ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart52b04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|S72926.1|S72926 Hordeum vulgare glucose and ribitol dehydrogenase homolog mRNA, complete cds Length = 1170 Score = 539 bits (272), Expect = e-150 Identities = 279/280 (99%), Gaps = 1/280 (0%) Strand = Plus / Plus Query: 128 gtcgtcgccaagagcaccgcccgctcgccgggggaccagagcaatggcgtcgcagaagtt 187 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 gtcgtcgccaagagcaccgcccgctcgccgggggaccagagcaatggcgtcgcagaagtt 60 Query: 188 cccgccgcagcagcaggactgccagcccggcaaggagcacgccatggacccccgccccga 247 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 61 cccgccgcagcagcaggactgccagcccggcaaggagcacgccatggacccccgccccga 120 Query: 248 ggccatcatcaagaactacaagtc-ggccaacaagctccagggcaaggtggcgctggtga 306 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 121 ggccatcatcaagaactacaagtcgggccaacaagctccagggcaaggtggcgctggtga 180 Query: 307 ccggcggcgactcgggcatcgggcgcgcggtgtgcctgtgcctcgcgctggagggcgcga 366 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 ccggcggcgactcgggcatcgggcgcgcggtgtgcctgtgcctcgcgctggagggcgcga 240 Query: 367 cggtgaacttcacgtacgtgaaggggcacgaggacaagga 406 |||||||||||||||||||||||||||||||||||||||| Sbjct: 241 cggtgaacttcacgtacgtgaaggggcacgaggacaagga 280
>dbj|AK110652.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-169-E03, full insert sequence Length = 1376 Score = 254 bits (128), Expect = 2e-64 Identities = 209/236 (88%) Strand = Plus / Plus Query: 171 atggcgtcgcagaagttcccgccgcagcagcaggactgccagcccggcaaggagcacgcc 230 |||||||||||| |||||||||||||| | ||||| ||||| || |||||||||||| Sbjct: 229 atggcgtcgcagcagttcccgccgcagaatcaggagacgcagccggggaaggagcacgcc 288 Query: 231 atggacccccgccccgaggccatcatcaagaactacaagtcggccaacaagctccagggc 290 ||||| ||||||||||||||||||||| ||| ||||||| | ||||||||||| ||| | Sbjct: 289 atggatccccgccccgaggccatcatccagagctacaagccagccaacaagctgaaggac 348 Query: 291 aaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggtgtgcctgtgcctc 350 ||||||||| | ||||||||||||||||| ||||||||||| ||||||||||||||| || Sbjct: 349 aaggtggcgatcgtgaccggcggcgactccggcatcgggcgggcggtgtgcctgtgcttc 408 Query: 351 gcgctggagggcgcgacggtgaacttcacgtacgtgaaggggcacgaggacaagga 406 ||||||||||||||||||||| |||||||||||||||||||| ||||| ||||| Sbjct: 409 gcgctggagggcgcgacggtggcgttcacgtacgtgaaggggcaggaggagaagga 464
>gb|AY104946.1| Zea mays PCO144726 mRNA sequence Length = 1424 Score = 222 bits (112), Expect = 7e-55 Identities = 199/228 (87%) Strand = Plus / Plus Query: 179 gcagaagttcccgccgcagcagcaggactgccagcccggcaaggagcacgccatggaccc 238 |||| |||||||| | ||||||||||| | |||||| || ||||||||||| |||||||| Sbjct: 204 gcagcagttcccggctcagcagcaggagtcccagccggggaaggagcacgcgatggaccc 263 Query: 239 ccgccccgaggccatcatcaagaactacaagtcggccaacaagctccagggcaaggtggc 298 ||| |||||||||||| || || |||||||| | |||||||||||| ||| ||||||||| Sbjct: 264 ccggcccgaggccatcgtccaggactacaaggccgccaacaagctcaaggacaaggtggc 323 Query: 299 gctggtgaccggcggcgactcgggcatcgggcgcgcggtgtgcctgtgcctcgcgctgga 358 ||| ||||||||||||||||| |||||||||||||| |||||||||||| ||||| ||| Sbjct: 324 gctcgtgaccggcggcgactccggcatcgggcgcgccgtgtgcctgtgcttcgcgaagga 383 Query: 359 gggcgcgacggtgaacttcacgtacgtgaaggggcacgaggacaagga 406 ||||||||||||| |||||| | ||||| |||||| ||||| ||||| Sbjct: 384 gggcgcgacggtggccttcaccttcgtgagggggcaggaggagaagga 431
>gb|AC137621.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0111O13, complete sequence Length = 126332 Score = 155 bits (78), Expect = 1e-34 Identities = 111/122 (90%) Strand = Plus / Minus Query: 285 cagggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggtgtgcctg 344 |||| |||||||||| | ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 118457 caggacaaggtggcgatcgtgaccggcggcgactccggcatcgggcgggcggtgtgcctg 118398 Query: 345 tgcctcgcgctggagggcgcgacggtgaacttcacgtacgtgaaggggcacgaggacaag 404 ||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| ||| Sbjct: 118397 tgcttcgcgctggagggcgcgacggtggcgttcacgtacgtgaaggggcaggaggagaag 118338 Query: 405 ga 406 || Sbjct: 118337 ga 118336 Score = 113 bits (57), Expect = 5e-22 Identities = 99/113 (87%) Strand = Plus / Minus Query: 171 atggcgtcgcagaagttcccgccgcagcagcaggactgccagcccggcaaggagcacgcc 230 |||||||||||| |||||||||||||| | ||||| ||||| || |||||||||||| Sbjct: 118641 atggcgtcgcagcagttcccgccgcagaatcaggagacgcagccggggaaggagcacgcc 118582 Query: 231 atggacccccgccccgaggccatcatcaagaactacaagtcggccaacaagct 283 ||||| ||||||||||||||||||||| ||| ||||||| | ||||||||||| Sbjct: 118581 atggatccccgccccgaggccatcatccagagctacaagccagccaacaagct 118529
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 155 bits (78), Expect = 1e-34 Identities = 111/122 (90%) Strand = Plus / Minus Query: 285 cagggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggtgtgcctg 344 |||| |||||||||| | ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 2286026 caggacaaggtggcgatcgtgaccggcggcgactccggcatcgggcgggcggtgtgcctg 2285967 Query: 345 tgcctcgcgctggagggcgcgacggtgaacttcacgtacgtgaaggggcacgaggacaag 404 ||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| ||| Sbjct: 2285966 tgcttcgcgctggagggcgcgacggtggcgttcacgtacgtgaaggggcaggaggagaag 2285907 Query: 405 ga 406 || Sbjct: 2285906 ga 2285905 Score = 113 bits (57), Expect = 5e-22 Identities = 99/113 (87%) Strand = Plus / Minus Query: 171 atggcgtcgcagaagttcccgccgcagcagcaggactgccagcccggcaaggagcacgcc 230 |||||||||||| |||||||||||||| | ||||| ||||| || |||||||||||| Sbjct: 2286210 atggcgtcgcagcagttcccgccgcagaatcaggagacgcagccggggaaggagcacgcc 2286151 Query: 231 atggacccccgccccgaggccatcatcaagaactacaagtcggccaacaagct 283 ||||| ||||||||||||||||||||| ||| ||||||| | ||||||||||| Sbjct: 2286150 atggatccccgccccgaggccatcatccagagctacaagccagccaacaagct 2286098
>gb|AC105262.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1489_G03, complete sequence Length = 107870 Score = 155 bits (78), Expect = 1e-34 Identities = 111/122 (90%) Strand = Plus / Minus Query: 285 cagggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggtgtgcctg 344 |||| |||||||||| | ||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 13941 caggacaaggtggcgatcgtgaccggcggcgactccggcatcgggcgggcggtgtgcctg 13882 Query: 345 tgcctcgcgctggagggcgcgacggtgaacttcacgtacgtgaaggggcacgaggacaag 404 ||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| ||| Sbjct: 13881 tgcttcgcgctggagggcgcgacggtggcgttcacgtacgtgaaggggcaggaggagaag 13822 Query: 405 ga 406 || Sbjct: 13821 ga 13820 Score = 113 bits (57), Expect = 5e-22 Identities = 99/113 (87%) Strand = Plus / Minus Query: 171 atggcgtcgcagaagttcccgccgcagcagcaggactgccagcccggcaaggagcacgcc 230 |||||||||||| |||||||||||||| | ||||| ||||| || |||||||||||| Sbjct: 14125 atggcgtcgcagcagttcccgccgcagaatcaggagacgcagccggggaaggagcacgcc 14066 Query: 231 atggacccccgccccgaggccatcatcaagaactacaagtcggccaacaagct 283 ||||| ||||||||||||||||||||| ||| ||||||| | ||||||||||| Sbjct: 14065 atggatccccgccccgaggccatcatccagagctacaagccagccaacaagct 14013
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 54.0 bits (27), Expect = 4e-04 Identities = 39/43 (90%) Strand = Plus / Plus Query: 286 agggcaaggtggcgctggtgaccggcggcgactcgggcatcgg 328 |||||||||| ||||||||||| ||||||| ||| |||||||| Sbjct: 4841828 agggcaaggtcgcgctggtgacgggcggcgcctccggcatcgg 4841870
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggt 337 |||||||| ||||| ||||| ||||||||| ||||||||||||||||| Sbjct: 1677165 ggcaaggtcgcgctcgtgacgggcggcgacagcggcatcgggcgcgcggt 1677116
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggt 337 |||||||| ||||| ||||| ||||||||| ||||||||||||||||| Sbjct: 3012117 ggcaaggtcgcgctcgtgacgggcggcgacagcggcatcgggcgcgcggt 3012068
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggt 337 |||||||| ||||| ||||| ||||||||| ||||||||||||||||| Sbjct: 2160949 ggcaaggtcgcgctcgtgacgggcggcgacagcggcatcgggcgcgcggt 2160900
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||||||||||||||||||||||| Sbjct: 2488731 ggcaaggtggcgctggtgaccggcg 2488707
>emb|BX640445.1| Bordetella bronchiseptica strain RB50, complete genome; segment 9/16 Length = 348706 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Plus Query: 297 gcgctggtgaccggcggcgactcgggcatcgggcgcgcggt 337 |||||||| |||||||||||||| || ||||| |||||||| Sbjct: 226765 gcgctggtcaccggcggcgactccggtatcggacgcgcggt 226805
>emb|BX640431.1| Bordetella parapertussis strain 12822, complete genome; segment 9/14 Length = 347894 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 297 gcgctggtgaccggcggcgactcgggcatcgggcgcgcggt 337 |||||||| |||||||||||||| || ||||| |||||||| Sbjct: 76180 gcgctggtcaccggcggcgactccggtatcggacgcgcggt 76140
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 286 agggcaaggtggcgctggtgaccgg 310 ||||||||||||||||||||||||| Sbjct: 3580899 agggcaaggtggcgctggtgaccgg 3580923
>gb|AF169018.1|AF169018 Glycine max seed maturation protein PM34 (PM34) mRNA, complete cds Length = 1187 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 374 cttcacgtacgtgaaggggcacgaggacaagga 406 ||||||||| ||||||||||| ||||||||||| Sbjct: 247 cttcacgtatgtgaaggggcatgaggacaagga 279
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence Length = 2726152 Score = 48.1 bits (24), Expect = 0.022 Identities = 27/28 (96%) Strand = Plus / Plus Query: 290 caaggtggcgctggtgaccggcggcgac 317 |||||| ||||||||||||||||||||| Sbjct: 1033582 caaggtcgcgctggtgaccggcggcgac 1033609 Score = 46.1 bits (23), Expect = 0.088 Identities = 26/27 (96%) Strand = Plus / Minus Query: 286 agggcaaggtggcgctggtgaccggcg 312 ||||||||||||||||||| ||||||| Sbjct: 2051975 agggcaaggtggcgctggtcaccggcg 2051949
>emb|AJ561198.1|NSP561198 Actinomadura sp. ATCC 39727 gene cluster for biosynthesis of glycopeptide antibiotic A40926, strain ATCC 39727 Length = 89153 Score = 48.1 bits (24), Expect = 0.022 Identities = 30/32 (93%) Strand = Plus / Minus Query: 306 accggcggcgactcgggcatcgggcgcgcggt 337 |||||||| ||||||||||||||||| ||||| Sbjct: 84418 accggcggtgactcgggcatcgggcgggcggt 84387
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 48.1 bits (24), Expect = 0.022 Identities = 27/28 (96%) Strand = Plus / Plus Query: 287 gggcaaggtggcgctggtgaccggcggc 314 ||||||||||| |||||||||||||||| Sbjct: 1483640 gggcaaggtggtgctggtgaccggcggc 1483667
>dbj|AB213459.1| Leifsonia sp. S749 lsadh gene for short chain alcohol dehydrogenase, complete cds Length = 859 Score = 48.1 bits (24), Expect = 0.022 Identities = 30/32 (93%) Strand = Plus / Plus Query: 303 gtgaccggcggcgactcgggcatcgggcgcgc 334 |||||||| |||| |||||||||||||||||| Sbjct: 80 gtgaccggaggcggctcgggcatcgggcgcgc 111
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 48.1 bits (24), Expect = 0.022 Identities = 48/56 (85%) Strand = Plus / Plus Query: 282 ctccagggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggt 337 ||||||| ||| ||||||||| | ||||||||||| || |||||||| || ||||| Sbjct: 441357 ctccaggacaaagtggcgctgattaccggcggcgattccggcatcggccgggcggt 441412 Score = 42.1 bits (21), Expect = 1.4 Identities = 48/57 (84%) Strand = Plus / Minus Query: 278 caagctccagggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgc 334 ||||||| | ||||| | |||||| || ||||||||||| ||||| ||||| ||||| Sbjct: 2155194 caagctcgaaggcaaagcggcgctcgtcaccggcggcgattcgggtatcggccgcgc 2155138
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 48.1 bits (24), Expect = 0.022 Identities = 24/24 (100%) Strand = Plus / Plus Query: 289 gcaaggtggcgctggtgaccggcg 312 |||||||||||||||||||||||| Sbjct: 2099084 gcaaggtggcgctggtgaccggcg 2099107
>gb|AF082663.3| Rhodococcus sp. NCIMB12038 naphthalene degradation gene cluster, complete sequence Length = 11548 Score = 46.1 bits (23), Expect = 0.088 Identities = 41/47 (87%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgc 334 |||||||||||||| || |||||||||| ||||| ||||| ||||| Sbjct: 6363 ggcaaggtggcgctcgtcaccggcggcggatcgggtatcggccgcgc 6409
>gb|CP000092.1| Ralstonia eutropha JMP134 megaplasmid, complete sequence Length = 634917 Score = 46.1 bits (23), Expect = 0.088 Identities = 26/27 (96%) Strand = Plus / Plus Query: 286 agggcaaggtggcgctggtgaccggcg 312 ||||||||||||||||||| ||||||| Sbjct: 541835 agggcaaggtggcgctggtcaccggcg 541861
>gb|AY392424.3| Rhodococcus sp. P200 rubredoxin (rub1), putative naphthalene degradation regulator protein (narR1), putative naphthalene degradation regulator protein (narR2), hypothetical protein, naphthalene dioxygenase large subunit (narAa), naphthalene dioxygenase small subunit (narAb), cis-naphthalene dihydrodiol dehydrogenase (narB), and putative aldolase (narC) genes, complete cds Length = 8815 Score = 46.1 bits (23), Expect = 0.088 Identities = 41/47 (87%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgc 334 |||||||||||||| || |||||||||| ||||| ||||| ||||| Sbjct: 5576 ggcaaggtggcgctcgtcaccggcggcggatcgggtatcggccgcgc 5622
>gb|AY392423.2| Rhodococcus sp. P400 rubredoxin (rub1), putative naphthalene degradation regulator protein (narR1), putative naphthalene degradation regulator protein (narR2), hypothetical protein, naphthalene dioxygenase large subunit (narAa), naphthalene dioxygenase small subunit (narAb), cis-naphthalene dihydrodiol dehydrogenase (narB), putative aldolase (narC), and putative oxygenase gene (oxiA) genes, complete cds Length = 12766 Score = 46.1 bits (23), Expect = 0.088 Identities = 41/47 (87%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgc 334 |||||||||||||| || |||||||||| ||||| ||||| ||||| Sbjct: 5510 ggcaaggtggcgctcgtcaccggcggcggatcgggtatcggccgcgc 5556
>dbj|AB110633.1| Rhodococcus opacus plasmid pWK301 orf6, dodR1, dodR2, orf7, dodA, dodB, dodC,orf8, genes for rubredoxin, transcriptional regulater GntR family protein, transcriptional activator protein, 2,4-diacetylphloroglucinol biosynthetic protein, terminal dioxygenase large subunit, terminal dioxygenase small subunit, dihydrodiol dehydrogenase, hydratase-aldolase, complete cds Length = 9225 Score = 46.1 bits (23), Expect = 0.088 Identities = 41/47 (87%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgc 334 |||||||||||||| || |||||||||| ||||| ||||| ||||| Sbjct: 6743 ggcaaggtggcgctcgtcaccggcggcggatcgggtatcggccgcgc 6789
>gb|AY109482.1| Zea mays CL123_1 mRNA sequence Length = 2096 Score = 46.1 bits (23), Expect = 0.088 Identities = 23/23 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttcacg 380 ||||||||||||||||||||||| Sbjct: 1580 agggcgcgacggtgaacttcacg 1602
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 46.1 bits (23), Expect = 0.088 Identities = 26/27 (96%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcggc 314 |||||||||||| |||||||||||||| Sbjct: 3700690 ggcaaggtggcgttggtgaccggcggc 3700664 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 3708281 ggcaaagtggcgctggtgaccggcg 3708257 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 ggtggcgctggtgaccggcg 312 |||||||||||||||||||| Sbjct: 726835 ggtggcgctggtgaccggcg 726854
>dbj|AB024936.1| Rhodococcus sp. CIR2 naphthalene degradation genes (rnoA1, rnoA2, rnoA3, rnoA4, rnoB), complete cds Length = 12534 Score = 46.1 bits (23), Expect = 0.088 Identities = 41/47 (87%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgc 334 |||||||||||||| || |||||||||| ||||| ||||| ||||| Sbjct: 7355 ggcaaggtggcgctcgtcaccggcggcggatcgggtatcggccgcgc 7401
>emb|BX058961.1|CNS09HNP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 845 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 295 tggcgctggtgaccggcggcga 316 |||||||||||||||||||||| Sbjct: 489 tggcgctggtgaccggcggcga 510
>emb|BX030937.1|CNS08W19 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46AG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 891 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 295 tggcgctggtgaccggcggcga 316 |||||||||||||||||||||| Sbjct: 457 tggcgctggtgaccggcggcga 478
>emb|BX010479.1|CNS08G8Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16DD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 558 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 295 tggcgctggtgaccggcggcga 316 |||||||||||||||||||||| Sbjct: 455 tggcgctggtgaccggcggcga 476
>emb|BX006911.1|CNS08DHV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA11CE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 484 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 295 tggcgctggtgaccggcggcga 316 |||||||||||||||||||||| Sbjct: 239 tggcgctggtgaccggcggcga 260
>ref|NM_142857.2| Drosophila melanogaster CG17121-RA (CG17121), mRNA Length = 1405 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcgg 313 ||||||||||| |||||||||||||| Sbjct: 442 ggcaaggtggcactggtgaccggcgg 467
>gb|AY089677.1| Drosophila melanogaster RH48101 full insert cDNA Length = 1425 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcgg 313 ||||||||||| |||||||||||||| Sbjct: 444 ggcaaggtggcactggtgaccggcgg 469
>ref|XM_318752.2| Anopheles gambiae str. PEST ENSANGP00000004677 (ENSANGG00000003665), partial mRNA Length = 1611 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 295 tggcgctggtgaccggcggcga 316 |||||||||||||||||||||| Sbjct: 971 tggcgctggtgaccggcggcga 992
>gb|AC167667.4| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940123D9, complete sequence Length = 121336 Score = 44.1 bits (22), Expect = 0.35 Identities = 37/42 (88%) Strand = Plus / Plus Query: 296 ggcgctggtgaccggcggcgactcgggcatcgggcgcgcggt 337 ||||||||| ||||| | ||| ||||||||||| |||||||| Sbjct: 119853 ggcgctggtcaccggtgccgattcgggcatcggccgcgcggt 119894
>gb|AE001825.1| Deinococcus radiodurans R1 chromosome 2, complete sequence Length = 412348 Score = 44.1 bits (22), Expect = 0.35 Identities = 52/62 (83%) Strand = Plus / Plus Query: 277 acaagctccagggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcgg 336 ||||||| ||||||||||||| || | | |||||||||| |||||||||||||||| Sbjct: 406486 acaagctgaagggcaaggtggccctcatcagcggcggcgacagcggcatcgggcgcgcgg 406545 Query: 337 tg 338 || Sbjct: 406546 tg 406547
>ref|XM_472389.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 828 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 287 gggcaaggtggcgctggtgaccggcggcg 315 |||||||||||||||| | |||||||||| Sbjct: 51 gggcaaggtggcgctgatcaccggcggcg 79
>ref|NM_197347.1| Oryza sativa (japonica cultivar-group) putative cytochrome P450 (OSJNBa0026L12.2), mRNA Length = 1551 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 1202 agggcgcgacggtgaacttca 1222
>ref|NM_197334.1| Oryza sativa (japonica cultivar-group) putative cytochrome P450 (OSJNBa0026L12.29), mRNA Length = 1451 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 1112 agggcgcgacggtgaacttca 1132
>ref|NM_197330.1| Oryza sativa (japonica cultivar-group) putative cytochrome P450 (OSJNBa0026L12.14), mRNA Length = 1563 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 1220 agggcgcgacggtgaacttca 1240
>ref|XM_517542.1| PREDICTED: Pan troglodytes hydroxyprostaglandin dehydrogenase 15-(NAD) (LOC461613), mRNA Length = 1420 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 571 ggcaaagtggcgctggtgaccggcg 595
>gb|CP000145.1| Rhodobacter sphaeroides 2.4.1 plasmid B, complete sequence Length = 114178 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 286 agggcaaggtggcgctggtgaccgg 310 |||| |||||||||||||||||||| Sbjct: 42012 aggggaaggtggcgctggtgaccgg 42036
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 222 gagcacgccatggacccccgccccg 246 ||||||| ||||||||||||||||| Sbjct: 376182 gagcacgacatggacccccgccccg 376158
>gb|AY658720.1| Synthetic construct Peudomonas aeruginosa clone FLH034861.01F PA2142 gene, partial cds Length = 861 Score = 42.1 bits (21), Expect = 1.4 Identities = 45/53 (84%) Strand = Plus / Plus Query: 286 agggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggtg 338 |||| |||||||| ||||| |||||||||||| || ||||| ||||||||| Sbjct: 122 agggtaaggtggccctggtcaccggcggcgacagtggtatcggccgcgcggtg 174
>gb|AE009391.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 161 of 187 of the complete sequence Length = 10784 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 306 accggcggcgactcgggcatcgggcgcgc 334 ||||||||||| || |||||||||||||| Sbjct: 303 accggcggcgattccggcatcgggcgcgc 331
>gb|AE008224.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 28 of 187 of the complete sequence Length = 10844 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 306 accggcggcgactcgggcatcgggcgcgc 334 ||||||||||| || |||||||||||||| Sbjct: 10526 accggcggcgattccggcatcgggcgcgc 10498
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome Length = 3928089 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 |||||||| |||||||||||||||| Sbjct: 1258032 ggcaaggtcgcgctggtgaccggcg 1258056
>ref|XM_543199.2| PREDICTED: Canis familiaris similar to 15-hydroxyprostaglandin dehydrogenase [NAD+] (PGDH) (Prostaglandin dehydrogenase 1) (LOC486073), mRNA Length = 927 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 52 ggcaaagtggcgctggtgaccggcg 76
>gb|BC007691.2| Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD), mRNA (cDNA clone IMAGE:3955175), partial cds Length = 628 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 21 ggcaaagtggcgctggtgaccggcg 45
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 286 agggcaaggtggcgctggtgaccgg 310 |||||||||| |||||||||||||| Sbjct: 1349377 agggcaaggtcgcgctggtgaccgg 1349401
>emb|X82460.1|HS15HPGDH H.sapiens mRNA for 15-hydroxy prostaglandin dehydrogenase Length = 660 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 13 ggcaaagtggcgctggtgaccggcg 37
>emb|CR859280.1| Pongo pygmaeus mRNA; cDNA DKFZp469E0623 (from clone DKFZp469E0623) Length = 2313 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 50 ggcaaagtggcgctggtgaccggcg 74
>emb|BX572599.1| Rhodopseudomonas palustris CGA009 complete genome; segment 7/16 Length = 349142 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 339392 ggcaaagtggcgctggtgaccggcg 339368
>emb|AL731639.3|OSJN00288 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000315_02, complete sequence Length = 112404 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 287 gggcaaggtggcgctggtgaccggcggcg 315 |||||||||||||||| | |||||||||| Sbjct: 88985 gggcaaggtggcgctgatcaccggcggcg 88957
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 |||||||| |||||||||||||||| Sbjct: 3526517 ggcaaggttgcgctggtgaccggcg 3526541
>ref|NM_000860.3| Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD) (HPGD), mRNA Length = 2592 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 22 ggcaaagtggcgctggtgaccggcg 46
>emb|CR618581.1| full-length cDNA clone CS0DI076YB06 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1397 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 36 ggcaaagtggcgctggtgaccggcg 60
>emb|CR608377.1| full-length cDNA clone CS0DI039YJ22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1716 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 28 ggcaaagtggcgctggtgaccggcg 52
>emb|CR606077.1| full-length cDNA clone CS0DI002YC08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1750 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 39 ggcaaagtggcgctggtgaccggcg 63
>emb|CR605509.1| full-length cDNA clone CS0DI014YK10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1526 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 41 ggcaaagtggcgctggtgaccggcg 65
>emb|CR604844.1| full-length cDNA clone CS0DI040YI14 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1021 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 32 ggcaaagtggcgctggtgaccggcg 56
>emb|CR603849.1| full-length cDNA clone CS0DE011YJ01 of Placenta of Homo sapiens (human) Length = 1752 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 39 ggcaaagtggcgctggtgaccggcg 63
>emb|CR602985.1| full-length cDNA clone CS0DI027YF06 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1733 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 31 ggcaaagtggcgctggtgaccggcg 55
>emb|CR600709.1| full-length cDNA clone CS0DI018YF05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1490 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 34 ggcaaagtggcgctggtgaccggcg 58
>emb|CR598443.1| full-length cDNA clone CS0DE007YF12 of Placenta of Homo sapiens (human) Length = 1674 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 31 ggcaaagtggcgctggtgaccggcg 55
>emb|CR594801.1| full-length cDNA clone CS0DI022YF08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1553 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 37 ggcaaagtggcgctggtgaccggcg 61
>gb|AC068924.11| Oryza sativa chromosome 10 BAC OSJNBa0026L12 genomic sequence, complete sequence Length = 152172 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 84055 agggcgcgacggtgaacttca 84035 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 67507 agggcgcgacggtgaacttca 67487 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 12877 agggcgcgacggtgaacttca 12857
>gb|AC096751.3| Homo sapiens BAC clone RP11-440I14 from 4, complete sequence Length = 174642 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 83544 ggcaaagtggcgctggtgaccggcg 83520
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 287 gggcaaggtggcgctggtgaccggcggcg 315 |||||||||||||||| | |||||||||| Sbjct: 20119080 gggcaaggtggcgctgatcaccggcggcg 20119052
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 19363504 agggcgcgacggtgaacttca 19363524 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 19308874 agggcgcgacggtgaacttca 19308894 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 19292326 agggcgcgacggtgaacttca 19292346
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 281 gctccagggcaaggtggcgctggtgaccggcgg 313 ||||||||||||||||||| | || |||||||| Sbjct: 1684754 gctccagggcaaggtggcgatcgtcaccggcgg 1684722
>gb|AE004641.1| Pseudomonas aeruginosa PAO1, section 202 of 529 of the complete genome Length = 12075 Score = 42.1 bits (21), Expect = 1.4 Identities = 45/53 (84%) Strand = Plus / Plus Query: 286 agggcaaggtggcgctggtgaccggcggcgactcgggcatcgggcgcgcggtg 338 |||| |||||||| ||||| |||||||||||| || ||||| ||||||||| Sbjct: 7423 agggtaaggtggccctggtcaccggcggcgacagtggtatcggccgcgcggtg 7475
>gb|AC114398.3| Homo sapiens chromosome 3 clone RP11-495E23, complete sequence Length = 233454 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 88 gtcccctccccaccaccagag 108 ||||||||||||||||||||| Sbjct: 107269 gtcccctccccaccaccagag 107249
>gb|AF229830.1|AF229830 Papio hamadryas prostaglandin dehydrogenase mRNA, partial cds Length = 689 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 19 ggcaaagtggcgctggtgaccggcg 43
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 42.1 bits (21), Expect = 1.4 Identities = 33/37 (89%) Strand = Plus / Minus Query: 287 gggcaaggtggcgctggtgaccggcggcgactcgggc 323 |||||||||||||||| | ||||||||| ||||||| Sbjct: 4219232 gggcaaggtggcgctgatctccggcggcggctcgggc 4219196
>dbj|AK121651.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033061A12, full insert sequence Length = 1785 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 1238 agggcgcgacggtgaacttca 1258
>dbj|AK058013.1| Homo sapiens cDNA FLJ25284 fis, clone STM06787, highly similar to 15-HYDROXYPROSTAGLANDIN DEHYDROGENASE [NAD(+)] (EC 1.1.1.141) Length = 2563 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 49 ggcaaagtggcgctggtgaccggcg 73
>gb|AF177983.1|AF177983 Homo sapiens NAD+-dependent 15-hydroxyprostaglandin dehydrogenase (PGDH) gene, promoter, exons 1 and 2 and partial cds Length = 3450 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 2382 ggcaaagtggcgctggtgaccggcg 2406
>dbj|AK110700.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-B08, full insert sequence Length = 1055 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 287 gggcaaggtggcgctggtgaccggcggcg 315 |||||||||||||||| | |||||||||| Sbjct: 109 gggcaaggtggcgctgatcaccggcggcg 137
>dbj|AK106424.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-B07, full insert sequence Length = 1878 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 1286 agggcgcgacggtgaacttca 1306
>dbj|AK105773.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-F01, full insert sequence Length = 1789 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 1242 agggcgcgacggtgaacttca 1262
>emb|AJ325774.1|HSA325774 Homo sapiens genomic sequence surrounding NotI site, clone NB1-688C Length = 980 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 69 ggcaaagtggcgctggtgaccggcg 93
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence Length = 2094509 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 290 caaggtggcgctggtgaccggcggc 314 |||||||||||||||||||| |||| Sbjct: 1963928 caaggtggcgctggtgaccgacggc 1963952
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcg 312 |||||||| |||||||||||||||| Sbjct: 2965501 ggcaaggtcgcgctggtgaccggcg 2965477
>gb|BC018986.2| Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD), mRNA (cDNA clone MGC:20092 IMAGE:3638799), complete cds Length = 2592 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 22 ggcaaagtggcgctggtgaccggcg 46
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 293 ggtggcgctggtgaccggcggcgactcgggcat 325 ||||||| ||||||||||||||| |||||||| Sbjct: 3492130 ggtggcggtggtgaccggcggcgcgtcgggcat 3492098 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 293 ggtggcgctggtgaccggcg 312 |||||||||||||||||||| Sbjct: 3990230 ggtggcgctggtgaccggcg 3990249
>gb|AY609554.1| Sus scrofa clone Clu_17292.scr.msk.p1.Contig2, mRNA sequence Length = 1335 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 30 ggcaaagtggcgctggtgaccggcg 54
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 19374780 agggcgcgacggtgaacttca 19374800 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 19320150 agggcgcgacggtgaacttca 19320170 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 agggcgcgacggtgaacttca 378 ||||||||||||||||||||| Sbjct: 19303602 agggcgcgacggtgaacttca 19303622
>gb|U63296.1|HSU63296 Human 15-hydroxyprostaglandin dehydrogenase mRNA, complete cds Length = 583 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 13 ggcaaagtggcgctggtgaccggcg 37
>dbj|AP006689.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT27F14, TM0387, complete sequence Length = 96031 Score = 42.1 bits (21), Expect = 1.4 Identities = 36/41 (87%) Strand = Plus / Minus Query: 285 cagggcaaggtggcgctggtgaccggcggcgactcgggcat 325 ||||| ||||||||| ||||||| || || ||||||||||| Sbjct: 13477 caggggaaggtggcgttggtgacaggaggtgactcgggcat 13437
>gb|L76465.1|HUMPGDHB Homo sapiens NAD+-dependent 15 hydroxyprostaglandin dehydrogenase (PGDH) mRNA, complete cds Length = 2518 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 30 ggcaaagtggcgctggtgaccggcg 54
>gb|J05594.1|HUMPGDHA Homo sapiens NAD+-dependent 15-hydroxyprostaglandin dehydrogenase (PDGH) mRNA, complete cds Length = 2412 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 30 ggcaaagtggcgctggtgaccggcg 54
>dbj|AB059653.1| Macaca fascicularis PGDH1 mRNA for prostaglandin dehydrogenase I, complete cds Length = 2587 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 288 ggcaaggtggcgctggtgaccggcg 312 ||||| ||||||||||||||||||| Sbjct: 31 ggcaaagtggcgctggtgaccggcg 55
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 40.1 bits (20), Expect = 5.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 297 gcgctggtgaccggcggcgactcgggcatcgggcgc 332 |||||||| |||||||||| | | |||||||||||| Sbjct: 2097688 gcgctggtcaccggcggcgccaccggcatcgggcgc 2097653
>ref|NM_103558.2| Arabidopsis thaliana unknown protein AT1G44770 mRNA, complete cds Length = 1165 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 49 ttctccttcttcttcaccgtctcc 72 |||| ||||||||||||||||||| Sbjct: 44 ttcttcttcttcttcaccgtctcc 21
>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence Length = 2107794 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 334 cggtgtgcctgtgcctcgcgctgg 357 |||||||||||||| ||||||||| Sbjct: 1808130 cggtgtgcctgtgcttcgcgctgg 1808107
>gb|AC161751.3| Mus musculus BAC clone RP24-525E22 from chromosome y, complete sequence Length = 188482 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 caaggtggcgctggtgaccg 309 |||||||||||||||||||| Sbjct: 126220 caaggtggcgctggtgaccg 126201
>gb|AC163622.4| Mus musculus BAC clone RP24-566G6 from chromosome y, complete sequence Length = 166756 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 290 caaggtggcgctggtgaccg 309 |||||||||||||||||||| Sbjct: 17740 caaggtggcgctggtgaccg 17721
>ref|XM_362142.1| Magnaporthe grisea 70-15 hypothetical protein (MG04587.4) partial cds Length = 2964 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 agttcccgccgcagcagcag 203 |||||||||||||||||||| Sbjct: 2929 agttcccgccgcagcagcag 2910
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome Length = 3814139 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 166 gagcaatggcgtcgcagaag 185 |||||||||||||||||||| Sbjct: 2918146 gagcaatggcgtcgcagaag 2918165
>gb|AC166561.2| Spironucleus vortens clone JGIBAWF-9C3, complete sequence Length = 35544 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 250 ccatcatcaagaactacaag 269 |||||||||||||||||||| Sbjct: 12660 ccatcatcaagaactacaag 12641
>ref|XM_391587.1| Gibberella zeae PH-1 chromosome linkage group 14 hypothetical protein (FG11411.1) partial mRNA Length = 1488 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 178 cgcagaagttcccgccgcagcagcagga 205 |||||||| |||||||||||||||||| Sbjct: 534 cgcagaagcacccgccgcagcagcagga 507
>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16 Length = 347137 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 285 cagggcaaggtggcgctggtgaccggcg 312 ||||||||| | |||||||||||||||| Sbjct: 148868 cagggcaagatcgcgctggtgaccggcg 148841
>emb|BX640433.1| Bordetella parapertussis strain 12822, complete genome; segment 11/14 Length = 349305 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 285 cagggcaaggtggcgctggtgaccggcg 312 ||||||||| | |||||||||||||||| Sbjct: 85361 cagggcaagatcgcgctggtgaccggcg 85334
>emb|BX640418.1| Bordetella pertussis strain Tohama I, complete genome; segment 8/12 Length = 349346 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 285 cagggcaaggtggcgctggtgaccggcg 312 ||||||||| | |||||||||||||||| Sbjct: 152004 cagggcaagatcgcgctggtgaccggcg 151977
>emb|AL939113.1|SCO939113 Streptomyces coelicolor A3(2) complete genome; segment 10/29 Length = 310550 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 294 gtggcgctggtgaccggcggcgac 317 ||||||||| |||||||||||||| Sbjct: 190066 gtggcgctgctgaccggcggcgac 190089
>emb|CR792458.6| Zebrafish DNA sequence from clone RP71-47I2, complete sequence Length = 186632 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 caaggtggcgctggtgaccg 309 |||||||||||||||||||| Sbjct: 107394 caaggtggcgctggtgaccg 107413
>gb|AC023720.4| Drosophila melanogaster X BAC RP98-7F15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179205 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 ttctccttcttcttcaccgt 68 |||||||||||||||||||| Sbjct: 8402 ttctccttcttcttcaccgt 8421
>gb|AE005759.1| Caulobacter crescentus CB15 section 85 of 359 of the complete genome Length = 12748 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 306 accggcggcgactcgggcatcggg 329 |||||||||| ||||||||||||| Sbjct: 791 accggcggcggctcgggcatcggg 768
>gb|AC023682.4| Drosophila melanogaster X BAC RP98-7F10 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179236 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 ttctccttcttcttcaccgt 68 |||||||||||||||||||| Sbjct: 145785 ttctccttcttcttcaccgt 145804
>ref|NM_132061.1| Drosophila melanogaster CG5937-RA (CG5937), mRNA Length = 6051 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 ttctccttcttcttcaccgt 68 |||||||||||||||||||| Sbjct: 5465 ttctccttcttcttcaccgt 5446
>gb|AC023950.6| Homo sapiens chromosome 11, clone RP11-808N1, complete sequence Length = 211464 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 81 cagctgcgtcccctccccaccacc 104 |||| ||||||||||||||||||| Sbjct: 145356 cagcagcgtcccctccccaccacc 145379
>gb|AE006470.1| Chlorobium tepidum TLS, complete genome Length = 2154946 Score = 40.1 bits (20), Expect = 5.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 288 ggcaaggtggcgctggtgaccggcggcg 315 |||||||||||||| || |||||||||| Sbjct: 1681073 ggcaaggtggcgctcgtcaccggcggcg 1681046
>gb|AC108867.3| Homo sapiens BAC clone RP11-102H15 from 4, complete sequence Length = 132858 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 89 tcccctccccaccaccagag 108 |||||||||||||||||||| Sbjct: 115627 tcccctccccaccaccagag 115608
>gb|AF079317.1| Sphingomonas aromaticivorans plasmid pNL1, complete plasmid sequence Length = 184457 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 292 aggtggcgctggtgaccggcggcg 315 ||||||||||| |||||||||||| Sbjct: 145404 aggtggcgctgctgaccggcggcg 145381
>gb|AE009461.1| Brucella melitensis 16M chromosome I, section 18 of 195 of the complete sequence Length = 10744 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 334 cggtgtgcctgtgcctcgcgctgg 357 |||||||||||||| ||||||||| Sbjct: 2089 cggtgtgcctgtgcttcgcgctgg 2112
>gb|AC084572.1|CBRG39K23 Caenorhabditis briggsae cosmid G39K23, complete sequence Length = 39590 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 cacccaccagagcccagccg 47 |||||||||||||||||||| Sbjct: 9170 cacccaccagagcccagccg 9151
>gb|AC020576.2|T12C22 Sequence of BAC T12C22 from Arabidopsis thaliana chromosome 1, complete sequence Length = 115421 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 49 ttctccttcttcttcaccgtctcc 72 |||| ||||||||||||||||||| Sbjct: 22120 ttcttcttcttcttcaccgtctcc 22143
>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence Length = 2124241 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 334 cggtgtgcctgtgcctcgcgctgg 357 |||||||||||||| ||||||||| Sbjct: 1824989 cggtgtgcctgtgcttcgcgctgg 1824966
>gb|AC003013.1|AC003013 Human PAC clone RP1-205E24 from Xq23, complete sequence Length = 173452 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 369 gtgaacttcacgtacgtgaa 388 |||||||||||||||||||| Sbjct: 16615 gtgaacttcacgtacgtgaa 16634
>gb|U67677.1|HMU67677 Hirudo medicinalis alpha-1 tubulin mRNA, complete cds Length = 1861 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 49 ttctccttcttcttcaccgtctcc 72 |||||||||||||||||| ||||| Sbjct: 1726 ttctccttcttcttcaccttctcc 1703
>gb|U67675.1|HMU67675 Hirudo medicinalis alpha-1 tubulin gene, complete cds Length = 2389 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 49 ttctccttcttcttcaccgtctcc 72 |||||||||||||||||| ||||| Sbjct: 2254 ttctccttcttcttcaccttctcc 2231
>gb|AE003436.3| Drosophila melanogaster chromosome X, section 20 of 74 of the complete sequence Length = 317322 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 ttctccttcttcttcaccgt 68 |||||||||||||||||||| Sbjct: 130848 ttctccttcttcttcaccgt 130829
>gb|AC153945.5| Mus musculus 10 BAC RP24-501G17 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 179734 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 48 tttctccttcttcttcaccgtctc 71 ||||||||||||||||| |||||| Sbjct: 97197 tttctccttcttcttcaacgtctc 97220
>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain 2308 Length = 2121359 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 334 cggtgtgcctgtgcctcgcgctgg 357 |||||||||||||| ||||||||| Sbjct: 1822117 cggtgtgcctgtgcttcgcgctgg 1822094
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 aggagcacgccatggacccc 239 |||||||||||||||||||| Sbjct: 2088496 aggagcacgccatggacccc 2088477 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,992,954 Number of Sequences: 3902068 Number of extensions: 2992954 Number of successful extensions: 83136 Number of sequences better than 10.0: 128 Number of HSP's better than 10.0 without gapping: 128 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 80547 Number of HSP's gapped (non-prelim): 2584 length of query: 406 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 384 effective length of database: 17,147,199,772 effective search space: 6584524712448 effective search space used: 6584524712448 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
