ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart52g02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_473308.1| Oryza sativa (japonica cultivar-group), predic... 78 2e-11
2emb|AL662998.4|OSJN00196 Oryza sativa genomic DNA, chromosome 4,... 78 2e-11
3dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 78 2e-11
4dbj|AK105805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 2e-11
5emb|CR388416.6| Zebrafish DNA sequence from clone DKEY-165B20 in... 42 1.3
6emb|CR847504.13| Zebrafish DNA sequence from clone DKEYP-51G9 in... 42 1.3
7gb|BC055711.1| Mus musculus calponin 3, acidic, mRNA (cDNA clone... 40 5.1
8gb|AC146263.2| Pan troglodytes BAC clone RP43-28O1 from 7, compl... 40 5.1
9ref|NM_028044.1| Mus musculus calponin 3, acidic (Cnn3), mRNA 40 5.1
10gb|AC105336.14| Mus musculus chromosome 3, clone RP24-277J22, co... 40 5.1
11emb|BX842649.1| Bdellovibrio bacteriovorus complete genome, stra... 40 5.1
12gb|AC152414.7| Mus musculus BAC clone RP23-358O14 from chromosom... 40 5.1
13dbj|AK138897.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu... 40 5.1
14dbj|AK159871.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 40 5.1
15dbj|AK167613.1| Mus musculus 14 days pregnant adult female place... 40 5.1
16dbj|AK166578.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN fu... 40 5.1
17dbj|AK159555.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 40 5.1
18dbj|AK169410.1| Mus musculus cDNA, RIKEN full-length enriched li... 40 5.1
19dbj|AK167201.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 40 5.1
20dbj|AK169098.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 40 5.1
21dbj|AK169021.1| Mus musculus 17 days pregnant adult female amnio... 40 5.1
22dbj|AK081672.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 40 5.1
23dbj|AK051628.1| Mus musculus 12 days embryo spinal ganglion cDNA... 40 5.1
24dbj|AK051121.1| Mus musculus 9 days embryo whole body cDNA, RIKE... 40 5.1
25dbj|AK005460.1| Mus musculus adult female placenta cDNA, RIKEN f... 40 5.1
26gb|AC066611.6|AC066611 Homo sapiens chromosome 15 clone RP11-348... 40 5.1
27dbj|AP002052.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 5.1
28emb|BX276097.12| Zebrafish DNA sequence from clone DKEY-97C6 in ... 40 5.1
29emb|AL845267.2| Mouse DNA sequence from clone RP23-426D2 on chro... 40 5.1 
>ref|XM_473308.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1536

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 283 ggccattttaaaaacattgcattgcgatgcactaagaatttgccttgggaggcctctctt 342
           ||||||||| |||| ||||  |||||||||||| | |||||| ||||||||||||| |||
Sbjct: 124 ggccattttgaaaatattgtcttgcgatgcactcaaaatttgtcttgggaggcctccctt 183

                                              
Query: 343 ccgtatgcttctgcagaggacgatgccagcattat 377
           || ||||| |||||||| || | ||||| ||||||
Sbjct: 184 ccatatgcctctgcagaagatggtgccaacattat 218
to top
>emb|AL662998.4|OSJN00196 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0020O11,
             complete sequence
          Length = 113677

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                         
Query: 283   ggccattttaaaaacattgcattgcgatgcactaagaatttgccttgggaggcctctctt 342
             ||||||||| |||| ||||  |||||||||||| | |||||| ||||||||||||| |||
Sbjct: 92206 ggccattttgaaaatattgtcttgcgatgcactcaaaatttgtcttgggaggcctccctt 92265

                                                
Query: 343   ccgtatgcttctgcagaggacgatgccagcattat 377
             || ||||| |||||||| || | ||||| ||||||
Sbjct: 92266 ccatatgcctctgcagaagatggtgccaacattat 92300



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                         
Query: 157   tcctgtaccatggcttctttgctttggtcacagataaaactaaacagagcatatgttagg 216
             |||||||||||||| |||||  |||| |||||||||||| ||| || |||| || |||||
Sbjct: 92074 tcctgtaccatggcctctttaatttgttcacagataaaattaagcaaagcacatattagg 92133

              
Query: 217   a 217
             |
Sbjct: 92134 a 92134
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Minus

                                                                            
Query: 283      ggccattttaaaaacattgcattgcgatgcactaagaatttgccttgggaggcctctctt 342
                ||||||||| |||| ||||  |||||||||||| | |||||| ||||||||||||| |||
Sbjct: 26690989 ggccattttgaaaatattgtcttgcgatgcactcaaaatttgtcttgggaggcctccctt 26690930

                                                   
Query: 343      ccgtatgcttctgcagaggacgatgccagcattat 377
                || ||||| |||||||| || | ||||| ||||||
Sbjct: 26690929 ccatatgcctctgcagaagatggtgccaacattat 26690895



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                            
Query: 157      tcctgtaccatggcttctttgctttggtcacagataaaactaaacagagcatatgttagg 216
                |||||||||||||| |||||  |||| |||||||||||| ||| || |||| || |||||
Sbjct: 26691121 tcctgtaccatggcctctttaatttgttcacagataaaattaagcaaagcacatattagg 26691062

                 
Query: 217      a 217
                |
Sbjct: 26691061 a 26691061
to top
>dbj|AK105805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-B06, full
           insert sequence
          Length = 1350

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 283 ggccattttaaaaacattgcattgcgatgcactaagaatttgccttgggaggcctctctt 342
           ||||||||| |||| ||||  |||||||||||| | |||||| ||||||||||||| |||
Sbjct: 236 ggccattttgaaaatattgtcttgcgatgcactcaaaatttgtcttgggaggcctccctt 295

                                              
Query: 343 ccgtatgcttctgcagaggacgatgccagcattat 377
           || ||||| |||||||| || | ||||| ||||||
Sbjct: 296 ccatatgcctctgcagaagatggtgccaacattat 330



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 157 tcctgtaccatggcttctttgctttggtcacagataaaactaaacagagcatatgttagg 216
           |||||||||||||| |||||  |||| |||||||||||| ||| || |||| || |||||
Sbjct: 104 tcctgtaccatggcctctttaatttgttcacagataaaattaagcaaagcacatattagg 163

            
Query: 217 a 217
           |
Sbjct: 164 a 164
to top
>emb|CR388416.6| Zebrafish DNA sequence from clone DKEY-165B20 in linkage group 14,
           complete sequence
          Length = 207245

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 tcacagataaaactaaacaga 204
           |||||||||||||||||||||
Sbjct: 778 tcacagataaaactaaacaga 798
to top
>emb|CR847504.13| Zebrafish DNA sequence from clone DKEYP-51G9 in linkage group 4, complete
              sequence
          Length = 138906

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 184    tcacagataaaactaaacaga 204
              |||||||||||||||||||||
Sbjct: 125416 tcacagataaaactaaacaga 125436
to top
>gb|BC055711.1| Mus musculus calponin 3, acidic, mRNA (cDNA clone MGC:66767
           IMAGE:6415164), complete cds
          Length = 2036

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 152 ccgcgcggccgccgctgggg 171
to top
>gb|AC146263.2| Pan troglodytes BAC clone RP43-28O1 from 7, complete sequence
          Length = 141252

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 86     cttcctcaccccccgaggag 105
              ||||||||||||||||||||
Sbjct: 103931 cttcctcaccccccgaggag 103950
to top
>ref|NM_028044.1| Mus musculus calponin 3, acidic (Cnn3), mRNA
          Length = 2005

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 153 ccgcgcggccgccgctgggg 172
to top
>gb|AC105336.14| Mus musculus chromosome 3, clone RP24-277J22, complete sequence
          Length = 176399

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     ccgcgcggccgccgctgggg 61
              ||||||||||||||||||||
Sbjct: 119816 ccgcgcggccgccgctgggg 119835
to top
>emb|BX842649.1| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 4/11
          Length = 349697

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 163    accatggcttctttgctttg 182
              ||||||||||||||||||||
Sbjct: 312635 accatggcttctttgctttg 312616
to top
>gb|AC152414.7| Mus musculus BAC clone RP23-358O14 from chromosome 10, complete sequence
          Length = 230322

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 170    cttctttgctttggtcacag 189
              ||||||||||||||||||||
Sbjct: 125514 cttctttgctttggtcacag 125533
to top
>dbj|AK138897.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A430107D08 product:unclassifiable, full
           insert sequence
          Length = 3341

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 885 ccgcgcggccgccgctgggg 866
to top
>dbj|AK159871.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420036B13 product:calponin 3, acidic,
           full insert sequence
          Length = 1776

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 169 ccgcgcggccgccgctgggg 188
to top
>dbj|AK167613.1| Mus musculus 14 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530025C21
           product:calponin 3, acidic, full insert sequence
          Length = 2018

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 169 ccgcgcggccgccgctgggg 188
to top
>dbj|AK166578.1| Mus musculus 1 cell embryo 1 cell cDNA, RIKEN full-length enriched
           library, clone:I0C0030O09 product:calponin 3, acidic,
           full insert sequence
          Length = 1755

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 159 ccgcgcggccgccgctgggg 178
to top
>dbj|AK159555.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420023M07 product:calponin 3, acidic,
           full insert sequence
          Length = 2047

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 184 ccgcgcggccgccgctgggg 203
to top
>dbj|AK169410.1| Mus musculus cDNA, RIKEN full-length enriched library,
           clone:I920195H02 product:calponin 3, acidic, full insert
           sequence
          Length = 1973

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 126 ccgcgcggccgccgctgggg 145
to top
>dbj|AK167201.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0038M14 product:calponin 3, acidic,
           full insert sequence
          Length = 1769

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 172 ccgcgcggccgccgctgggg 191
to top
>dbj|AK169098.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I920079O10 product:calponin 3, acidic,
           full insert sequence
          Length = 2042

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 196 ccgcgcggccgccgctgggg 215
to top
>dbj|AK169021.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920075F08
           product:calponin 3, acidic, full insert sequence
          Length = 1772

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 176 ccgcgcggccgccgctgggg 195
to top
>dbj|AK081672.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
          library, clone:C130064P20 product:calponin 3, acidic,
          full insert sequence
          Length = 1912

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 42 ccgcgcggccgccgctgggg 61
          ||||||||||||||||||||
Sbjct: 67 ccgcgcggccgccgctgggg 86
to top
>dbj|AK051628.1| Mus musculus 12 days embryo spinal ganglion cDNA, RIKEN full-length
           enriched library, clone:D130061A04 product:calponin 3,
           acidic, full insert sequence
          Length = 1761

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 169 ccgcgcggccgccgctgggg 188
to top
>dbj|AK051121.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:D030074O03 product:calponin 3,
           acidic, full insert sequence
          Length = 2216

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 148 ccgcgcggccgccgctgggg 167
to top
>dbj|AK005460.1| Mus musculus adult female placenta cDNA, RIKEN full-length enriched
           library, clone:1600014M03 product:calponin 3, acidic,
           full insert sequence
          Length = 2005

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ccgcgcggccgccgctgggg 61
           ||||||||||||||||||||
Sbjct: 153 ccgcgcggccgccgctgggg 172
to top
>gb|AC066611.6|AC066611 Homo sapiens chromosome 15 clone RP11-348P16 map 15q21.3, complete
              sequence
          Length = 184355

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 79     tcggaggcttcctcaccccccgag 102
              |||||||||||||||| |||||||
Sbjct: 148493 tcggaggcttcctcactccccgag 148516
to top
>dbj|AP002052.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: T13J10
          Length = 46739

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 171  ttctttgctttggtcacagataaa 194
            |||||||||||||||||| |||||
Sbjct: 1211 ttctttgctttggtcacaaataaa 1234
to top
>emb|BX276097.12| Zebrafish DNA sequence from clone DKEY-97C6 in linkage group 20,
             complete sequence
          Length = 128871

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   ccattttaaaaacattgcat 304
             ||||||||||||||||||||
Sbjct: 53212 ccattttaaaaacattgcat 53231
to top
>emb|AL845267.2| Mouse DNA sequence from clone RP23-426D2 on chromosome 2, complete
             sequence
          Length = 216597

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 281   caggccattttaaaaacatt 300
             ||||||||||||||||||||
Sbjct: 25002 caggccattttaaaaacatt 25021


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,343,071
Number of Sequences: 3902068
Number of extensions: 3343071
Number of successful extensions: 64199
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64140
Number of HSP's gapped (non-prelim): 59
length of query: 379
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 357
effective length of database: 17,147,199,772
effective search space: 6121550318604
effective search space used: 6121550318604
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top