = 198405

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 166220 gaagaaggaggaggaggagaagaaga 166195



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 166196 gaagaaggaggaggaggagaagaaga 166171



to top

>dbj|AB231934.1| Rosa hybrid cultivar Asami Red DNA, microsatellite marker RA003a
          Length = 578

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 300 gaagaaggaggtggaggagaagaaga 325
           ||||||||||| ||||||||||||||
Sbjct: 56  gaagaaggaggaggaggagaagaaga 81



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 300      gaagaaggaggtggaggagaagaaga 325
                ||||||||||| ||||||||||||||
Sbjct: 19452493 gaagaaggaggaggaggagaagaaga 19452468



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 300      gaagaaggaggtggaggagaagaaga 325
                ||||||||||| ||||||||||||||
Sbjct: 19452469 gaagaaggaggaggaggagaagaaga 19452444



to top

>gb|AC120838.10| Pan troglodytes clone ch251-239a19, complete sequence
          Length = 150256

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 120096 gaagaaggaggcggaggagaagaaga 120071



to top

>gb|AC164572.4| Mus musculus 6 BAC RP24-89J17 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 221464

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 216730 gaagaaggaggaggaggagaagaaga 216755



to top

>gb|AC099670.2| Homo sapiens chromosome 1 clone RP11-84O12, complete sequence
          Length = 171226

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 163190 gaagaaggaggaggaggagaagaaga 163215



to top

>gb|AC003060.1| Mus musculus Chromosome 16 BAC Clone 72k21 Syntenic To Homo sapiens
             22q11.2 DGCR Region, complete sequence
          Length = 118235

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 64442 gaagaaggaggaggaggagaagaaga 64467



to top

>emb|CR405704.4| Mouse DNA sequence from clone RP23-395B7 on chromosome 2, complete
             sequence
          Length = 58248

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 32256 gaagaaggaggaggaggagaagaaga 32231



to top

>gb|DP000036.1| Papio anubis target 106 genomic scaffold
          Length = 492848

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 433208 gaagaaggaggaggaggagaagaaga 433183



to top

>gb|AC118231.9| Mus musculus chromosome 5, clone RP23-462J24, complete sequence
          Length = 186083

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 3595 gaagaaggaggaggaggagaagaaga 3620



to top

>gb|AC151535.2| Mus musculus BAC clone RP23-213M8 from chromosome 7, complete sequence
          Length = 216527

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 94063 gaagaaggaggaggaggagaagaaga 94088



to top

>gb|AC158299.7| Mus musculus chromosome 7, clone RP24-271L24, complete sequence
          Length = 185347

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 14447 gaagaaggaggaggaggagaagaaga 14472



to top

>gb|AC157498.2| Pan troglodytes BAC clone CH251-412M6 from chromosome unknown, complete
              sequence
          Length = 159994

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 154489 gaagaaggaggaggaggagaagaaga 154514



to top

>gb|AC161372.2| Mus musculus BAC clone RP23-326G14 from chromosome 16, complete
             sequence
          Length = 208994

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 84557 gaagaaggaggaggaggagaagaaga 84532



to top

>gb|AC084822.36| Mus musculus strain C57BL/6J clone rp23-47o21 map 16, complete sequence
          Length = 195335

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 97618 gaagaaggaggaggaggagaagaaga 97643



to top

>gb|AC008078.11| Homo sapiens chromosome 15 clone b2176l16 map 15q21, complete sequence
          Length = 78467

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 28803 gaagaaggaggaggaggagaagaaga 28778



to top

>gb|AC010999.6|AC010999 Homo sapiens chromosome 15 clone RP11-323F24 map 15q21.3, complete
              sequence
          Length = 221986

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 118789 gaagaaggaggaggaggagaagaaga 118764



to top

>gb|AF374195.1|AF374195 Mus musculus ribosomal protein L6 (Rpl6) gene, complete cds
          Length = 5672

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 300 gaagaaggaggtggaggagaagaaga 325
           ||||||||||| ||||||||||||||
Sbjct: 305 gaagaaggaggaggaggagaagaaga 330



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 209      ggaggctggaggaggagaagag 230
                ||||||||||||||||||||||
Sbjct: 23599359 ggaggctggaggaggagaagag 23599338



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 304     aaggaggtggaggagaagaagagag 328
               ||||||| |||||||||||||||||
Sbjct: 6955749 aaggaggaggaggagaagaagagag 6955725



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 216      ggaggaggagaagagcaaga 235
                ||||||||||||||||||||
Sbjct: 20683454 ggaggaggagaagagcaaga 20683473



to top

>gb|AC095380.1| Homo sapiens PCR product GAP1622 from Y, complete sequence
          Length = 45429

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 19290 gaagaaggaggaggaggagaagaaga 19265



to top

>emb|AL603782.5| Mouse DNA sequence from clone RP23-480M4 on chromosome 8, complete
              sequence
          Length = 175157

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 133409 gaagaaggaggaggaggagaagaaga 133384



to top

>gb|AC097474.3| Homo sapiens BAC clone RP11-93I21 from 4, complete sequence
          Length = 156568

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 117922 gaagaaggaggaggaggagaagaaga 117947



to top

>gb|AC100810.18| Homo sapiens chromosome 8, clone CTD-2336O2, complete sequence
          Length = 114639

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 17381 gaagaaggaggaggaggagaagaaga 17406



to top

>gb|AC154530.2| Mus musculus BAC clone RP23-467F17 from chromosome 16, complete
             sequence
          Length = 179995

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 43210 gaagaaggaggaggaggagaagaaga 43235



to top

>gb|AC153136.3| Mus musculus BAC clone RP24-191P11 from chromosome 10, complete
            sequence
          Length = 199200

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 2730 gaagaaggaggaggaggagaagaaga 2755



to top

>gb|AC009976.4|AC009976 Homo sapiens BAC clone RP11-509B6 from Y, complete sequence
          Length = 179060

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 1777 gaagaaggaggaggaggagaagaaga 1802



to top

>gb|AC019257.3| Homo sapiens chromosome 8, clone RP11-439C15, complete sequence
          Length = 220201

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 217960 gaagaaggaggaggaggagaagaaga 217985



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 217936 gaagaaggaggaggaggagaagaaga 217961



to top

>gb|AC068448.10| Homo sapiens chromosome 15, clone RP11-624A21, complete sequence
          Length = 165208

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 45120 gaagaaggaggcggaggagaagaaga 45145



to top

>gb|AC019159.8| Homo sapiens BAC clone RP11-56O18 from 2, complete sequence
          Length = 163085

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 82346 gaagaaggaggaggaggagaagaaga 82371



to top

>emb|BX682541.5| Mouse DNA sequence from clone RP23-349P20 on chromosome 2, complete
             sequence
          Length = 55982

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 55884 gaagaaggaggaggaggagaagaaga 55859



to top

>emb|BX813335.2| Mouse DNA sequence from clone RP24-375E5 on chromosome 2, complete
             sequence
          Length = 57516

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 31524 gaagaaggaggaggaggagaagaaga 31499



to top

>dbj|AP005385.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1791_B03
          Length = 166214

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 209    ggaggctggaggaggagaagag 230
              ||||||||||||||||||||||
Sbjct: 165042 ggaggctggaggaggagaagag 165021



to top

>dbj|AP004124.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1669_F01
          Length = 140019

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 209   ggaggctggaggaggagaagag 230
             ||||||||||||||||||||||
Sbjct: 40459 ggaggctggaggaggagaagag 40438



to top

>emb|AL731647.13| Mouse DNA sequence from clone RP23-226L1 on chromosome X, complete
            sequence
          Length = 185319

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 5218 gaagaaggaggaggaggagaagaaga 5243



to top

>emb|AL929537.17| Mouse DNA sequence from clone RP23-147E9 on chromosome 2, complete
             sequence
          Length = 93822

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 51482 gaagaaggaggaggaggagaagaaga 51507



to top

>dbj|AK073602.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033052I23, full
           insert sequence
          Length = 1136

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 209 ggaggctggaggaggagaagag 230
           ||||||||||||||||||||||
Sbjct: 530 ggaggctggaggaggagaagag 551



to top

>ref|NG_004636.1| Homo sapiens chromosome Y palindromes P4 and P5 (P4-P5@) on chromosome Y
          Length = 1351786

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 535194 gaagaaggaggaggaggagaagaaga 535169



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 338627 gaagaaggaggaggaggagaagaaga 338652



to top

>emb|AL391833.10| Human DNA sequence from clone RP11-307K1 on chromosome 6, complete
             sequence
          Length = 201512

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 21    tttctcttgcaacaagtcagta 42
             ||||||||||||||||||||||
Sbjct: 89845 tttctcttgcaacaagtcagta 89824



to top

>gb|AC140381.3| Mus musculus BAC clone RP23-176M4 from 10, complete sequence
          Length = 223470

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 140504 gaagaaggaggaggaggagaagaaga 140479



to top

>dbj|AK064340.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-H03, full
           insert sequence
          Length = 1467

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 209 ggaggctggaggaggagaagag 230
           ||||||||||||||||||||||
Sbjct: 859 ggaggctggaggaggagaagag 880



to top

>gb|AC156277.6| Mus musculus 6 BAC RP24-309B5 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 152539

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 36180 gaagaaggaggaggaggagaagaaga 36205



to top

>gb|AC153949.3| Mus musculus 10 BAC RP24-366H8 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 145982

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 121757 gaagaaggaggaggaggagaagaaga 121732



to top

>gb|AC151531.3| Mus musculus BAC clone RP24-387D22 from chromosome 7, complete sequence
          Length = 213801

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 200354 gaagaaggaggaggaggagaagaaga 200379



to top

>gb|AY610413.1| Sus scrofa clone rjej03b_a4.y1.abd, mRNA sequence
          Length = 703

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 305 aggaggtggaggagaagaagag 326
           ||||||||||||||||||||||
Sbjct: 11  aggaggtggaggagaagaagag 32



to top

>gb|AC110037.13| Mus musculus chromosome 5, clone RP23-257E17, complete sequence
          Length = 177428

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 144422 gaagaaggaggaggaggagaagaaga 144447



to top

>gb|AC121139.20| Mus musculus chromosome 5, clone RP23-429G1, complete sequence
          Length = 206249

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 157445 gaagaaggaggaggaggagaagaaga 157470



to top

>emb|CT010490.10| Mouse DNA sequence from clone RP23-148P12 on chromosome 16, complete
             sequence
          Length = 206348

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 72730 gaagaaggaggaggaggagaagaaga 72755



to top

>emb|AL844517.6| Mouse DNA sequence from clone RP23-453K8 on chromosome 2, complete
             sequence
          Length = 98792

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 90141 gaagaaggaggaggaggagaagaaga 90166



to top

>emb|CT025540.12| Mouse DNA sequence from clone RP24-280B23 on chromosome 12, complete
              sequence
          Length = 199060

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 302    agaaggaggtggaggagaagaagaga 327
              |||||||||||||||||||| |||||
Sbjct: 175811 agaaggaggtggaggagaaggagaga 175786



to top

>gb|AC132224.3| Mus musculus BAC clone RP24-554P12 from 1, complete sequence
          Length = 154996

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 22149 gaagaaggaggaggaggagaagaaga 22124



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 6912 gaagaaggaggaggaggagaagaaga 6937



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 300  gaagaaggaggtggaggagaagaag 324
            ||||||||||| |||||||||||||
Sbjct: 6894 gaagaaggaggaggaggagaagaag 6918



to top

>gb|AC133520.4| Mus musculus BAC clone RP23-185G9 from 8, complete sequence
          Length = 201054

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 2156 gaagaaggaggaggaggagaagaaga 2131



to top

>gb|AC132431.3| Mus musculus BAC clone RP23-211M23 from 6, complete sequence
          Length = 207155

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 297   gatgaagaaggaggtggaggagaagaagag 326
             |||||||||||||  |||||||||||||||
Sbjct: 32627 gatgaagaaggagaaggaggagaagaagag 32656



to top

>gb|AC145559.4| Mus musculus BAC clone RP23-371A1 from 5, complete sequence
          Length = 203726

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 202579 gaagaaggaggaggaggagaagaaga 202604



to top

>gb|AC125463.4| Mus musculus BAC clone RP23-106G8 from 8, complete sequence
          Length = 212677

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 4673 gaagaaggaggaggaggagaagaaga 4648



to top

>dbj|AP005202.3| Homo sapiens genomic DNA, chromosome 18 clone:CTD-2124B20, complete
             sequence
          Length = 136283

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 302   agaaggaggtggaggagaagaagagaggtg 331
             ||||||||| ||||||||||||||| ||||
Sbjct: 81624 agaaggaggaggaggagaagaagagtggtg 81653



to top

>gb|AC159126.4| Mus musculus chromosome 8, clone RP23-182M11, complete sequence
          Length = 238838

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 153248 gaagaaggaggaggaggagaagaaga 153273



to top

>gb|AC156836.6| Mus musculus BAC clone RP23-88L11 from chromosome 10, complete sequence
          Length = 255961

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 144301 gaagaaggaggaggaggagaagaaga 144326



to top

>emb|AL928662.5| Mouse DNA sequence from clone RP23-379M5 on chromosome 2, complete
            sequence
          Length = 116419

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 300  gaagaaggaggtggaggagaagaaga 325
            ||||||||||| ||||||||||||||
Sbjct: 1900 gaagaaggaggaggaggagaagaaga 1875



to top

>emb|AL713875.14| Mouse DNA sequence from clone RP23-17N7 on chromosome 11, complete
             sequence
          Length = 201123

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 15123 gaagaaggaggaggaggagaagaaga 15098



to top

>emb|AL607084.14| Mouse DNA sequence from clone RP23-272N19 on chromosome 4, complete
             sequence
          Length = 113877

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 73101 gaagaaggaggaggaggagaagaaga 73076



to top

>emb|AL807764.9| Mouse DNA sequence from clone RP23-400F8 on chromosome 4, complete
             sequence
          Length = 226637

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 63825 gaagaaggaggaggaggagaagaaga 63850



to top

>gb|AC122116.9| Mus musculus chromosome 7, clone RP23-449M8, complete sequence
          Length = 173990

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 27533 gaagaaggaggaggaggagaagaaga 27508



to top

>gb|AC109618.12| Mus musculus chromosome 8, clone RP23-478L3, complete sequence
          Length = 173511

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 101144 gaagaaggaggaggaggagaagaaga 101169



to top

>gb|AC119202.6| Mus musculus chromosome 8, clone RP24-185N3, complete sequence
          Length = 159765

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 72612 gaagaaggaggaggaggagaagaaga 72637



to top

>emb|AL670246.13| Mouse DNA sequence from clone RP23-2O18 on chromosome 4, complete
             sequence
          Length = 182187

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 90722 gaagaaggaggaggaggagaagaaga 90697



to top

>emb|AL606969.26| Mouse DNA sequence from clone RP23-331P21 on chromosome 4, complete
             sequence
          Length = 224344

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 300   gaagaaggaggtggaggagaagaaga 325
             ||||||||||| ||||||||||||||
Sbjct: 92153 gaagaaggaggaggaggagaagaaga 92128



to top

>emb|AL731735.14| Mouse DNA sequence from clone RP23-139P21 on chromosome X, complete
              sequence
          Length = 201223

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 300    gaagaaggaggtggaggagaagaaga 325
              ||||||||||| ||||||||||||||
Sbjct: 104449 gaagaaggaggaggaggagaagaaga 104474



to top

>gb|AC123656.9| Mus musculus chromosome 15, clone RP23-188M21, complete sequence
          Length = 200922

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 300  gaagaaggaggtggaggagaagaagagag 328
            |||| |||||| |||||||||||||||||
Sbjct: 4448 gaaggaggaggaggaggagaagaagagag 4476



to top

>gb|AC138355.17| Mus musculus chromosome 8, clone RP24-281G1, complete sequence
          Length = 154808

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 141841 gaagaaggaggaggaggagaagaag 141817



to top

>ref|XM_550352.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2039

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 305 aggaggtggaggagaagaagagagg 329
           |||||||||||||||||| ||||||
Sbjct: 50  aggaggtggaggagaagaggagagg 26



to top

>gb|AC154520.3| Mus musculus BAC clone RP23-471P16 from chromosome 14, complete sequence
          Length = 199186

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 297    gatgaagaaggaggtggaggagaagaaga 325
              |||||||||||||| ||||||| ||||||
Sbjct: 177445 gatgaagaaggaggaggaggaggagaaga 177473



to top

>gb|AC168217.2| Mus musculus BAC clone RP24-498P8 from chromosome 9, complete sequence
          Length = 171426

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 139543 gaagaaggaggaggaggagaagaag 139519



to top

>ref|XM_464727.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1846

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 304 aaggaggtggaggagaagaagagag 328
           ||||||| |||||||||||||||||
Sbjct: 52  aaggaggaggaggagaagaagagag 28



to top

>gb|AC138204.7| Mus musculus chromosome 3, clone RP23-381G8, complete sequence
          Length = 173792

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 301    aagaaggaggtggaggagaag 321
              |||||||||||||||||||||
Sbjct: 125221 aagaaggaggtggaggagaag 125201



to top

>gb|U65590.1|HSU65590 Homo sapiens IL-1 receptor antagonist IL-1Ra (IL-1RN) gene,
             alternatively spliced forms, complete cds
          Length = 33414

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 298   atgaagaaggaggtggaggag 318
             |||||||||||||||||||||
Sbjct: 18255 atgaagaaggaggtggaggag 18275



to top

>gb|AC161416.2| Mus musculus BAC clone RP23-306A2 from chromosome 1, complete sequence
          Length = 196764

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||| |||||||||||||
Sbjct: 12912 gaagaaggaggaggaggagaagaag 12888



to top

>gb|AC161375.4| Mus musculus BAC clone RP23-297A22 from chromosome 14, complete
             sequence
          Length = 211662

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 301   aagaaggaggtggaggagaagaaga 325
             |||||||||| ||||||||||||||
Sbjct: 52323 aagaaggagggggaggagaagaaga 52299



to top

>gb|AC161260.2| Mus musculus BAC clone RP23-448A11 from chromosome 9, complete sequence
          Length = 190608

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 123254 gaagaaggaggaggaggagaagaag 123278



to top

>gb|AC136645.2| Rattus norvegicus 7 BAC CH230-156H17 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 204000

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 155252 gaagaaggaggaggaggagaagaag 155228



to top

>gb|AC097023.6| Rattus norvegicus BAC CH230-35L12 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 228433

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 162207 gaagaaggaggaggaggagaagaag 162183



to top

>ref|NM_173841.1| Homo sapiens interleukin 1 receptor antagonist (IL1RN), transcript
           variant 2, mRNA
          Length = 1865

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 atgaagaaggaggtggaggag 318
           |||||||||||||||||||||
Sbjct: 146 atgaagaaggaggtggaggag 166



to top

>gb|AC115924.11| Mus musculus chromosome 15, clone RP24-511O11, complete sequence
          Length = 166860

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 300   gaagaaggaggtggaggagaagaagagag 328
             |||| |||||| |||||||||||||||||
Sbjct: 59560 gaaggaggaggaggaggagaagaagagag 59532



to top

>gb|AC140303.3| Mus musculus BAC clone RP23-381H21 from chromosome 3, complete sequence
          Length = 192020

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 301   aagaaggaggtggaggagaagaaga 325
             |||||||||| ||||||||||||||
Sbjct: 69213 aagaaggaggaggaggagaagaaga 69237



to top

>gb|AC183296.3| Pan troglodytes BAC clone CH251-352A17 from chromosome 19, complete
             sequence
          Length = 180482

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||||||||||| |||||
Sbjct: 28012 gaagaaggaggtggaggaggagaag 28036



to top

>gb|BC068441.1| Homo sapiens interleukin 1 receptor antagonist, mRNA (cDNA clone
           IMAGE:5270437), partial cds
          Length = 2148

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 atgaagaaggaggtggaggag 318
           |||||||||||||||||||||
Sbjct: 439 atgaagaaggaggtggaggag 459



to top

>gb|AC141888.4| Mus musculus BAC clone RP23-462H3 from chromosome 19, complete sequence
          Length = 185192

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 302   agaaggaggtggaggagaagaagag 326
             ||||||||| |||||||||||||||
Sbjct: 15534 agaaggaggaggaggagaagaagag 15510



to top

>gb|AC140927.2| Mus musculus BAC clone RP23-409D19 from chromosome 5, complete sequence
          Length = 209257

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 300    gaagaaggaggtggaggagaa 320
              |||||||||||||||||||||
Sbjct: 162842 gaagaaggaggtggaggagaa 162822



to top

>gb|AC091458.5| Mus musculus chromosome 12, clone RP23-68M8, complete sequence
          Length = 289751

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 141142 gaagaaggaggaggaggagaagaag 141166



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 140950 gaagaaggaggaggaggagaagaag 140974



to top

>gb|AY392150.1| Schistosoma haematobium nicotinic acetylcholine receptor alpha
            subunit precursor, mRNA, complete cds
          Length = 2237

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 301  aagaaggaggtggaggagaagaaga 325
            |||||||||| ||||||||||||||
Sbjct: 1323 aagaaggaggaggaggagaagaaga 1347



to top

>gb|AC036145.11| Mus musculus chromosome 5, clone RP23-439C22, complete sequence
          Length = 182228

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 114890 gaagaaggaggaggaggagaagaag 114914



to top

>gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, complete sequence
          Length = 190888

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||| |||||||||||||
Sbjct: 65076 gaagaaggaggaggaggagaagaag 65052



to top

>ref|XM_001002052.1| PREDICTED: Mus musculus gamma-aminobutyric acid (GABA-A) receptor,
            subunit alpha 2, transcript variant 3 (Gabra2), mRNA
          Length = 2730

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 300  gaagaaggaggtggaggagaagaag 324
            ||||||||||| |||||||||||||
Sbjct: 2595 gaagaaggaggaggaggagaagaag 2619



to top

>ref|XM_001002044.1| PREDICTED: Mus musculus gamma-aminobutyric acid (GABA-A) receptor,
            subunit alpha 2, transcript variant 2 (Gabra2), mRNA
          Length = 2323

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 300  gaagaaggaggtggaggagaagaag 324
            ||||||||||| |||||||||||||
Sbjct: 2188 gaagaaggaggaggaggagaagaag 2212



to top

>gb|AC147052.2| Pan troglodytes BAC clone RP43-143G1 from 7, complete sequence
          Length = 170236

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 301    aagaaggaggtggaggagaagaaga 325
              |||||||||| ||||||||||||||
Sbjct: 118243 aagaaggaggaggaggagaagaaga 118267



to top

>emb|CT009519.4| Mouse DNA sequence from clone RP23-145L1 on chromosome 14, complete
              sequence
          Length = 216678

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 297    gatgaagaaggaggtggaggagaagaaga 325
              |||||||||||||| ||||||| ||||||
Sbjct: 183535 gatgaagaaggaggaggaggaggagaaga 183507



to top

>gb|AC127690.4| Mus musculus BAC clone RP24-215A3 from chromosome 17, complete sequence
          Length = 187751

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 305    aggaggtggaggagaagaagagagg 329
              |||||| ||||||||||||||||||
Sbjct: 121339 aggaggaggaggagaagaagagagg 121315



to top

>gb|AC122015.3| Mus musculus BAC clone RP24-358M18 from chromosome 6, complete sequence
          Length = 166966

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 302    agaaggaggtggaggagaagaagag 326
              ||||||||| |||||||||||||||
Sbjct: 150557 agaaggaggaggaggagaagaagag 150533



to top

>gb|AC132251.3| Mus musculus BAC clone RP24-447I16 from chromosome 19, complete sequence
          Length = 187534

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 302    agaaggaggtggaggagaagaagag 326
              ||||||||| |||||||||||||||
Sbjct: 140253 agaaggaggaggaggagaagaagag 140229



to top

>gb|AC131794.3| Mus musculus BAC clone RP24-486P14 from chromosome 9, complete sequence
          Length = 166272

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||||||||||| |||||
Sbjct: 49970 gaagaaggaggtggaggaggagaag 49946



to top

>gb|AC140053.4| Mus musculus BAC clone RP23-258J2 from chromosome 19, complete sequence
          Length = 186595

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 107340 gaagaaggaggaggaggagaagaag 107316



to top

>gb|AC111008.6| Mus musculus BAC clone RP23-415J21 from chromosome 7, complete sequence
          Length = 193593

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 100829 gaagaaggaggaggaggagaagaag 100853



to top

>gb|AC125093.4| Mus musculus BAC clone RP24-176F8 from chromosome 19, complete sequence
          Length = 158027

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 144630 gaagaaggaggaggaggagaagaag 144606



to top

>ref|XM_537420.2| PREDICTED: Canis familiaris similar to melanoma inhibitory activity 2
            (LOC480297), mRNA
          Length = 1893

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 299  tgaagaaggaggtggaggaga 319
            |||||||||||||||||||||
Sbjct: 1209 tgaagaaggaggtggaggaga 1229



to top

>gb|AC122840.3| Mus musculus BAC clone RP23-193M8 from 13, complete sequence
          Length = 216326

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 302   agaaggaggtggaggagaagaagag 326
             ||||||||| |||||||||||||||
Sbjct: 56739 agaaggaggaggaggagaagaagag 56715



to top

>gb|AC122280.4| Mus musculus BAC clone RP23-239I12 from 17, complete sequence
          Length = 238767

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 130174 gaagaaggaggaggaggagaagaag 130150



to top

>gb|AC112144.4| Mus musculus BAC clone RP23-32B4 from 19, complete sequence
          Length = 216521

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 190965 gaagaaggaggaggaggagaagaag 190989



to top

>gb|AC124169.3| Mus musculus BAC clone RP23-151G15 from 19, complete sequence
          Length = 201188

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||| |||||||||||||
Sbjct: 37272 gaagaaggaggaggaggagaagaag 37248



to top

>gb|AC119996.7| Mus musculus chromosome 19, clone RP24-120D1, complete sequence
          Length = 172160

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 302    agaaggaggtggaggagaagaagag 326
              ||||||||| |||||||||||||||
Sbjct: 109301 agaaggaggaggaggagaagaagag 109277



to top

>gb|AC146125.2| Pan troglodytes BAC clone RP43-4K13 from 7, complete sequence
          Length = 172424

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 301   aagaaggaggtggaggagaagaaga 325
             |||||||||| ||||||||||||||
Sbjct: 77908 aagaaggaggaggaggagaagaaga 77932



to top

>gb|AC159149.10| Mus musculus 10 BAC RP23-56F17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 219585

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 301   aagaaggaggtggaggagaagaaga 325
             |||||||||| ||||||||||||||
Sbjct: 81731 aagaaggaggaggaggagaagaaga 81707



to top

>emb|AL590434.16| Human DNA sequence from clone RP11-181E22 on chromosome 1 Contains the 3'
              end of the gene for a novel protein, a novel pseudogene,
              the SFPQ gene for splicing factor proline/glutamine rich
              (polypyrimidine tract binding protein associated), the 5'
              end of the ZNF262 gene for zinc finger protein 262 and a
              CpG island, complete sequence
          Length = 185909

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 147240 gaagaaggaggaggaggagaagaag 147216



to top

>emb|AL354680.14| Human DNA sequence from clone RP11-536F8 on chromosome 6p23-24.3 Contains
              part of gene KIAA1733 and a CpG island, complete sequence
          Length = 194845

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 302    agaaggaggtggaggagaagaagag 326
              ||||||||| |||||||||||||||
Sbjct: 144984 agaaggaggaggaggagaagaagag 144960



to top

>emb|AL136171.17| Human DNA sequence from clone RP4-584N17 on chromosome 1q42.2-43
             Contains part of the DISC1 gene for disrupted in
             schizophrenia 1, complete sequence
          Length = 133968

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 301   aagaaggaggtggaggagaagaaga 325
             |||||||||| ||||||||||||||
Sbjct: 11857 aagaaggaggaggaggagaagaaga 11881



to top

>gb|AY263168.1| Takifugu rubripes Tmc2-related protein 2 mRNA, partial cds
          Length = 1977

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 305 aggaggtggaggagaagaaga 325
           |||||||||||||||||||||
Sbjct: 50  aggaggtggaggagaagaaga 70



to top

>gb|AC105586.5| Rattus norvegicus 3 BAC CH230-239D4 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 235468

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 145055 gaagaaggagggggaggagaagaag 145079



to top

>gb|AC119275.12| Mus musculus chromosome 8, clone RP24-459A4, complete sequence
          Length = 203937

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 300    gaagaaggaggtggaggagaagaagagag 328
              ||||||||||| |||||||||| ||||||
Sbjct: 144070 gaagaaggaggaggaggagaaggagagag 144042



to top

>gb|AC159194.3| Mus musculus BAC clone RP23-469D18 from chromosome 7, complete sequence
          Length = 213870

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 157688 gaagaaggaggaggaggagaagaag 157712



to top

>emb|AL596110.15| Mouse DNA sequence from clone RP23-330N10 on chromosome 11 Contains the
              3' end of a variant of the gene for a novel protein similar
              to human sperm antigen HCMOGT-1 (B230396K10Rik), the
              Adora2b gene for adenosine A2b receptor, the gene for a
              novel protein (2410012H22Rik), a somatic cytochrome c
              (Cycs) pseudogene, a novel gene, a novel pseudogene, the
              gene for a novel protein (2810460C24Rik), the 3' end of the
              Ncor1 gene for nuclear receptor co-repressor 1 and two CpG
              islands, complete sequence
          Length = 214834

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 297    gatgaagaaggaggtggaggagaag 321
              |||||||||||||| ||||||||||
Sbjct: 169674 gatgaagaaggaggaggaggagaag 169698



to top

>gb|AC153012.4| Mus musculus BAC clone RP23-302F19 from chromosome 9, complete sequence
          Length = 196764

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||||||||||| |||||
Sbjct: 18735 gaagaaggaggtggaggaggagaag 18711



to top

>emb|AL645611.9| Mouse DNA sequence from clone RP23-432O24 on chromosome 11 Contains
             part of the Adamts2 gene for a disintegrin-like and
             metalloprotease (reprolysin type) with thrombospondin type
             1 motif 2, complete sequence
          Length = 69492

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 299   tgaagaaggaggtggaggagaagaagaga 327
             |||||||||||| ||||||||||| ||||
Sbjct: 28871 tgaagaaggaggaggaggagaagaggaga 28899



to top

>emb|AL669968.10| Mouse DNA sequence from clone RP23-475F22 on chromosome 11 Contains a
             glyceraldehyde-3-phosphate dehydrogenase (Gapd)
             pseudogene, complete sequence
          Length = 167170

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 302   agaaggaggtggaggagaagaagag 326
             ||||||||| |||||||||||||||
Sbjct: 87491 agaaggaggaggaggagaagaagag 87467



to top

>gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, complete sequence
          Length = 202719

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||| |||||||||||||
Sbjct: 10357 gaagaaggaggaggaggagaagaag 10333



to top

>emb|AL844601.4| Mouse DNA sequence from clone RP23-245J22 on chromosome 4, complete
              sequence
          Length = 166294

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 302    agaaggaggtggaggagaagaagag 326
              ||||||||| |||||||||||||||
Sbjct: 160357 agaaggaggaggaggagaagaagag 160333



to top

>gb|AC161503.4| Mus musculus chromosome 8, clone RP23-81C3, complete sequence
          Length = 180580

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 300    gaagaaggaggtggaggagaagaag 324
              ||||||||||| |||||||||||||
Sbjct: 101528 gaagaaggaggaggaggagaagaag 101504



to top

>gb|AC011195.14| Homo sapiens chromosome 17, clone CTD-2200P10, complete sequence
          Length = 152574

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||| |||||||||||||
Sbjct: 93827 gaagaaggaggaggaggagaagaag 93803



to top

>gb|AC100183.11| Mus musculus chromosome 3, clone RP23-54L16, complete sequence
          Length = 231917

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 301    aagaaggaggtggaggagaag 321
              |||||||||||||||||||||
Sbjct: 113074 aagaaggaggtggaggagaag 113094



to top

>gb|AC158757.6| Mus musculus chromosome 5, clone RP23-64D3, complete sequence
          Length = 247058

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 302   agaaggaggtggaggagaagaagag 326
             ||||||||| |||||||||||||||
Sbjct: 10939 agaaggaggaggaggagaagaagag 10915



to top

>gb|AC087763.10| Homo sapiens chromosome 8, clone RP11-62H7, complete sequence
          Length = 98494

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 301   aagaaggaggtggaggagaagaaga 325
             |||||||||| ||||||||||||||
Sbjct: 42976 aagaaggaggaggaggagaagaaga 42952



to top

>gb|AC120104.4| Homo sapiens 12 BAC RP11-638F21 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 110001

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 301   aagaaggaggtggaggagaagaaga 325
             |||||||||| ||||||||||||||
Sbjct: 89666 aagaaggaggaggaggagaagaaga 89690



to top

>gb|AC106740.3| Homo sapiens chromosome 5 clone RP11-100E22, complete sequence
          Length = 155443

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 301   aagaaggaggtggaggagaagaaga 325
             |||||||||| ||||||||||||||
Sbjct: 63066 aagaaggaggaggaggagaagaaga 63042



to top

>gb|AC019084.9| Homo sapiens BAC clone RP11-354O2 from 7, complete sequence
          Length = 201215

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||| |||||||||||||
Sbjct: 85202 gaagaaggaggaggaggagaagaag 85178



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 302   agaaggaggtggaggagaagaaga 325
             ||||||||| ||||||||||||||
Sbjct: 85361 agaaggaggaggaggagaagaaga 85338



to top

>ref|XM_686676.1| PREDICTED: Danio rerio similar to LOC496799 protein (LOC563309),
           mRNA
          Length = 1059

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 303 gaaggaggtggaggagaagaagaga 327
           |||||||| ||||||||||||||||
Sbjct: 789 gaaggaggaggaggagaagaagaga 813



to top

>emb|BX470167.7| Zebrafish DNA sequence from clone DKEYP-86G2 in linkage group 5,
             complete sequence
          Length = 189590

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 297   gatgaagaaggaggtggagga 317
             |||||||||||||||||||||
Sbjct: 35122 gatgaagaaggaggtggagga 35142



to top

>gb|AC159320.3| Mus musculus BAC clone RP23-51A12 from chromosome 14, complete sequence
          Length = 255936

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 301   aagaaggaggtggaggagaagaaga 325
             |||||||||| ||||||||||||||
Sbjct: 45574 aagaaggagggggaggagaagaaga 45598



to top

>dbj|AK048165.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130038H23 product:gamma-aminobutyric acid
            (GABA-A) receptor, subunit alpha 2, full insert sequence
          Length = 3806

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 300  gaagaaggaggtggaggagaagaag 324
            ||||||||||| |||||||||||||
Sbjct: 2359 gaagaaggaggaggaggagaagaag 2383



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 305      aggaggtggaggagaagaagagagg 329
                ||||||||||||||| |||||||||
Sbjct: 15913359 aggaggtggaggagaggaagagagg 15913335



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 305     aggaggtggaggagaagaagagagg 329
               |||||||||||||||||| ||||||
Sbjct: 3198416 aggaggtggaggagaagaggagagg 3198392



to top

>gb|AC079181.3|AC079181 Mus musculus strain C57BL/6J chromosome 12 clone RP23-197F8, complete
             sequence
          Length = 209058

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 300   gaagaaggaggtggaggagaagaag 324
             ||||||||||| |||||||||||||
Sbjct: 89635 gaagaaggaggaggaggagaagaag 89611


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,312,108
Number of Sequences: 3902068
Number of extensions: 4312108
Number of successful extensions: 144585
Number of sequences better than 10.0: 601
Number of HSP's better than 10.0 without gapping: 606
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 140536
Number of HSP's gapped (non-prelim): 4033
length of query: 456
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 434
effective length of database: 17,147,199,772
effective search space: 7441884701048
effective search space used: 7441884701048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top