Clone Name | bart52a02 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|AY228176.1|AY228176S1 Streptomyces WP 4669 PD 116740 angucycl... | 38 | 3.6 | 2 | gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... | 38 | 3.6 |
---|
>gb|AY228176.1|AY228176S1 Streptomyces WP 4669 PD 116740 angucycline type II polyketide synthase gene cluster, partial sequence Length = 7023 Score = 38.2 bits (19), Expect = 3.6 Identities = 19/19 (100%) Strand = Plus / Minus Query: 64 ccgtcgtccccgtccggca 82 ||||||||||||||||||| Sbjct: 1126 ccgtcgtccccgtccggca 1108
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 38.2 bits (19), Expect = 3.6 Identities = 22/23 (95%) Strand = Plus / Minus Query: 59 cggctccgtcgtccccgtccggc 81 |||||||||||||| |||||||| Sbjct: 2661108 cggctccgtcgtccgcgtccggc 2661086 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 306,877 Number of Sequences: 3902068 Number of extensions: 306877 Number of successful extensions: 20148 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 20124 Number of HSP's gapped (non-prelim): 24 length of query: 85 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 64 effective length of database: 17,151,101,840 effective search space: 1097670517760 effective search space used: 1097670517760 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)