ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart50d10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AJ488507.1|TAE488507 Triticum aestivum mRNA for triacylglyce... 192 7e-46
2emb|AJ488508.1|TAE488508 Triticum aestivum mRNA for triacylglyce... 170 3e-39
3gb|AC164955.2| Mus musculus BAC clone RP24-233H9 from chromosome... 52 0.002
4emb|AL731553.12| Human DNA sequence from clone RP11-56M3 on chro... 52 0.002
5gb|AC122353.5| Mus musculus BAC clone RP23-391E17 from chromosom... 52 0.002
6gb|AC129888.3| Atelerix albiventris clone LB4-495B20, complete s... 50 0.007
7emb|AL592215.12| Mouse DNA sequence from clone RP23-172P19 on ch... 50 0.007
8gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold 50 0.007
9gb|AC118640.8| Mus musculus chromosome 15, clone RP24-112A20, co... 48 0.026
10gb|AC127292.4| Mus musculus BAC clone RP23-375J3 from chromosome... 48 0.026
11gb|AC123863.4| Mus musculus BAC clone RP23-364A19 from chromosom... 48 0.026
12gb|AC165350.3| Mus musculus BAC clone RP23-249A17 from chromosom... 48 0.026
13emb|AL031429.11|HS333A15 Human DNA sequence from clone RP3-333A1... 48 0.026
14gb|AC151265.3| Mus musculus BAC clone RP24-372H7 from chromosome... 48 0.026
15gb|AC110797.4| Homo sapiens BAC clone RP11-637M3 from 4, complet... 48 0.026
16gb|AC122327.5| Mus musculus BAC clone RP23-339D20 from chromosom... 48 0.026
17gb|AC144813.3| Mus musculus BAC clone RP24-324I23 from 9, comple... 48 0.026
18gb|AC118234.10| Mus musculus chromosome 15, clone RP23-463J9, co... 48 0.026
19gb|AC163709.3| Gallus gallus BAC clone CH261-60F22 from chromoso... 48 0.026
20gb|AC156163.2| Mus musculus BAC clone RP24-122E11 from chromosom... 46 0.10
21gb|AC127252.3| Mus musculus BAC clone RP24-276A6 from chromosome... 46 0.10
22gb|AC122901.4| Mus musculus BAC clone RP23-40D21 from chromosome... 46 0.10
23gb|AC124686.3| Mus musculus BAC clone RP24-422F20 from chromosom... 46 0.10
24gb|AC127313.3| Mus musculus BAC clone RP23-311A21 from 5, comple... 46 0.10
25emb|AL161945.31| Human DNA sequence from clone RP4-606D23 on chr... 46 0.10
26gb|AC091536.2| Rattus norvegicus strain Brown Norway clone RP31-... 46 0.10
27gb|AC091588.6| Homo sapiens chromosome 18, clone RP11-627G18, co... 46 0.10
28emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on ch... 46 0.10
29gb|AC159825.2| Mus musculus BAC clone RP23-100J21 from chromosom... 46 0.10
30gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome... 46 0.10
31gb|AC137875.13| Mus musculus chromosome 15, clone RP23-62B15, co... 46 0.10
32gb|AY057907.1| Mus musculus brain-derived neurotrophic factor (B... 46 0.10
33gb|AC158989.1| Mus musculus BAC clone RP23-399H20 from chromosom... 46 0.10
34gb|AC091043.12| Homo sapiens chromosome 18, clone RP11-595B24, c... 46 0.10
35gb|AC107045.9| Mus musculus chromosome 1, clone RP23-334J7, comp... 46 0.10
36emb|AL713918.22| Mouse DNA sequence from clone RP23-350D7 on chr... 46 0.10
37gb|AC154192.3| Mus musculus BAC clone RP24-70F14 from chromosome... 46 0.10
38gb|AC134615.5| Mus musculus BAC clone RP23-148H3 from 8, complet... 46 0.10
39gb|AC138616.4| Mus musculus BAC clone RP23-403D16 from 9, comple... 46 0.10
40gb|AC150033.2| Mus musculus BAC clone RP23-449N19 from 3, comple... 46 0.10
41gb|AC121281.19| Mus musculus chromosome 3, clone RP23-61G16, com... 44 0.41
42gb|AC115727.10| Mus musculus chromosome 3, clone RP23-30A13, com... 44 0.41
43gb|AC104554.7| Mus musculus chromosome 5, clone RP24-441E22, com... 44 0.41
44gb|AC153801.1| Mus musculus 10 NOVECTOR RP24-255E19 (Roswell Par... 44 0.41
45gb|AC103636.11| Mus musculus chromosome 5, clone RP24-373A18, co... 44 0.41
46gb|AC102908.11| Mus musculus chromosome 16, clone RP24-288K2, co... 44 0.41
47gb|AC121147.8| Mus musculus chromosome 3, clone RP24-369O15, com... 44 0.41
48gb|AC152953.1| Mus musculus 10 BAC RP23-403E19 (Roswell Park Can... 44 0.41
49gb|AC101593.16| Mus musculus chromosome 18, clone RP23-198A7, co... 44 0.41
50gb|AC122357.4| Mus musculus BAC clone RP23-403O8 from chromosome... 44 0.41
51gb|AC160121.2| Mus musculus BAC clone RP23-402P14 from chromosom... 44 0.41
52gb|AC166341.3| Mus musculus BAC clone RP23-430C21 from chromosom... 44 0.41
53gb|AC102130.7| Mus musculus chromosome 3, clone RP23-223I2, comp... 44 0.41
54gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, co... 44 0.41
55gb|AC121498.12| Mus musculus chromosome 1, clone RP23-38P22, com... 44 0.41
56gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, co... 44 0.41
57gb|AC165157.4| Mus musculus BAC clone RP23-267A24 from chromosom... 44 0.41
58gb|AC133286.15| Mus musculus chromosome 1, clone RP24-358J4, com... 44 0.41
59gb|AC102081.15| Mus musculus chromosome 18, clone RP23-43H5, com... 44 0.41
60gb|AC167963.5| Mus musculus chromosome 1, clone RP24-171A4, comp... 44 0.41
61gb|AC151369.4| Aotus nancymaae clone CH258-279B4, complete sequence 44 0.41
62gb|AC100500.10| Mus musculus chromosome 3, clone RP23-143I10, co... 44 0.41
63gb|AC118696.14| Mus musculus chromosome 3, clone RP24-62O16, com... 44 0.41
64gb|AC122309.5| Mus musculus BAC clone RP23-293G2 from chromosome... 44 0.41
65gb|AC103399.9| Mus musculus chromosome 3, clone RP23-310N18, com... 44 0.41
66gb|AC120348.9| Mus musculus chromosome 5, clone RP23-55P22, comp... 44 0.41
67gb|AC113041.9| Mus musculus chromosome 8, clone RP23-240K12, com... 44 0.41
68gb|AC101684.13| Mus musculus chromosome 1, clone RP23-187I13, co... 44 0.41
69gb|AC163358.3| Mus musculus BAC clone RP23-11M14 from chromosome... 44 0.41
70gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome... 44 0.41
71gb|AC167017.4| Mus musculus BAC clone RP24-86L13 from chromosome... 44 0.41
72gb|AC164302.2| Mus musculus BAC clone RP23-286N12 from chromosom... 44 0.41
73gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosom... 44 0.41
74gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, co... 44 0.41
75gb|AC122766.25| Mus musculus chromosome 3, clone RP24-111F24, co... 44 0.41
76gb|AC110509.21| Mus musculus chromosome 8, clone RP24-423G4, com... 44 0.41
77gb|AC164587.5| Mus musculus chromosome 5, clone RP24-222H12, com... 44 0.41
78gb|AC091455.12| Mus musculus chromosome 1, clone RP23-23O9, comp... 44 0.41
79gb|AC105948.9| Mus musculus chromosome 8, clone RP24-96N12, comp... 44 0.41
80gb|AC102603.11| Mus musculus chromosome 14, clone RP23-385I17, c... 44 0.41
81gb|AC158957.2| Mus musculus chromosome 15, clone RP23-27P5, comp... 44 0.41
82gb|AC162171.7| Mus musculus chromosome 5, clone RP23-143N11, com... 44 0.41
83gb|AF064864.1| Homo sapiens chromosome 21q22.3 PAC 21L13, comple... 44 0.41
84gb|AC100734.4| Mus musculus chromosome 15, clone RP24-316L11, co... 44 0.41
85gb|AC114679.10| Mus musculus chromosome 3, clone RP24-235E22, co... 44 0.41
86gb|AC005220.1| Homo sapiens chromosome 20, BAC clone 99 (LBNL H8... 44 0.41
87gb|AC165225.5| Mus musculus chromosome 3, clone RP24-70J13, comp... 44 0.41
88gb|AC166800.5| Mus musculus chromosome 1, clone RP24-260I21, com... 44 0.41
89gb|AC124981.25| Mus musculus chromosome 5, clone RP24-170P20, co... 44 0.41
90gb|AC102017.15| Mus musculus chromosome 5, clone RP24-571N6, com... 44 0.41
91gb|AC111116.13| Mus musculus chromosome 16, clone RP23-214I13, c... 44 0.41
92gb|AC161609.6| Mus musculus BAC clone RP23-139D15 from chromosom... 44 0.41
93gb|AC154354.2| Mus musculus BAC clone RP23-203C5 from chromosome... 44 0.41
94gb|AC119266.14| Mus musculus chromosome 13, clone RP24-321G8, co... 44 0.41
95gb|AC116776.12| Mus musculus chromosome 3, clone RP24-472H5, com... 44 0.41
96gb|AC165970.3| Mus musculus BAC clone RP23-129J20 from chromosom... 44 0.41
97gb|AC166989.4| Mus musculus BAC clone RP24-345J5 from chromosome... 44 0.41
98gb|AC158943.9| Mus musculus chromosome 1, clone RP24-272N10, com... 44 0.41
99gb|AC138641.10| Mus musculus chromosome 5, clone RP23-466K15, co... 44 0.41
100gb|AC131980.9| Mus musculus chromosome 1, clone RP24-170O7, comp... 44 0.41
101gb|AC103674.10| Mus musculus chromosome 15, clone RP24-329A8, co... 44 0.41
102gb|AC162854.7| Mus musculus chromosome 1, clone RP24-335B5, comp... 44 0.41
103gb|AC098570.7| Mus musculus chromosome 1, clone RP23-278N11, com... 44 0.41
104gb|AC119854.7| Mus musculus chromosome 3, clone RP23-234F9, comp... 44 0.41
105gb|AC091478.6| Mus musculus chromosome 3, clone RP23-469J3, comp... 44 0.41
106gb|AC102196.7| Mus musculus chromosome 3, clone RP24-445M20, com... 44 0.41
107gb|AC108422.10| Mus musculus chromosome 1, clone RP23-438D3, com... 44 0.41
108gb|AC147027.4| Pan troglodytes BAC clone RP43-92F2 from 7, compl... 44 0.41
109gb|AC118021.13| Mus musculus chromosome 7, clone RP23-459P15, co... 44 0.41
110gb|AC091473.2| Mus musculus chromosome X clones RP21-114F21, RP2... 44 0.41
111gb|AC116871.6| Mus musculus chromosome 19, clone RP24-417P12, co... 44 0.41
112gb|AC119822.38| Mus musculus chromosome 13, clone RP23-202P22, c... 44 0.41
113gb|AC148825.4| Pan troglodytes BAC clone CH251-539J12 from chrom... 44 0.41
114gb|AC119210.11| Mus musculus chromosome 18, clone RP24-190H7, co... 44 0.41
115gb|AC124026.2| Mus musculus chromosome X clone RP21-564N13 map q... 44 0.41
116gb|AC124023.2| Mus musculus chromosome X clone RP21-437J18 map q... 44 0.41
117gb|AC124022.2| Mus musculus chromosome X clone RP21-566N22 map q... 44 0.41
118gb|AC124021.2| Mus musculus chromosome X clone RP21-566N22 map q... 44 0.41
119gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosom... 44 0.41
120gb|AC134561.5| Mus musculus BAC clone RP24-111C16 from chromosom... 44 0.41
121gb|AC135361.3| Mus musculus BAC clone RP23-216A21 from chromosom... 44 0.41
122gb|AC115045.13| Mus musculus chromosome 6, clone RP24-315D19, co... 44 0.41
123gb|AC123731.9| Mus musculus chromosome 15, clone RP23-458N23, co... 44 0.41
124gb|AC182584.3| Pan troglodytes BAC clone CH251-530K15 from chrom... 44 0.41
125gb|AC044807.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 44 0.41
126gb|AC105062.13| Mus musculus chromosome 7, clone RP24-528E17, co... 44 0.41
127gb|AC161021.4| Pan troglodytes BAC clone CH251-2N24 from chromos... 44 0.41
128gb|AC161472.4| Pan troglodytes BAC clone CH251-584L3 from chromo... 44 0.41
129gb|AC102771.13| Mus musculus chromosome 1, clone RP23-175K23, co... 44 0.41
130gb|AC145952.3| Pan troglodytes BAC clone RP43-18D16 from 7, comp... 44 0.41
131gb|AC146018.3| Pan troglodytes BAC clone RP43-135A21 from 7, com... 44 0.41
132gb|AC147047.2| Mus musculus BAC clone RP23-97D19 from chromosome... 44 0.41
133gb|AC115297.7| Mus musculus BAC clone RP23-205H11 from chromosom... 44 0.41
134gb|AC131339.3| Mus musculus BAC clone RP23-226F20 from chromosom... 44 0.41
135gb|AC125151.4| Mus musculus BAC clone RP24-355K8 from chromosome... 44 0.41
136gb|AC157379.7| Mus musculus chromosome 3, clone RP23-20F10, comp... 44 0.41
137gb|AC161228.7| Mus musculus chromosome 3, clone RP24-77I5, compl... 44 0.41
138gb|AC120347.7| Mus musculus chromosome 13, clone RP23-262I3, com... 44 0.41
139gb|AC117740.12| Mus musculus chromosome 8, clone RP24-134P12, co... 44 0.41
140gb|AC117567.12| Mus musculus chromosome 16, clone RP24-380O24, c... 44 0.41
141gb|AC161490.7| Mus musculus chromosome 7, clone RP23-307M23, com... 44 0.41
142gb|AC024914.48| Mus musculus BAC Clone 262c6 RPCI-23, complete s... 44 0.41
143gb|AC145944.3| Gallus gallus chromosome UNK clone CH261-22N7, co... 44 0.41
144gb|AC099594.6| Mus musculus chromosome 15, clone RP23-458G7, com... 44 0.41
145gb|AC100208.16| Mus musculus chromosome 7, clone RP23-59J14, com... 44 0.41
146gb|AC166993.4| Mus musculus BAC clone RP23-467D18 from chromosom... 44 0.41
147gb|AC025794.9| Mus musculus chromosome 19, clone RP23-62O7, comp... 44 0.41
148gb|AC034254.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 44 0.41
149gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 44 0.41
150gb|AC164431.2| Mus musculus BAC clone RP23-430N15 from chromosom... 44 0.41
151gb|AC161537.7| Mus musculus chromosome 15, clone RP23-471J11, co... 44 0.41
152gb|AC118639.12| Mus musculus chromosome 15, clone RP24-112I4, co... 44 0.41
153gb|AC166256.5| Mus musculus BAC RP23-440F21 (Roswell Park Cance... 44 0.41
154gb|AC159708.13| Mus musculus 10 BAC RP23-110M21 (Roswell Park Ca... 44 0.41
155gb|AC162936.3| Mus musculus BAC clone RP23-108K5 from chromosome... 44 0.41
156gb|AC132284.5| Mus musculus BAC clone RP24-351O18 from chromosom... 44 0.41
157gb|AC154583.3| Mus musculus BAC clone RP23-248H18 from chromosom... 44 0.41
158gb|AC164554.2| Mus musculus BAC clone RP23-351O14 from chromosom... 44 0.41
159gb|AC131110.3| Mus musculus BAC clone RP23-387J23 from chromosom... 44 0.41
160gb|AC162790.2| Mus musculus chromosome 3, clone RP24-397C18, com... 44 0.41
161gb|AC005528.43| Mus musculus strain 129S6/SvEvTac clone rp21-493... 44 0.41
162gb|AC140981.3| Mus musculus chromosome 9 clone RP23-282G22, comp... 44 0.41
163gb|AC142448.3| Mus musculus BAC clone RP24-540M5 from chromosome... 44 0.41
164gb|AC092214.3| Homo sapiens BAC clone RP11-811J9 from 7, complet... 44 0.41
165gb|AC122896.4| Mus musculus BAC clone RP23-69N8 from chromosome ... 44 0.41
166gb|AC128705.4| Mus musculus BAC clone RP23-443P12 from chromosom... 44 0.41
167gb|AC132358.3| Mus musculus BAC clone RP24-133O24 from chromosom... 44 0.41
168gb|AC123830.5| Mus musculus BAC clone RP24-125B17 from chromosom... 44 0.41
169gb|AC134837.3| Mus musculus BAC clone RP24-338L20 from chromosom... 44 0.41
170gb|AC122321.4| Mus musculus BAC clone RP23-319I22 from chromosom... 44 0.41
171gb|AC123066.4| Mus musculus BAC clone RP23-262I13 from chromosom... 44 0.41
172gb|AY050668.1| Homo sapiens PKC-potentiated PP1 inhibitory prote... 44 0.41
173emb|CR937052.2| Rattus norvegicus chromosome 1 BAC CH230-445C15,... 44 0.41
174gb|AC116119.12| Mus musculus chromosome 12, clone RP23-76D19, co... 44 0.41
175gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosom... 44 0.41
176gb|AC126933.3| Mus musculus BAC clone RP24-117M7 from chromosome... 44 0.41
177gb|AC123798.5| Mus musculus BAC clone RP24-334O8 from chromosome... 44 0.41
178gb|AC130721.3| Mus musculus BAC clone RP24-333B3 from chromosome... 44 0.41
179gb|AC122482.4| Mus musculus BAC clone RP24-361E14 from chromosom... 44 0.41
180gb|AC133182.3| Mus musculus BAC clone RP24-181H19 from chromosom... 44 0.41
181gb|AC134535.4| Mus musculus BAC clone RP24-371E20 from chromosom... 44 0.41
182gb|AC132245.3| Mus musculus BAC clone RP24-420M8 from chromosome... 44 0.41
183gb|AC129590.4| Mus musculus BAC clone RP24-428B12 from chromosom... 44 0.41
184gb|AC124441.5| Mus musculus BAC clone RP24-176L17 from chromosom... 44 0.41
185gb|AC114821.4| Mus musculus BAC clone RP23-72K1 from chromosome ... 44 0.41
186gb|AC124601.5| Mus musculus BAC clone RP23-27M3 from chromosome ... 44 0.41
187gb|AC140352.3| Mus musculus BAC clone RP23-223L7 from chromosome... 44 0.41
188gb|AC127304.4| Mus musculus BAC clone RP23-285C13 from chromosom... 44 0.41
189gb|AC116585.3| Mus musculus BAC clone RP23-358A16 from chromosom... 44 0.41
190gb|AC124588.4| Mus musculus BAC clone RP23-133F15 from chromosom... 44 0.41
191gb|AC139757.4| Mus musculus BAC clone RP23-440H11 from chromosom... 44 0.41
192gb|AC122878.4| Mus musculus BAC clone RP23-116F15 from chromosom... 44 0.41
193gb|AC131080.13| Mus musculus chromosome 16, clone RP23-438H16, c... 44 0.41
194gb|AC111096.15| Mus musculus chromosome 3, clone RP23-174B18, co... 44 0.41
195gb|AC118020.11| Mus musculus, clone RP23-459B19, complete sequence 44 0.41
196gb|AC104231.10| Homo sapiens chromosome 15, clone RP11-96H23, co... 44 0.41
197gb|AC125340.3| Mus musculus BAC clone RP24-364H15 from chromosom... 44 0.41
198gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosom... 44 0.41
199gb|AC125154.3| Mus musculus BAC clone RP24-380C2 from chromosome... 44 0.41
200gb|AC123792.4| Mus musculus BAC clone RP24-309B14 from chromosom... 44 0.41
201gb|AC122041.4| Mus musculus BAC clone RP24-443H19 from chromosom... 44 0.41
202gb|AC122055.4| Mus musculus BAC clone RP24-465O15 from chromosom... 44 0.41
203gb|AC124359.3| Mus musculus BAC clone RP24-495G2 from chromosome... 44 0.41
204gb|AC129081.6| Mus musculus BAC clone RP24-274H24 from chromosom... 44 0.41
205gb|AC121809.3| Mus musculus BAC clone RP23-451B23 from chromosom... 44 0.41
206gb|AC121817.3| Mus musculus BAC clone RP23-458O1 from chromosome... 44 0.41
207gb|AC121826.3| Mus musculus BAC clone RP23-470O13 from chromosom... 44 0.41
208gb|AC121831.3| Mus musculus BAC clone RP24-66F17 from chromosome... 44 0.41
209gb|AC121829.3| Mus musculus BAC clone RP23-480P21 from chromosom... 44 0.41
210gb|AC124470.4| Mus musculus BAC clone RP24-174O2 from chromosome... 44 0.41
211gb|AC124582.4| Mus musculus BAC clone RP23-120A15 from 6, comple... 44 0.41
212gb|AC115356.5| Mus musculus BAC clone RP23-47E9 from 15, complet... 44 0.41
213gb|AC122865.3| Mus musculus BAC clone RP23-143B2 from 8, complet... 44 0.41
214gb|AC122862.4| Mus musculus BAC clone RP23-140O11 from 5, comple... 44 0.41
215gb|AC123557.4| Mus musculus BAC clone RP23-183P22 from 1, comple... 44 0.41
216gb|AC122841.4| Mus musculus BAC clone RP23-194E5 from 3, complet... 44 0.41
217gb|AC131711.3| Mus musculus BAC clone RP23-192M18 from 6, comple... 44 0.41
218gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, compl... 44 0.41
219gb|AC121567.3| Mus musculus BAC clone RP23-225D14 from 14, compl... 44 0.41
220gb|AC129333.4| Mus musculus BAC clone RP23-104F23 from 6, comple... 44 0.41
221gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, comple... 44 0.41
222gb|AC131663.3| Mus musculus BAC clone RP23-258B18 from 6, comple... 44 0.41
223gb|AC127329.3| Mus musculus BAC clone RP23-260A24 from 8, comple... 44 0.41
224gb|AC099413.3| Mus musculus BAC clone RP23-2O10 from 4, complete... 44 0.41
225gb|AC116572.3| Mus musculus BAC clone RP23-101D16 from 14, compl... 44 0.41
226gb|AC112701.6| Mus musculus BAC clone RP23-171A11 from 13, compl... 44 0.41
227gb|AC105407.5| Mus musculus BAC clone RP24-196J17 from 13, compl... 44 0.41
228gb|AC121957.2| Mus musculus BAC clone RP24-232G13 from 18, compl... 44 0.41
229gb|AC121981.3| Mus musculus BAC clone RP24-290K9 from 5, complet... 44 0.41
230gb|AC122496.2| Mus musculus BAC clone RP24-400K16 from 5, comple... 44 0.41
231gb|AC123802.2| Mus musculus BAC clone RP24-398M15 from 3, comple... 44 0.41
232gb|AC100752.10| Mus musculus chromosome 3, clone RP23-2A4, compl... 44 0.41
233gb|AC110514.9| Mus musculus chromosome 17, clone RP23-363P16, co... 44 0.41
234gb|AC096785.29| Mus musculus strain C57BL/6J clone rp23-382i2 ma... 44 0.41
235gb|AC101490.8| Mus musculus chromosome 3, clone RP23-188O2, comp... 44 0.41
236gb|AC019155.4| Homo sapiens BAC clone RP11-3B12 from 7, complete... 44 0.41
237gb|AC010082.4| Homo sapiens BAC clone RP11-109D3 from 7, complet... 44 0.41
238gb|AC092647.2| Homo sapiens BAC clone RP11-419M24 from 7, comple... 44 0.41
239gb|AC006337.5| Homo sapiens BAC clone RP11-535N23 from 7, comple... 44 0.41
240gb|AC004538.1| Homo sapiens PAC clone RP5-887P4 from 7, complete... 44 0.41
241gb|AC116468.13| Mus musculus chromosome 16, clone RP23-166G21, c... 44 0.41
242gb|AC110918.9| Mus musculus chromosome 5, clone RP23-189P23, com... 44 0.41
243gb|AC116465.8| Mus musculus chromosome 10, clone RP23-64J3, comp... 44 0.41
244gb|AC102105.8| Mus musculus chromosome 12, clone RP23-89G24, com... 44 0.41
245gb|AC103939.8| Mus musculus chromosome 18, clone RP23-300E7, com... 44 0.41
246gb|AC158751.7| Mus musculus chromosome 7, clone RP23-413C19, com... 44 0.41
247gb|AC164537.3| Mus musculus chromosome 7, clone RP23-68N11, comp... 44 0.41
248gb|AC161825.13| Mus musculus 10 BAC RP23-35O24 (Roswell Park Can... 44 0.41
249gb|AC150314.5| Mus musculus BAC clone RP23-269O24 from chromosom... 44 0.41
250gb|AC154577.2| Mus musculus BAC clone RP23-375G9 from chromosome... 44 0.41
251gb|AC166057.2| Mus musculus BAC clone RP23-385D11 from chromosom... 44 0.41
252gb|AC134528.6| Mus musculus BAC clone RP24-502G8 from chromosome... 44 0.41
253gb|AC110557.10| Mus musculus chromosome 5, clone RP23-250P16, co... 44 0.41
254gb|AC164433.4| Mus musculus BAC clone RP23-357G5 from chromosome... 44 0.41
255gb|AC153656.4| Mus musculus BAC clone RP23-428O19 from chromosom... 44 0.41
256gb|AC096625.25| Mus musculus strain C57BL/6J clone rp23-388i7 ma... 44 0.41
257gb|AC159466.3| Mus musculus 10 BAC RP23-388A21 (Roswell Park Can... 44 0.41
258gb|AC118728.12| Mus musculus chromosome 1, clone RP24-168F13, co... 44 0.41
259emb|AL163283.2|HS21C083 Homo sapiens chromosome 21 segment HS21C083 44 0.41
260gb|AC161761.3| Mus musculus BAC clone RP23-379E17 from chromosom... 44 0.41
261gb|AC161046.2| Mus musculus BAC clone RP24-266E5 from chromosome... 44 0.41
262gb|AC163665.4| Mus musculus BAC clone RP23-325J23 from chromosom... 44 0.41
263gb|AC164003.2| Mus musculus chromosome 18, clone RP23-480F11, co... 44 0.41
264ref|NM_006372.3| Homo sapiens synaptotagmin binding, cytoplasmic... 44 0.41
265gb|AC102609.7| Mus musculus, clone RP23-403I3, complete sequence 44 0.41
266gb|AC083867.7| Homo sapiens chromosome 7 clone RP11-183I20, comp... 44 0.41
267emb|AL158042.9| Human DNA sequence from clone RP11-103J8 on chro... 44 0.41
268emb|AL731569.18| Human DNA sequence from clone RP11-77P6 on chro... 44 0.41
269emb|AL607035.12| Human DNA sequence from clone RP11-570G20 on ch... 44 0.41
270emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chr... 44 0.41
271emb|AL591890.31| Human DNA sequence from clone RP11-54A22 on chr... 44 0.41
272emb|AL591901.12| Human DNA sequence from clone RP11-400C4 on chr... 44 0.41
273emb|AL592423.8| Human DNA sequence from clone RP11-1A24 on chrom... 44 0.41
274emb|AL589864.14| Human DNA sequence from clone RP13-63P20 on chr... 44 0.41
275emb|AL590704.13| Human DNA sequence from clone RP11-106E7 on chr... 44 0.41
276emb|AL445466.9| Human DNA sequence from clone RP11-453O22 on chr... 44 0.41
277emb|AL445473.7| Human DNA sequence from clone RP11-214M7 on chro... 44 0.41
278emb|AL390876.19| Human DNA sequence from clone RP11-394D2 on chr... 44 0.41
279gb|AC022773.17| Mus musculus chromosome X, clone RP23-157B8, com... 44 0.41
280emb|AL356513.15| Human DNA sequence from clone RP11-108A15 on ch... 44 0.41
281emb|AL354720.14| Human DNA sequence from clone RP11-505F3 on chr... 44 0.41
282emb|AL162419.34| Human DNA sequence from clone RP11-358M14 on ch... 44 0.41
283gb|AY231293.1| Chlamydomonas reinhardtii long flagella protein L... 44 0.41
284emb|AL161935.10| Human DNA sequence from clone RP11-472N13 on ch... 44 0.41
285emb|AL161638.10| Human DNA sequence from clone RP4-591L5 on chro... 44 0.41
286emb|AL157895.8| Human DNA sequence from clone RP11-354E11 on chr... 44 0.41
287emb|AL136082.22| Human DNA sequence from clone RP1-3J17 on chrom... 44 0.41
288emb|AL136230.9| Human DNA sequence from clone RP1-95I21 on chrom... 44 0.41
289emb|AL133293.28| Human DNA sequence from clone RP5-823N20 on chr... 44 0.41
290emb|AL121712.27|HSJ710H13 Human DNA sequence from clone RP4-710H... 44 0.41
291emb|AL080274.21|HS1012F16 Human DNA sequence from clone RP5-1012... 44 0.41
292emb|AL049736.10|HSDJ723E3 Human DNA sequence from clone RP4-723E... 44 0.41
293gb|AC157904.3| Mus musculus chromosome 18, clone RP23-379G12, co... 44 0.41
294gb|AC158228.3| Mus musculus chromosome 5, clone RP23-118K12, com... 44 0.41
295emb|AL022149.2|HS122K23 Human DNA sequence from clone RP1-122K23... 44 0.41
296emb|AL009177.1|HS365E2 Human DNA sequence from clone RP3-365E2 o... 44 0.41
297gb|AC111648.6| Rattus norvegicus 2 BAC CH230-103N18 (Children's ... 44 0.41
298gb|AC103688.4| Homo sapiens chromosome 8, clone CTD-3046C4, comp... 44 0.41
299gb|AC163090.5| Mus musculus chromosome 8, clone RP23-457I3, comp... 44 0.41
300gb|AC166327.1| Mus musculus BAC clone RP23-175K2 from chromosome... 44 0.41
301gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosom... 44 0.41
302gb|AC161921.5| Mus musculus chromosome 1, clone RP24-402C17, com... 44 0.41
303emb|BX897676.1| Neurospora crassa DNA linkage group VI BAC clone... 44 0.41
304gb|AC165284.2| Mus musculus BAC clone RP24-378E14 from chromosom... 44 0.41
305gb|AC163342.2| Mus musculus BAC clone RP24-115M13 from chromosom... 44 0.41
306gb|AC153894.8| Mus musculus 6 BAC RP23-118E20 (Roswell Park Canc... 44 0.41
307gb|AC163347.4| Mus musculus BAC clone RP23-259F13 from chromosom... 44 0.41
308emb|AL713870.26| Mouse DNA sequence from clone RP24-239D8 on chr... 44 0.41
309emb|AL645845.14| Mouse DNA sequence from clone RP23-338J18 on ch... 44 0.41
310gb|AC158132.6| Mus musculus chromosome 1, clone RP23-11K8, compl... 44 0.41
311gb|AC156268.10| Mus musculus 10 BAC RP24-336P23 (Roswell Park Ca... 44 0.41
312gb|AC123298.4| Rattus norvegicus BAC CH230-352N4 (Children's Ho... 44 0.41
313gb|AC164615.3| Mus musculus BAC clone RP23-320N6 from chromosome... 44 0.41
314gb|AC153950.8| Mus musculus 10 BAC RP24-444M16 (Roswell Park Can... 44 0.41
315gb|AC153153.4| Mus musculus BAC clone RP23-79G18 from chromosome... 44 0.41
316gb|AC161590.2| Mus musculus BAC clone RP24-300B21 from chromosom... 44 0.41
317emb|AL591126.18| Mouse DNA sequence from clone RP23-188A3 on chr... 44 0.41
318emb|BX255938.7| Mouse DNA sequence from clone RP23-333B5 on chro... 44 0.41
319emb|AL646097.25| Mouse DNA sequence from clone RP23-338M9 on chr... 44 0.41
320emb|AL646054.20| Mouse DNA sequence from clone RP23-157N11 on ch... 44 0.41
321emb|AL669871.18| Mouse DNA sequence from clone RP23-48J15 on chr... 44 0.41
322emb|AL669979.13| Mouse DNA sequence from clone RP23-93O11 on chr... 44 0.41
323emb|AL672173.9| Mouse DNA sequence from clone RP23-149O19 on chr... 44 0.41
324emb|AL929426.8| Mouse DNA sequence from clone RP23-471H23 on chr... 44 0.41
325emb|AL645584.27| Mouse DNA sequence from clone RP23-280M7 on chr... 44 0.41
326emb|AL603793.4| Mouse DNA sequence from clone RP23-131A14 on chr... 44 0.41
327emb|CR932800.1| Mus musculus chromosome 2, clone ResGen-169L23 s... 44 0.41
328emb|BX682542.5| Mouse DNA sequence from clone RP23-125N5 on chro... 44 0.41
329emb|AL928642.5| Mouse DNA sequence from clone RP24-191C1 on chro... 44 0.41
330emb|BX119969.4| Mouse DNA sequence from clone RP23-58N9 on chrom... 44 0.41
331emb|AL845255.2| Mouse DNA sequence from clone RP23-298K19 on chr... 44 0.41
332emb|AL606528.7| Mouse DNA sequence from clone RP23-45H23 on chro... 44 0.41
333gb|AC161347.2| Mus musculus chromosome 15, clone RP23-273M5, com... 44 0.41
334gb|AC153634.3| Mus musculus 6 BAC RP23-368O2 (Roswell Park Cance... 44 0.41
335gb|AC092711.14| Mus musculus chromosome 5, clone RP23-7D3, compl... 44 0.41
336gb|AC140930.3| Mus musculus BAC clone RP23-116P20 from chromosom... 44 0.41
337gb|AC161426.5| Mus musculus BAC clone RP23-69L13 from chromosome... 44 0.41
338gb|AC160139.2| Mus musculus BAC clone RP23-93P8 from chromosome ... 44 0.41
339gb|AC159822.2| Mus musculus BAC clone RP23-152C21 from chromosom... 44 0.41
340gb|AC159897.2| Mus musculus BAC clone RP23-191E14 from chromosom... 44 0.41
341gb|AC163900.3| Mus musculus BAC clone RP23-151K15 from chromosom... 44 0.41
342gb|AC108726.9| Homo sapiens 3 BAC RP11-385G14 (Roswell Park Canc... 44 0.41
343gb|AC117507.5| Homo sapiens 3 BAC RP11-137K3 (Roswell Park Cance... 44 0.41
344gb|AC055788.7| Homo sapiens chromosome 8, clone RP11-252H14, com... 44 0.41
345gb|AC022389.9| Homo sapiens chromosome 10 clone RP11-124L5, comp... 44 0.41
346gb|AC018525.8| Homo sapiens chromosome 8, clone RP11-3J13, compl... 44 0.41
347gb|AC103853.2| Homo sapiens chromosome 8, clone RP11-642D21, com... 44 0.41
348gb|AC116559.30| Papio anubis clone rp41-339c10, complete sequence 44 0.41
349gb|AC116558.21| Papio anubis clone rp41-273g19, complete sequence 44 0.41
350gb|AC068989.36| Homo sapiens 4 BAC RP11-662D13 (Roswell Park Can... 44 0.41
351gb|AC074321.10| Homo sapiens chromosome 10 clone RP11-122F14, co... 44 0.41
352gb|AC084429.5| Mus Musculus Chromosome 2 Clone RP23-291P1, compl... 44 0.41
353gb|AC087116.13| Mus Musculus Strain C57BL6/J Chromosome 15~RP23-... 44 0.41
354gb|AC116664.1| Papio hamadryas, clone RP41-57E23, complete sequence 44 0.41
355gb|AC063960.10| Homo sapiens chromosome 10 clone RP11-105F10, co... 44 0.41
356gb|AC008914.7| Homo sapiens chromosome 5 clone CTD-2270I16, comp... 44 0.41
357gb|AC084740.5| Homo sapiens BAC clone RP11-423E20 from 4, comple... 44 0.41
358gb|AC112640.3| Homo sapiens 3 BAC RP11-817M15 (Roswell Park Canc... 44 0.41
359gb|AC111198.4| Homo sapiens BAC clone RP11-602O1 from 4, complet... 44 0.41
360gb|AC093183.3| Homo sapiens chromosome 7 clone RP11-786I1, compl... 44 0.41
361gb|AC108075.3| Homo sapiens BAC clone RP11-728C8 from 4, complet... 44 0.41
362gb|AC093166.6| Homo sapiens BAC clone RP11-1429F20 from 2, compl... 44 0.41
363gb|AC025289.6| Homo sapiens chromosome 16 clone RP11-533D19, com... 44 0.41
364gb|AC159905.3| Pan troglodytes BAC clone CH251-347E2 from chromo... 44 0.41
365gb|AC009638.9| Homo sapiens chromosome 11, clone RP11-47K5, comp... 44 0.41
366gb|AC051642.5| Homo sapiens chromosome 8, clone RP11-583M2, comp... 44 0.41
367gb|AC007844.32| Mus musculus strain 129/Sv ES cell line CJ7 chro... 44 0.41
368gb|AC019133.8| Homo sapiens BAC clone RP11-577G20 from 4, comple... 44 0.41
369gb|AC020716.3| Homo sapiens BAC clone RP11-449G13 from 16, compl... 44 0.41
370gb|AC139035.12| Mus musculus chromosome 5, clone RP23-348E9, com... 44 0.41
371gb|AC156984.9| Mus musculus chromosome 5, clone RP23-418H8, comp... 44 0.41
372gb|AC019205.4| Homo sapiens BAC clone RP11-398K22 from 6, comple... 44 0.41
373gb|AC040927.18| Mus musculus chromosome 5, clone RP23-186A21, co... 44 0.41
374gb|AC008378.6| Homo sapiens chromosome 5 clone CTC-209H22, compl... 44 0.41
375gb|AC129196.5| Mus musculus BAC clone RP24-161C8 from chromosome... 44 0.41
376gb|AC156996.7| Mus musculus chromosome 3, clone RP23-284A15, com... 44 0.41
377gb|AC163646.2| Mus musculus BAC clone RP23-207D1 from chromosome... 44 0.41
378gb|AC157511.2| Mus musculus BAC clone RP24-456J10 from chromosom... 44 0.41
379gb|AC159710.9| Mus musculus 10 BAC RP24-325N16 (Roswell Park Can... 44 0.41
380gb|AC151598.2| Medicago truncatula chromosome 2 BAC clone mte1-4... 44 0.41
381gb|AC151895.4| Mus musculus BAC clone RP24-323A22 from chromosom... 44 0.41
382gb|AC163035.2| Mus musculus BAC clone RP23-301L2 from chromosome... 44 0.41
383gb|AC090519.3| Homo sapiens chromosome 15 clone RP11-616K22 map ... 44 0.41
384gb|AY046056.1| Mus musculus zonadhesin (Zan) gene, complete cds 44 0.41
385emb|AL935162.15| Mouse DNA sequence from clone RP24-463M4 on chr... 44 0.41
386gb|AC107828.16| Mus musculus chromosome 18, clone RP23-213N4, co... 44 0.41
387gb|AC139044.6| Mus musculus chromosome 15, clone RP23-249A8, com... 44 0.41
388gb|AC073940.4| Homo sapiens chromosome 15 clone CTD-2190J1 map 1... 44 0.41
389gb|AC158239.2| Mus musculus BAC clone RP23-48A24 from chromosome... 44 0.41
390gb|AC154639.2| Mus musculus BAC clone RP23-306D9 from chromosome... 44 0.41
391gb|AC161379.2| Mus musculus BAC clone RP23-207P12 from chromosom... 44 0.41
392gb|AC159258.2| Mus musculus BAC clone RP24-87A4 from chromosome ... 44 0.41
393gb|AC134333.3| Mus musculus BAC clone RP24-140M19 from chromosom... 44 0.41
394gb|AC154701.2| Mus musculus BAC clone RP24-344N20 from chromosom... 44 0.41
395gb|AC154729.2| Mus musculus BAC clone RP24-377H17 from chromosom... 44 0.41
396gb|AC158390.2| Mus musculus BAC clone RP24-401O3 from chromosome... 44 0.41
397gb|AC158388.2| Mus musculus BAC clone RP24-545I9 from chromosome... 44 0.41
398gb|AC135355.3| Mus musculus BAC clone RP24-495F22 from chromosom... 44 0.41
399gb|AC153646.3| Mus musculus BAC clone RP24-493K8 from chromosome... 44 0.41
400gb|AC079308.15| Homo sapiens 3 BAC RP11-57P12 (Roswell Park Canc... 44 0.41
401gb|AC008857.6| Homo sapiens chromosome 5 clone CTD-2180C22, comp... 44 0.41
402gb|AC055716.24|AC055716 Homo sapiens 12 BAC RP11-641A6 (Roswell ... 44 0.41
403gb|AC011454.6|AC011454 Homo sapiens chromosome 19 clone CTC-347E... 44 0.41
404gb|AC153435.6| Mus musculus 6 BAC RP23-112L19 (Roswell Park Canc... 44 0.41
405gb|AC119995.22| Mus musculus chromosome 3, clone RP24-120B18, co... 44 0.41
406gb|AC156949.9| Mus musculus 10 BAC RP24-347J14 (Roswell Park Can... 44 0.41
407gb|AC159711.8| Mus musculus 10 BAC RP23-214N15 (Roswell Park Can... 44 0.41
408gb|AC129563.14| Mus musculus chromosome 15, clone RP23-223M20, c... 44 0.41
409emb|AL929088.23| Mouse DNA sequence from clone RP23-360J2 on chr... 44 0.41
410gb|AF312033.1|AF312033 Mus musculus acetylcholinesterase (Ache) ... 44 0.41
411gb|AC025281.8| Homo sapiens chromosome 16 clone RP11-356O24, com... 44 0.41
412gb|AC007603.5| Homo sapiens chromosome 16 clone RP11-305A4, comp... 44 0.41
413gb|AC007491.7| Homo sapiens chromosome 16 clone RP11-182C10, com... 44 0.41
414emb|AL603782.5| Mouse DNA sequence from clone RP23-480M4 on chro... 44 0.41
415gb|AC122744.16| Mus musculus chromosome 5, clone RP23-37I24, com... 44 0.41
416dbj|AP006504.1| Mus musculus genomic DNA, chromosome 4, clone: R... 44 0.41
417gb|AC104840.2| Homo sapiens BAC clone RP11-10E9 from 4, complete... 44 0.41
418gb|AC021878.4| Homo sapiens BAC clone RP11-18N21 from 4, complet... 44 0.41
419gb|AC079080.5| Homo sapiens BAC clone RP11-162O12 from 4, comple... 44 0.41
420gb|AC093777.4| Homo sapiens BAC clone RP11-166N24 from 4, comple... 44 0.41
421emb|AL772181.23| Mouse DNA sequence from clone RP23-118H3 on chr... 44 0.41
422gb|AC082651.6| Homo sapiens BAC clone RP11-521D12 from 2, comple... 44 0.41
423gb|AC016761.10| Homo sapiens BAC clone RP11-538A12 from 2, compl... 44 0.41
424gb|AC105399.3| Homo sapiens BAC clone RP11-715P7 from 2, complet... 44 0.41
425gb|AC069205.6| Homo sapiens BAC clone RP11-735P12 from 2, comple... 44 0.41
426gb|AC158314.5| Mus musculus chromosome 7, clone RP23-145E21, com... 44 0.41
427gb|AC153568.5| Mus musculus 10 BAC RP23-66K22 (Roswell Park Canc... 44 0.41
428gb|AC159150.5| Mus musculus BAC RP23-339M5 (Roswell Park Cancer... 44 0.41
429gb|AC123600.18| Mus musculus chromosome 7, clone RP23-62J11, com... 44 0.41
430gb|AC107739.9| Mus musculus chromosome 7, clone RP23-345M1, comp... 44 0.41
431gb|AC154807.2| Mus musculus BAC clone RP23-79E7 from chromosome ... 44 0.41
432gb|AC158237.2| Mus musculus BAC clone RP23-142I8 from chromosome... 44 0.41
433gb|AC154637.2| Mus musculus BAC clone RP23-303N14 from chromosom... 44 0.41
434gb|AC154576.2| Mus musculus BAC clone RP23-372B6 from chromosome... 44 0.41
435gb|AC154545.2| Mus musculus BAC clone RP23-431G16 from chromosom... 44 0.41
436gb|AC154183.2| Mus musculus BAC clone RP23-474E16 from chromosom... 44 0.41
437gb|AC158158.6| Mus musculus chromosome 1, clone RP23-10D8, compl... 44 0.41
438gb|AC074046.9|AC074046 Mus musculus 5 BAC RP23-440C1 (Roswell Pa... 44 0.41
439gb|AC018638.5|AC018638 Homo sapiens chromosome 7 clone RP11-274B... 44 0.41
440gb|AC093526.5| Homo sapiens chromosome 16 clone RP11-213K2, comp... 44 0.41
441gb|AC092326.4| Homo sapiens chromosome 16 clone RP11-14N9, compl... 44 0.41
442gb|AC026472.8| Homo sapiens chromosome 16 clone RP11-511J24, com... 44 0.41
443gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome... 44 0.41
444gb|AC133645.5| Mus musculus BAC clone RP23-73O10 from chromosome... 44 0.41
445gb|AC142455.4| Mus musculus BAC clone RP23-179B15 from chromosom... 44 0.41
446gb|AC156022.2| Mus musculus BAC clone RP23-201E13 from chromosom... 44 0.41
447gb|AC157493.3| Mus musculus BAC clone RP23-321K7 from chromosome... 44 0.41
448gb|AC142260.6| Mus musculus BAC clone RP24-508M8 from chromosome... 44 0.41
449gb|AC144800.3| Mus musculus BAC clone RP24-257N2 from chromosome... 44 0.41
450gb|AC157090.6| Mus musculus 10 BAC RP24-360A19 (Roswell Park Can... 44 0.41
451gb|AC138811.3| Homo sapiens chromosome 16 clone RP11-1035H13, co... 44 0.41
452gb|AC013445.8| Homo sapiens BAC clone RP11-489J10 from 2, comple... 44 0.41
453gb|AC027348.8| Homo sapiens chromosome 16 clone CTD-2595P9, comp... 44 0.41
454gb|AC105303.23| Mus musculus strain C57BL/6J chromosome 2 clone ... 44 0.41
455gb|AC067721.22| Homo sapiens 3 BAC RP11-111F10 (Roswell Park Can... 44 0.41
456gb|AC083899.6| Homo sapiens BAC clone RP11-223J6 from 2, complet... 44 0.41
457gb|AC015971.4| Homo sapiens BAC clone RP11-269K22 from 2, comple... 44 0.41
458gb|AC107070.4| Homo sapiens BAC clone RP11-293H4 from 2, complet... 44 0.41
459gb|AC010373.7| Homo sapiens chromosome 16 clone CTD-2053O6, comp... 44 0.41
460gb|AC021646.35| Homo sapiens 12 BAC RP11-511B23 (Roswell Park Ca... 44 0.41
461gb|AC160991.3| Mus musculus BAC clone RP23-187D8 from chromosome... 44 0.41
462gb|AC011479.7| Homo sapiens chromosome 19 clone CTB-102L5, compl... 44 0.41
463gb|AC130454.2| Homo sapiens chromosome 16 clone CTA-345G4, compl... 44 0.41
464gb|AC136431.3| Homo sapiens chromosome 16 clone RP11-148M17, com... 44 0.41
465gb|AC026888.6|AC026888 Homo sapiens chromosome 14 clone CTD-2243... 44 0.41
466gb|AC136618.3| Homo sapiens chromosome 16 clone RP11-457I16, com... 44 0.41
467gb|AC092855.39| Mus musculus strain C57BL/6J chromosome 3 clone ... 44 0.41
468gb|AC009451.21| Homo sapiens chromosome 17, clone CTD-2286H12, c... 44 0.41
469gb|AC034099.16| Mus Musculus Strain C57BL6/J Chromosome 7 BAC, R... 44 0.41
470gb|AC164661.3| Pan troglodytes BAC clone CH251-11F8 from chromos... 44 0.41
471gb|AC126760.4| Homo sapiens chromosome 16 clone RP11-1307B12, co... 44 0.41
472gb|AC122335.4| Mus musculus BAC clone RP23-350F7 from chromosome... 44 0.41
473gb|AC009134.6|AC009134 Homo sapiens chromosome 16 clone RP11-505... 44 0.41
474gb|AC103644.15| Mus musculus chromosome 7, clone RP24-361F3, com... 44 0.41
475dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 44 0.41
476gb|AC012147.7|AC012147 Mus musculus, clone RP23-191A4, complete ... 44 0.41
477gb|AC109183.17| Mus musculus chromosome 15, clone RP24-86P1, com... 44 0.41
478emb|AL805956.22| Mouse DNA sequence from clone RP23-239F1 on chr... 44 0.41
479emb|BX571848.8| Mouse DNA sequence from clone RP24-194N17 on chr... 44 0.41
480gb|AC100956.9| Mus musculus chromosome 7, clone RP23-74B10, comp... 44 0.41
481emb|AL928974.12| Mouse DNA sequence from clone RP23-56C2 on chro... 44 0.41
482emb|BX530084.11| Mouse DNA sequence from clone RP24-548D9 on chr... 44 0.41
483gb|AC110266.15| Mus musculus chromosome 1, clone RP23-319C1, com... 44 0.41
484emb|AL670413.19| Mouse DNA sequence from clone RP23-298E4 on chr... 44 0.41
485emb|AL929170.16| Mouse DNA sequence from clone RP23-451M16 on ch... 44 0.41
486emb|AL844608.18| Mouse DNA sequence from clone RP23-27L22 on chr... 44 0.41
487emb|AL929219.16| Mouse DNA sequence from clone RP23-53I18 on chr... 44 0.41
488emb|BX005055.5| Zebrafish DNA sequence from clone CH211-188N23 i... 44 0.41
489gb|AC018365.49| Mus musculus strain 129/SvJ clone mgs1-461b11 ma... 44 0.41
490gb|AC005780.1|AC005780 Homo sapiens chromosome 19, cosmid F23049... 44 0.41
491gb|AC157824.1| Mus musculus BAC clone RP23-265E4 from 1, complet... 44 0.41
492gb|AC004998.2|AC004998 Homo sapiens PAC clone RP1-164D5 from Xq2... 44 0.41
493gb|AC121513.15| Mus musculus chromosome 18, clone RP24-391B9, co... 44 0.41
494gb|AC102304.6| Mus musculus chromosome 7, clone RP24-403P14, com... 44 0.41
495gb|AC103897.3| Papio anubis clone RP41-461D5, complete sequence 44 0.41
496emb|AL163213.2|HS21C013 Homo sapiens chromosome 21 segment HS21C013 44 0.41
497gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome... 44 0.41
498gb|AC005877.3|AC005877 citb_19_o_18, complete sequence 44 0.41
499gb|AC150560.5| Mus musculus BAC clone RP23-16I14 from 15, comple... 44 0.41
500gb|AC149089.4| Mus musculus BAC clone RP23-94H23 from 6, complet... 44 0.41

>emb|AJ488507.1|TAE488507 Triticum aestivum mRNA for triacylglycerol lipase (lipase gene),
           cultivar Hereward
          Length = 1053

 Score =  192 bits (97), Expect = 7e-46
 Identities = 124/133 (93%)
 Strand = Plus / Plus

                                                                       
Query: 337 atggagcgccgcgggttgctcaaggcggctctgctggcgtgcttgctcgtcgtctgctcc 396
           |||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||
Sbjct: 1   atggagcgccgcgggttgctcaagacggctctactggcgtgcttgctcgtcgtatgctcc 60

                                                                       
Query: 397 gccagagtacctacagttatacaacagccatccgctaacatatacaactcaacccttgcc 456
           |  ||||||||||  |||||||||||||||||| ||| ||||||||||||||||||||||
Sbjct: 61  gggagagtacctatggttatacaacagccatccactaccatatacaactcaacccttgcc 120

                        
Query: 457 aagacactagtgg 469
           |||||||||||||
Sbjct: 121 aagacactagtgg 133



to top

>emb|AJ488508.1|TAE488508 Triticum aestivum mRNA for triacylglycerol lipase (lipase gene),
           cultivar Cadenza
          Length = 1186

 Score =  170 bits (86), Expect = 3e-39
 Identities = 124/136 (91%), Gaps = 3/136 (2%)
 Strand = Plus / Plus

                                                                       
Query: 337 atggagcgccgcgggttgctcaaggcggctctgctggcgt---gcttgctcgtcgtctgc 393
           |||||||||||||||||||||||||||||||| |||||||   |||||||||| || |||
Sbjct: 1   atggagcgccgcgggttgctcaaggcggctctactggcgtcgtgcttgctcgtggtttgc 60

                                                                       
Query: 394 tccgccagagtacctacagttatacaacagccatccgctaacatatacaactcaaccctt 453
           ||||  ||||||||||| |||||||| ||||||||| ||| |||||||||||||||||||
Sbjct: 61  tccgggagagtacctacggttatacagcagccatccactaccatatacaactcaaccctt 120

                           
Query: 454 gccaagacactagtgg 469
           ||||||||||||||||
Sbjct: 121 gccaagacactagtgg 136



to top

>gb|AC164955.2| Mus musculus BAC clone RP24-233H9 from chromosome 9, complete sequence
          Length = 221907

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             ||||||||||||||||||||||| ||||||
Sbjct: 40096 cttcccttcccttcccttgcctcccctccc 40067



to top

>emb|AL731553.12| Human DNA sequence from clone RP11-56M3 on chromosome 10 Contains a
             nudix (nucleoside diphosphate linked moiety X)-type
             pseudogene, complete sequence
          Length = 99089

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||||||||||
Sbjct: 59459 cttcccttcccttcccttccctctcctccc 59430



to top

>gb|AC122353.5| Mus musculus BAC clone RP23-391E17 from chromosome 16, complete sequence
          Length = 200401

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||||||||||
Sbjct: 135442 cttcccttcccttcccttccctctcctccc 135413



to top

>gb|AC129888.3| Atelerix albiventris clone LB4-495B20, complete sequence
          Length = 149724

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 1      cttcccttcccttcccttgcctctcctcc 29
              |||||||||||||||||| ||||||||||
Sbjct: 114579 cttcccttcccttccctttcctctcctcc 114607



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 1      cttcccttcccttcccttgcctctcctc 28
              |||||||||||||||||| ||| |||||
Sbjct: 114574 cttcccttcccttcccttccctttcctc 114601



to top

>emb|AL592215.12| Mouse DNA sequence from clone RP23-172P19 on chromosome 11 Contains two
             novel genes (4930452L02Rik and B430319H21Rik), the 3' end
             of the gene for a novel protein (1700019I23Rik), the gene
             for a novel protein (4933407G07Rik), the Pmp22 gene for
             peripheral myelin protein and a CpG island, complete
             sequence
          Length = 219468

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 1     cttcccttcccttcccttgcctctcctcc 29
             |||||||||||||||||| ||||||||||
Sbjct: 83469 cttcccttcccttcccttccctctcctcc 83441



to top

>gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold
          Length = 2136267

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 1       cttcccttcccttcccttgcctctcctcc 29
               |||||||||||||||||| ||||||||||
Sbjct: 1685779 cttcccttcccttccctttcctctcctcc 1685807



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 1       cttcccttcccttcccttgcctctcctcc 29
               |||||||||||||||||| |||| |||||
Sbjct: 1828202 cttcccttcccttcccttccctcccctcc 1828174



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 1       cttcccttcccttcccttgcctctcctc 28
               |||||||||||||||||| ||| |||||
Sbjct: 1685774 cttcccttcccttcccttccctttcctc 1685801



to top

>gb|AC118640.8| Mus musculus chromosome 15, clone RP24-112A20, complete sequence
          Length = 179510

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 1      cttcccttcccttcccttgcctct 24
              ||||||||||||||||||||||||
Sbjct: 159149 cttcccttcccttcccttgcctct 159172



to top

>gb|AC127292.4| Mus musculus BAC clone RP23-375J3 from chromosome 9, complete sequence
          Length = 157088

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 1      cttcccttcccttcccttgcctctcctc 28
              |||||||||||||||||| |||||||||
Sbjct: 120553 cttcccttcccttcccttccctctcctc 120580



to top

>gb|AC123863.4| Mus musculus BAC clone RP23-364A19 from chromosome 5, complete sequence
          Length = 218179

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 1     cttcccttcccttcccttgcctctcctc 28
             |||||||||||||||||| |||||||||
Sbjct: 57149 cttcccttcccttcccttccctctcctc 57176



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 1     cttcccttcccttcccttgcctctcctc 28
             |||||||||||||||||  |||||||||
Sbjct: 57154 cttcccttcccttccctctcctctcctc 57181



to top

>gb|AC165350.3| Mus musculus BAC clone RP23-249A17 from chromosome 12, complete sequence
          Length = 227048

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 2      ttcccttcccttcccttgcctctcctcc 29
              ||||||||||||||||| ||||||||||
Sbjct: 136170 ttcccttcccttcccttccctctcctcc 136143



to top

>emb|AL031429.11|HS333A15 Human DNA sequence from clone RP3-333A15 on chromosome 1p31.1-31.3
              Contains the 5' end of the PTGER3 gene for prostaglandin E
              receptor 3 (subtype EP3), part of a novel gene and a CpG
              island, complete sequence
          Length = 133221

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 2      ttcccttcccttcccttgcctctcctcc 29
              ||||||||||||||||| ||||||||||
Sbjct: 116531 ttcccttcccttcccttccctctcctcc 116504



to top

>gb|AC151265.3| Mus musculus BAC clone RP24-372H7 from chromosome 17, complete
            sequence
          Length = 191739

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1    cttcccttcccttcccttgcctctcctc 28
            |||||||||||||||||| |||||||||
Sbjct: 8606 cttcccttcccttcccttccctctcctc 8633



to top

>gb|AC110797.4| Homo sapiens BAC clone RP11-637M3 from 4, complete sequence
          Length = 32196

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 1     cttcccttcccttcccttgcctct 24
             ||||||||||||||||||||||||
Sbjct: 23678 cttcccttcccttcccttgcctct 23655



to top

>gb|AC122327.5| Mus musculus BAC clone RP23-339D20 from chromosome 12, complete sequence
          Length = 217167

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 2      ttcccttcccttcccttgcctctcctcc 29
              ||||||||||||||||| ||||||||||
Sbjct: 217155 ttcccttcccttcccttccctctcctcc 217128



to top

>gb|AC144813.3| Mus musculus BAC clone RP24-324I23 from 9, complete sequence
          Length = 146104

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 1      cttcccttcccttcccttgcctctcctc 28
              |||||||||||||||||| |||||||||
Sbjct: 114705 cttcccttcccttcccttccctctcctc 114678



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 114735 cttcccttcccttcccttccctcccctccc 114706



to top

>gb|AC118234.10| Mus musculus chromosome 15, clone RP23-463J9, complete sequence
          Length = 198519

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 1     cttcccttcccttcccttgcctct 24
             ||||||||||||||||||||||||
Sbjct: 24972 cttcccttcccttcccttgcctct 24995



to top

>gb|AC163709.3| Gallus gallus BAC clone CH261-60F22 from chromosome ul, complete
             sequence
          Length = 210984

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 1     cttcccttcccttcccttgcctct 24
             ||||||||||||||||||||||||
Sbjct: 32711 cttcccttcccttcccttgcctct 32688



to top

>gb|AC156163.2| Mus musculus BAC clone RP24-122E11 from chromosome 9, complete sequence
          Length = 141660

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 117416 cttcccttcccttcccttccctctcct 117442



to top

>gb|AC127252.3| Mus musculus BAC clone RP24-276A6 from chromosome 3, complete sequence
          Length = 173199

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 164205 cttcccttcccttcccttccctctcct 164179



to top

>gb|AC122901.4| Mus musculus BAC clone RP23-40D21 from chromosome 10, complete sequence
          Length = 207598

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 1     cttcccttcccttcccttgcctctcct 27
             |||||||||||||||||| ||||||||
Sbjct: 30791 cttcccttcccttcccttccctctcct 30817



to top

>gb|AC124686.3| Mus musculus BAC clone RP24-422F20 from chromosome 10, complete sequence
          Length = 194018

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 163524 cttcccttcccttcccttccctctcct 163550



to top

>gb|AC127313.3| Mus musculus BAC clone RP23-311A21 from 5, complete sequence
          Length = 195651

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 111792 cttcccttcccttcccttccctctcct 111766



to top

>emb|AL161945.31| Human DNA sequence from clone RP4-606D23 on chromosome 20 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 70299

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 4     cccttcccttcccttgcctctcctccc 30
             ||||||||||||||| |||||||||||
Sbjct: 60162 cccttcccttcccttccctctcctccc 60188



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             ||||||||||||| |||| |||||||||||
Sbjct: 60215 cttcccttcccttgccttccctctcctccc 60244



to top

>gb|AC091536.2| Rattus norvegicus strain Brown Norway clone RP31-547A5, complete
             sequence
          Length = 175512

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 1     cttcccttcccttcccttgcctctcct 27
             |||||||||||||||||| ||||||||
Sbjct: 67100 cttcccttcccttccctttcctctcct 67126



to top

>gb|AC091588.6| Homo sapiens chromosome 18, clone RP11-627G18, complete sequence
          Length = 165420

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1     cttcccttcccttcccttgcctc 23
             |||||||||||||||||||||||
Sbjct: 53539 cttcccttcccttcccttgcctc 53561



to top

>emb|AL606805.21| Mouse DNA sequence from clone RP23-449F16 on chromosome 11 Contains the
              5' end of the Lpo gene for lactoperoxidase, a novel gene,
              the Epx gene for eosinophil peroxidase, the Olfr462,
              Olfr463 and Olfr464 genes for olfactory receptors 462, 463
              and 464, a novel gene, a cytochrome c oxidase subunit VIc
              (Cox6c) pseudogene, a ubiquitin-conjugating enzyme E2B (S.
              cerevisiae RAD6 homology) (Ube2b) pseudogene and the 3' end
              of the gene for dynein light chain 2 (6720463E02Rik),
              complete sequence
          Length = 184069

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 106264 cttcccttcccttcccttccctctcct 106238



to top

>gb|AC159825.2| Mus musculus BAC clone RP23-100J21 from chromosome 9, complete sequence
          Length = 209633

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 1     cttcccttcccttcccttgcctctcct 27
             |||||||||||||||||| ||||||||
Sbjct: 38802 cttcccttcccttcccttccctctcct 38828



to top

>gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome 9, complete sequence
          Length = 241917

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 231870 cttcccttcccttcccttccctctcct 231896



to top

>gb|AC137875.13| Mus musculus chromosome 15, clone RP23-62B15, complete sequence
          Length = 195956

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 1     cttcccttcccttcccttgcctctcct 27
             |||||||||||||||||| ||||||||
Sbjct: 17921 cttcccttcccttcccttccctctcct 17895



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 1     cttcccttcccttcccttgcctctcct 27
             |||||||||||||||||| ||||||||
Sbjct: 17816 cttcccttcccttcccttccctctcct 17790



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 1     cttcccttcccttcccttgcctctcct 27
             |||||||||||||||||| ||||||||
Sbjct: 17791 cttcccttcccttcccttccctctcct 17765



to top

>gb|AY057907.1| Mus musculus brain-derived neurotrophic factor (Bdnf) gene, complete
             cds, alternatively spliced
          Length = 80945

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 1     cttcccttcccttcccttgcctctcct 27
             |||||||||||||||||||||| ||||
Sbjct: 80912 cttcccttcccttcccttgcctttcct 80938



to top

>gb|AC158989.1| Mus musculus BAC clone RP23-399H20 from chromosome 3, complete sequence
          Length = 190372

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 139292 cttcccttcccttcccttccctctcct 139318



to top

>gb|AC091043.12| Homo sapiens chromosome 18, clone RP11-595B24, complete sequence
          Length = 208310

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1     cttcccttcccttcccttgcctc 23
             |||||||||||||||||||||||
Sbjct: 13659 cttcccttcccttcccttgcctc 13637



to top

>gb|AC107045.9| Mus musculus chromosome 1, clone RP23-334J7, complete sequence
          Length = 222700

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 1     cttcccttcccttcccttgcctctcct 27
             |||||||||||||||||| ||||||||
Sbjct: 23588 cttcccttcccttcccttccctctcct 23614



to top

>emb|AL713918.22| Mouse DNA sequence from clone RP23-350D7 on chromosome 4, complete
             sequence
          Length = 180282

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 2     ttcccttcccttcccttgcctct 24
             |||||||||||||||||||||||
Sbjct: 97298 ttcccttcccttcccttgcctct 97276



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 173312 cttcccttcccttcccttccctcccctccc 173283



to top

>gb|AC154192.3| Mus musculus BAC clone RP24-70F14 from chromosome 17, complete sequence
          Length = 234088

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 108753 cttcccttcccttcccttccctctcct 108779



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 108665 cttcccttcccttcccttccctctcct 108691



to top

>gb|AC134615.5| Mus musculus BAC clone RP23-148H3 from 8, complete sequence
          Length = 199454

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 100552 cttcccttcccttcccttccctctcct 100526



to top

>gb|AC138616.4| Mus musculus BAC clone RP23-403D16 from 9, complete sequence
          Length = 196304

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 1      cttcccttcccttcccttgcctctcct 27
              |||||||||||||||||| ||||||||
Sbjct: 154590 cttcccttcccttcccttccctctcct 154564



to top

>gb|AC150033.2| Mus musculus BAC clone RP23-449N19 from 3, complete sequence
          Length = 179293

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 1     cttcccttcccttcccttgcctctcct 27
             |||||||||||||||||| ||||||||
Sbjct: 59827 cttcccttcccttcccttccctctcct 59801



to top

>gb|AC121281.19| Mus musculus chromosome 3, clone RP23-61G16, complete sequence
          Length = 196761

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 138679 cttcccttcccttcccttccctcccctccc 138650



to top

>gb|AC115727.10| Mus musculus chromosome 3, clone RP23-30A13, complete sequence
          Length = 183826

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              ||||||| |||||||||| |||||||||||
Sbjct: 125824 cttccctccccttcccttccctctcctccc 125853



to top

>gb|AC104554.7| Mus musculus chromosome 5, clone RP24-441E22, complete sequence
          Length = 176408

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 49359 cttcccttcccttcccttccctcccctccc 49388



to top

>gb|AC153801.1| Mus musculus 10 NOVECTOR RP24-255E19 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 156755

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1     cttcccttcccttcccttgcct 22
             ||||||||||||||||||||||
Sbjct: 18590 cttcccttcccttcccttgcct 18611



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1     cttcccttcccttcccttgcct 22
             ||||||||||||||||||||||
Sbjct: 18560 cttcccttcccttcccttgcct 18581



to top

>gb|AC103636.11| Mus musculus chromosome 5, clone RP24-373A18, complete sequence
          Length = 185727

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 42704 cttcccttcccttcccttccctcccctccc 42733



to top

>gb|AC102908.11| Mus musculus chromosome 16, clone RP24-288K2, complete sequence
          Length = 174803

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 33108 cttcccttcccttcccttccctcccctccc 33079



to top

>gb|AC121147.8| Mus musculus chromosome 3, clone RP24-369O15, complete sequence
          Length = 178352

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 123890 cttcccttcccttcccttccctcccctccc 123861



to top

>gb|AC152953.1| Mus musculus 10 BAC RP23-403E19 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 211343

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 23987 cttcccttcccttcccttccctcccctccc 23958



to top

>gb|AC101593.16| Mus musculus chromosome 18, clone RP23-198A7, complete sequence
          Length = 206936

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 200498 cttcccttcccttcccttccctcccctccc 200469



to top

>gb|AC122357.4| Mus musculus BAC clone RP23-403O8 from chromosome 13, complete sequence
          Length = 203039

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 112218 cttcccttcccttcccttccctcccctccc 112189



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 43951 cttcccttcccttcccttccctcccctccc 43922



to top

>gb|AC160121.2| Mus musculus BAC clone RP23-402P14 from chromosome 13, complete
             sequence
          Length = 183152

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 78728 cttcccttcccttcccttccctcccctccc 78699



to top

>gb|AC166341.3| Mus musculus BAC clone RP23-430C21 from chromosome 12, complete
          sequence
          Length = 196418

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                        
Query: 1  cttcccttcccttcccttgcctctcctccc 30
          |||||||||||||||||  |||||||||||
Sbjct: 17 cttcccttcccttccctcccctctcctccc 46



to top

>gb|AC102130.7| Mus musculus chromosome 3, clone RP23-223I2, complete sequence
          Length = 176409

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 173328 cttcccttcccttcccttccctcccctccc 173357



to top

>gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, complete sequence
          Length = 184600

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 155061 cttcccttcccttcccttccctcccctccc 155090



to top

>gb|AC121498.12| Mus musculus chromosome 1, clone RP23-38P22, complete sequence
          Length = 152264

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 87578 cttcccttcccttcccttccctcccctccc 87549



to top

>gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, complete sequence
          Length = 162317

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 31527 cttcccttcccttcccttccctcccctccc 31556



to top

>gb|AC165157.4| Mus musculus BAC clone RP23-267A24 from chromosome 12, complete sequence
          Length = 205444

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 150339 cttcccttcccttcccttccctcccctccc 150310



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 150280 cttcccttcccttccctttcctcccctccc 150251



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 3      tcccttcccttcccttgcctctcctccc 30
              |||||||||||||||| ||| |||||||
Sbjct: 150283 tcccttcccttcccttccctttcctccc 150256



to top

>gb|AC133286.15| Mus musculus chromosome 1, clone RP24-358J4, complete sequence
          Length = 169772

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 121518 cttcccttcccttcccttccctcccctccc 121547



to top

>gb|AC102081.15| Mus musculus chromosome 18, clone RP23-43H5, complete sequence
          Length = 245125

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 18293 cttcccttcccttcccttccctcccctccc 18322



to top

>gb|AC167963.5| Mus musculus chromosome 1, clone RP24-171A4, complete sequence
          Length = 172954

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 1     cttcccttcccttcccttgcctctcc 26
             |||||||||||||||||| |||||||
Sbjct: 66623 cttcccttcccttcccttccctctcc 66648



to top

>gb|AC151369.4| Aotus nancymaae clone CH258-279B4, complete sequence
          Length = 196485

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 19152 cttcccttcccttcccttccctcccctccc 19123



to top

>gb|AC100500.10| Mus musculus chromosome 3, clone RP23-143I10, complete sequence
          Length = 179369

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 25309 cttcccttcccttcccttccctcccctccc 25338



to top

>gb|AC118696.14| Mus musculus chromosome 3, clone RP24-62O16, complete sequence
          Length = 190616

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 36479 cttcccttcccttcccttccctcccctccc 36450



to top

>gb|AC122309.5| Mus musculus BAC clone RP23-293G2 from chromosome 14, complete sequence
          Length = 208443

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 36009 cttcccttcccttcccttccctcccctccc 36038



to top

>gb|AC103399.9| Mus musculus chromosome 3, clone RP23-310N18, complete sequence
          Length = 154918

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 75989 cttcccttcccttcccttccctcccctccc 75960



to top

>gb|AC120348.9| Mus musculus chromosome 5, clone RP23-55P22, complete sequence
          Length = 244565

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 12003 cttcccttcccttcccttccctcccctccc 11974



to top

>gb|AC113041.9| Mus musculus chromosome 8, clone RP23-240K12, complete sequence
          Length = 175827

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 52494 cttcccttcccttcccttccctcccctccc 52523



to top

>gb|AC101684.13| Mus musculus chromosome 1, clone RP23-187I13, complete sequence
          Length = 227440

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 223304 cttcccttcccttcccttccctcccctccc 223333



to top

>gb|AC163358.3| Mus musculus BAC clone RP23-11M14 from chromosome 14, complete sequence
          Length = 208634

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 173199 cttcccttcccttcccttccctcccctccc 173228



to top

>gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome 12, complete sequence
          Length = 199262

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 119927 cttcccttcccttcccttccctcccctccc 119898



to top

>gb|AC167017.4| Mus musculus BAC clone RP24-86L13 from chromosome 9, complete sequence
          Length = 183068

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 33645 cttcccttcccttcccttccctcccctccc 33674



to top

>gb|AC164302.2| Mus musculus BAC clone RP23-286N12 from chromosome 16, complete
             sequence
          Length = 192765

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 79458 cttcccttcccttcccttccctcccctccc 79487



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 79393 cttcccttcccttcccttccctcccctccc 79422



to top

>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence
          Length = 196951

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 70555 cttcccttcccttcccttccctcccctccc 70584



to top

>gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, complete sequence
          Length = 224193

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||  |||||||||||
Sbjct: 15127 cttcccttcccttccctcccctctcctccc 15098



to top

>gb|AC122766.25| Mus musculus chromosome 3, clone RP24-111F24, complete sequence
          Length = 145902

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 84580 cttcccttcccttcccttccctcccctccc 84551



to top

>gb|AC110509.21| Mus musculus chromosome 8, clone RP24-423G4, complete sequence
          Length = 190160

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 133913 cttcccttcccttcccttccctcccctccc 133884



to top

>gb|AC164587.5| Mus musculus chromosome 5, clone RP24-222H12, complete sequence
          Length = 176841

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 1    cttcccttcccttcccttgcctctcctccc 30
            |||||||||||||||||| |||| ||||||
Sbjct: 2043 cttcccttcccttcccttccctcccctccc 2072



to top

>gb|AC091455.12| Mus musculus chromosome 1, clone RP23-23O9, complete sequence
          Length = 257924

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 82002 cttcccttcccttcccttccctcccctccc 81973



to top

>gb|AC105948.9| Mus musculus chromosome 8, clone RP24-96N12, complete sequence
          Length = 143798

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 25874 cttcccttcccttcccttccctcccctccc 25845



to top

>gb|AC102603.11| Mus musculus chromosome 14, clone RP23-385I17, complete sequence
          Length = 204565

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1      cttcccttcccttcccttgcct 22
              ||||||||||||||||||||||
Sbjct: 107864 cttcccttcccttcccttgcct 107885



to top

>gb|AC158957.2| Mus musculus chromosome 15, clone RP23-27P5, complete sequence
          Length = 187390

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 5     ccttcccttcccttgcctctcctccc 30
             |||||||||||||| |||||||||||
Sbjct: 43052 ccttcccttcccttccctctcctccc 43027



to top

>gb|AC162171.7| Mus musculus chromosome 5, clone RP23-143N11, complete sequence
          Length = 229553

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1      cttcccttcccttcccttgcct 22
              ||||||||||||||||||||||
Sbjct: 195074 cttcccttcccttcccttgcct 195095



to top

>gb|AF064864.1| Homo sapiens chromosome 21q22.3 PAC 21L13, complete sequence
          Length = 120007

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 83790 cttcccttcccttcccttccctcccctccc 83761



to top

>gb|AC100734.4| Mus musculus chromosome 15, clone RP24-316L11, complete sequence
          Length = 182088

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 149846 cttcccttcccttcccttccctcccctccc 149875



to top

>gb|AC114679.10| Mus musculus chromosome 3, clone RP24-235E22, complete sequence
          Length = 157152

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 20031 cttcccttcccttcccttccctcccctccc 20002



to top

>gb|AC005220.1| Homo sapiens chromosome 20, BAC clone 99 (LBNL H80), complete sequence
          Length = 163196

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 93081 cttcccttcccttcccttccctcccctccc 93052



to top

>gb|AC165225.5| Mus musculus chromosome 3, clone RP24-70J13, complete sequence
          Length = 205069

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 76940 cttcccttcccttcccttccctcccctccc 76911



to top

>gb|AC166800.5| Mus musculus chromosome 1, clone RP24-260I21, complete sequence
          Length = 162752

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 147519 cttcccttcccttcccttccctcccctccc 147548



to top

>gb|AC124981.25| Mus musculus chromosome 5, clone RP24-170P20, complete sequence
          Length = 153767

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 52562 cttcccttcccttcccttccctcccctccc 52591



to top

>gb|AC102017.15| Mus musculus chromosome 5, clone RP24-571N6, complete sequence
          Length = 119681

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 72036 cttcccttcccttcccttccctcccctccc 72065



to top

>gb|AC111116.13| Mus musculus chromosome 16, clone RP23-214I13, complete sequence
          Length = 173839

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 88169 cttcccttcccttcccttccctcccctccc 88140



to top

>gb|AC161609.6| Mus musculus BAC clone RP23-139D15 from chromosome 14, complete sequence
          Length = 219723

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||  |||||||||||
Sbjct: 209271 cttcccttcccttccctcccctctcctccc 209242



to top

>gb|AC154354.2| Mus musculus BAC clone RP23-203C5 from chromosome 14, complete sequence
          Length = 238278

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 14634 cttcccttcccttcccttccctcccctccc 14663



to top

>gb|AC119266.14| Mus musculus chromosome 13, clone RP24-321G8, complete sequence
          Length = 174035

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 51144 cttcccttcccttcccttccctcccctccc 51115



to top

>gb|AC116776.12| Mus musculus chromosome 3, clone RP24-472H5, complete sequence
          Length = 170076

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 135438 cttcccttcccttcccttccctcccctccc 135467



to top

>gb|AC165970.3| Mus musculus BAC clone RP23-129J20 from chromosome 6, complete sequence
          Length = 207303

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 155036 cttcccttcccttcccttccctcccctccc 155007



to top

>gb|AC166989.4| Mus musculus BAC clone RP24-345J5 from chromosome 16, complete sequence
          Length = 232228

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 207688 cttcccttcccttcccttccctcccctccc 207659



to top

>gb|AC158943.9| Mus musculus chromosome 1, clone RP24-272N10, complete sequence
          Length = 186003

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 132938 cttcccttcccttcccttccctcccctccc 132909



to top

>gb|AC138641.10| Mus musculus chromosome 5, clone RP23-466K15, complete sequence
          Length = 175628

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 88897 cttcccttcccttcccttccctcccctccc 88926



to top

>gb|AC131980.9| Mus musculus chromosome 1, clone RP24-170O7, complete sequence
          Length = 200100

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 35062 cttcccttcccttcccttccctcccctccc 35033



to top

>gb|AC103674.10| Mus musculus chromosome 15, clone RP24-329A8, complete sequence
          Length = 142740

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 108529 cttcccttcccttcccttccctcccctccc 108558



to top

>gb|AC162854.7| Mus musculus chromosome 1, clone RP24-335B5, complete sequence
          Length = 162297

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 117937 cttcccttcccttcccttccctcccctccc 117966



to top

>gb|AC098570.7| Mus musculus chromosome 1, clone RP23-278N11, complete sequence
          Length = 193097

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 127530 cttcccttcccttcccttccctcccctccc 127501



to top

>gb|AC119854.7| Mus musculus chromosome 3, clone RP23-234F9, complete sequence
          Length = 210547

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| ||| |||||||
Sbjct: 17810 cttcccttcccttcccttccctttcctccc 17839



to top

>gb|AC091478.6| Mus musculus chromosome 3, clone RP23-469J3, complete sequence
          Length = 253738

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 210846 cttcccttcccttcccttccctcccctccc 210817



to top

>gb|AC102196.7| Mus musculus chromosome 3, clone RP24-445M20, complete sequence
          Length = 166532

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 86507 cttcccttcccttcccttccctcccctccc 86536



to top

>gb|AC108422.10| Mus musculus chromosome 1, clone RP23-438D3, complete sequence
          Length = 173372

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 1     cttcccttcccttcccttgcctctcc 26
             |||||||||||||||||| |||||||
Sbjct: 38581 cttcccttcccttcccttccctctcc 38606



to top

>gb|AC147027.4| Pan troglodytes BAC clone RP43-92F2 from 7, complete sequence
          Length = 162023

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 106999 cttcccttcccttcccttccctcccctccc 106970



to top

>gb|AC118021.13| Mus musculus chromosome 7, clone RP23-459P15, complete sequence
          Length = 196441

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 184636 cttcccttcccttcccttccctcccctccc 184607



to top

>gb|AC091473.2| Mus musculus chromosome X clones RP21-114F21, RP21-430D6 complete
              sequence
          Length = 221860

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 157760 cttcccttcccttcccttccctcccctccc 157731



to top

>gb|AC116871.6| Mus musculus chromosome 19, clone RP24-417P12, complete sequence
          Length = 161959

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 36224 cttcccttcccttcccttccctcccctccc 36195



to top

>gb|AC119822.38| Mus musculus chromosome 13, clone RP23-202P22, complete sequence
          Length = 213736

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 149245 cttcccttcccttcccttccctcccctccc 149216



to top

>gb|AC148825.4| Pan troglodytes BAC clone CH251-539J12 from chromosome 7, complete
             sequence
          Length = 181673

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 92483 cttcccttcccttcccttccctcccctccc 92512



to top

>gb|AC119210.11| Mus musculus chromosome 18, clone RP24-190H7, complete sequence
          Length = 198006

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 121410 cttcccttcccttcccttccctcccctccc 121381



to top

>gb|AC124026.2| Mus musculus chromosome X clone RP21-564N13 map qA7.2, complete sequence
          Length = 178239

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 174171 cttcccttcccttcccttccctcccctccc 174200



to top

>gb|AC124023.2| Mus musculus chromosome X clone RP21-437J18 map qA7.2, complete
            sequence
          Length = 168775

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 1    cttcccttcccttcccttgcctctcctccc 30
            |||||||||||||||||| |||| ||||||
Sbjct: 4465 cttcccttcccttcccttccctcccctccc 4494



to top

>gb|AC124022.2| Mus musculus chromosome X clone RP21-566N22 map qA7.2, complete
             sequence
          Length = 163107

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 75992 cttcccttcccttcccttccctcccctccc 76021



to top

>gb|AC124021.2| Mus musculus chromosome X clone RP21-566N22 map qA7.2, complete
             sequence
          Length = 152943

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 70151 cttcccttcccttcccttccctcccctccc 70180



to top

>gb|AC146609.3| Mus musculus BAC clone RP23-162K11 from chromosome 14, complete
             sequence
          Length = 199215

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 33171 cttcccttcccttcccttccctcccctccc 33200



to top

>gb|AC134561.5| Mus musculus BAC clone RP24-111C16 from chromosome 8, complete sequence
          Length = 179978

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 55781 cttcccttcccttcccttccctcccctccc 55752



to top

>gb|AC135361.3| Mus musculus BAC clone RP23-216A21 from chromosome 14, complete
             sequence
          Length = 203946

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 96615 cttcccttcccttcccttccctcccctccc 96586



to top

>gb|AC115045.13| Mus musculus chromosome 6, clone RP24-315D19, complete sequence
          Length = 177917

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 130815 cttcccttcccttcccttccctcccctccc 130844



to top

>gb|AC123731.9| Mus musculus chromosome 15, clone RP23-458N23, complete sequence
          Length = 178222

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 32553 cttcccttcccttcccttccctcccctccc 32524



to top

>gb|AC182584.3| Pan troglodytes BAC clone CH251-530K15 from chromosome 2, complete
             sequence
          Length = 206103

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 27412 cttcccttcccttcccttccctcccctccc 27383



to top

>gb|AC044807.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-412F2, complete
            sequence
          Length = 182150

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 1    cttcccttcccttcccttgcctctcctccc 30
            |||||||||||||||||| |||| ||||||
Sbjct: 8157 cttcccttcccttcccttccctcccctccc 8186



to top

>gb|AC105062.13| Mus musculus chromosome 7, clone RP24-528E17, complete sequence
          Length = 162502

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 148623 cttcccttcccttcccttccctcccctccc 148594



to top

>gb|AC161021.4| Pan troglodytes BAC clone CH251-2N24 from chromosome 7, complete sequence
          Length = 187139

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 148909 cttcccttcccttcccttccctcccctccc 148880



to top

>gb|AC161472.4| Pan troglodytes BAC clone CH251-584L3 from chromosome 7, complete
             sequence
          Length = 189756

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 12795 cttcccttcccttcccttccctcccctccc 12766



to top

>gb|AC102771.13| Mus musculus chromosome 1, clone RP23-175K23, complete sequence
          Length = 226416

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 66452 cttcccttcccttcccttccctcccctccc 66423



to top

>gb|AC145952.3| Pan troglodytes BAC clone RP43-18D16 from 7, complete sequence
          Length = 160354

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 72943 cttcccttcccttcccttccctcccctccc 72914



to top

>gb|AC146018.3| Pan troglodytes BAC clone RP43-135A21 from 7, complete sequence
          Length = 177841

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 81158 cttcccttcccttcccttccctcccctccc 81187



to top

>gb|AC147047.2| Mus musculus BAC clone RP23-97D19 from chromosome 6, complete sequence
          Length = 239653

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 179021 cttcccttcccttcccttccctcccctccc 179050



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 2      ttcccttcccttcccttgcctctcctccc 30
              ||||||||||||||||| |||| ||||||
Sbjct: 233173 ttcccttcccttcccttccctcccctccc 233201



to top

>gb|AC115297.7| Mus musculus BAC clone RP23-205H11 from chromosome 10, complete
             sequence
          Length = 171350

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 13627 cttcccttcccttcccttccctcccctccc 13598



to top

>gb|AC131339.3| Mus musculus BAC clone RP23-226F20 from chromosome 16, complete
             sequence
          Length = 180384

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 69384 cttcccttcccttcccttccctcccctccc 69355



to top

>gb|AC125151.4| Mus musculus BAC clone RP24-355K8 from chromosome 14, complete sequence
          Length = 202916

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 86875 cttcccttcccttcccttccctcccctccc 86846



to top

>gb|AC157379.7| Mus musculus chromosome 3, clone RP23-20F10, complete sequence
          Length = 183455

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 138968 cttcccttcccttcccttccctcccctccc 138939



to top

>gb|AC161228.7| Mus musculus chromosome 3, clone RP24-77I5, complete sequence
          Length = 222551

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 47860 cttcccttcccttcccttccctcccctccc 47831



to top

>gb|AC120347.7| Mus musculus chromosome 13, clone RP23-262I3, complete sequence
          Length = 227644

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 175844 cttcccttcccttcccttccctcccctccc 175873



to top

>gb|AC117740.12| Mus musculus chromosome 8, clone RP24-134P12, complete sequence
          Length = 186401

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 64240 cttcccttcccttcccttccctcccctccc 64211



to top

>gb|AC117567.12| Mus musculus chromosome 16, clone RP24-380O24, complete sequence
          Length = 195972

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1      cttcccttcccttcccttgcct 22
              ||||||||||||||||||||||
Sbjct: 110098 cttcccttcccttcccttgcct 110119



to top

>gb|AC161490.7| Mus musculus chromosome 7, clone RP23-307M23, complete sequence
          Length = 169596

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 59455 cttcccttcccttcccttccctcccctccc 59426



to top

>gb|AC024914.48| Mus musculus BAC Clone 262c6 RPCI-23, complete sequence
          Length = 205922

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 164648 cttcccttcccttcccttccctcccctccc 164619



to top

>gb|AC145944.3| Gallus gallus chromosome UNK clone CH261-22N7, complete sequence
          Length = 215147

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 45755 cttcccttcccttcccttccctcccctccc 45726



to top

>gb|AC099594.6| Mus musculus chromosome 15, clone RP23-458G7, complete sequence
          Length = 220242

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| ||| |||||||
Sbjct: 109837 cttcccttcccttcccttccctttcctccc 109866



to top

>gb|AC100208.16| Mus musculus chromosome 7, clone RP23-59J14, complete sequence
          Length = 280763

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 118362 cttcccttcccttcccttccctcccctccc 118391



to top

>gb|AC166993.4| Mus musculus BAC clone RP23-467D18 from chromosome 17, complete sequence
          Length = 199776

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 138488 cttcccttcccttcccttccctcccctccc 138459



to top

>gb|AC025794.9| Mus musculus chromosome 19, clone RP23-62O7, complete sequence
          Length = 242418

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 116288 cttcccttcccttcccttccctcccctccc 116259



to top

>gb|AC034254.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-257K10, complete
             sequence
          Length = 116022

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 23326 cttcccttcccttcccttccctcccctccc 23355



to top

>gb|AC084163.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-287D23, complete
             sequence
          Length = 214292

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 48115 cttcccttcccttcccttccctcccctccc 48144



to top

>gb|AC164431.2| Mus musculus BAC clone RP23-430N15 from chromosome 17, complete
             sequence
          Length = 190724

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 10286 cttcccttcccttcccttccctcccctccc 10257



to top

>gb|AC161537.7| Mus musculus chromosome 15, clone RP23-471J11, complete sequence
          Length = 188471

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 1      cttcccttcccttcccttgcctctcc 26
              |||||||||||||||||| |||||||
Sbjct: 185721 cttcccttcccttcccttccctctcc 185696



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 147015 cttcccttcccttccctttcctcccctccc 147044



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| ||| |||||||
Sbjct: 147010 cttcccttcccttcccttccctttcctccc 147039



to top

>gb|AC118639.12| Mus musculus chromosome 15, clone RP24-112I4, complete sequence
          Length = 166053

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| ||| |||||||
Sbjct: 155148 cttcccttcccttcccttccctttcctccc 155119



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 155143 cttcccttcccttccctttcctcccctccc 155114



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 1      cttcccttcccttcccttgcctctcc 26
              |||||||||||||||||| |||||||
Sbjct: 116438 cttcccttcccttcccttccctctcc 116463



to top

>gb|AC166256.5| Mus musculus  BAC RP23-440F21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 181903

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 150529 cttcccttcccttcccttccctcccctccc 150500



to top

>gb|AC159708.13| Mus musculus 10 BAC RP23-110M21 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 238622

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             ||||||||||||||| || |||||||||||
Sbjct: 78749 cttcccttcccttcctttccctctcctccc 78778



to top

>gb|AC162936.3| Mus musculus BAC clone RP23-108K5 from chromosome 14, complete sequence
          Length = 236917

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 232074 cttcccttcccttcccttccctcccctccc 232045



to top

>gb|AC132284.5| Mus musculus BAC clone RP24-351O18 from chromosome 5, complete sequence
          Length = 174681

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 97312 cttcccttcccttcccttccctcccctccc 97283



to top

>gb|AC154583.3| Mus musculus BAC clone RP23-248H18 from chromosome 13, complete
             sequence
          Length = 191052

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 33882 cttcccttcccttcccttccctcccctccc 33911



to top

>gb|AC164554.2| Mus musculus BAC clone RP23-351O14 from chromosome 17, complete sequence
          Length = 192632

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 168927 cttcccttcccttcccttccctcccctccc 168956



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1     cttcccttcccttcccttgcct 22
             ||||||||||||||||||||||
Sbjct: 47448 cttcccttcccttcccttgcct 47469



to top

>gb|AC131110.3| Mus musculus BAC clone RP23-387J23 from chromosome 6, complete sequence
          Length = 205463

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 125158 cttcccttcccttcccttccctcccctccc 125129



to top

>gb|AC162790.2| Mus musculus chromosome 3, clone RP24-397C18, complete sequence
          Length = 169244

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 130532 cttcccttcccttcccttccctcccctccc 130561



to top

>gb|AC005528.43| Mus musculus strain 129S6/SvEvTac clone rp21-493n6 map 11a2, complete
             sequence
          Length = 199326

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 75461 cttcccttcccttcccttccctcccctccc 75490



to top

>gb|AC140981.3| Mus musculus chromosome 9 clone RP23-282G22, complete sequence
          Length = 174329

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||  |||||||||||
Sbjct: 69663 cttcccttcccttccctcccctctcctccc 69692



to top

>gb|AC142448.3| Mus musculus BAC clone RP24-540M5 from chromosome 18, complete sequence
          Length = 170302

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 79639 cttcccttcccttcccttccctcccctccc 79610



to top

>gb|AC092214.3| Homo sapiens BAC clone RP11-811J9 from 7, complete sequence
          Length = 72045

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 69477 cttcccttcccttcccttccctcccctccc 69506



to top

>gb|AC122896.4| Mus musculus BAC clone RP23-69N8 from chromosome 10, complete
            sequence
          Length = 232473

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 1    cttcccttcccttcccttgcctctcctccc 30
            |||||||||||||||||| |||| ||||||
Sbjct: 5825 cttcccttcccttcccttccctcccctccc 5854



to top

>gb|AC128705.4| Mus musculus BAC clone RP23-443P12 from chromosome 9, complete sequence
          Length = 192271

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||  |||||||||||
Sbjct: 12900 cttcccttcccttccctcccctctcctccc 12929



to top

>gb|AC132358.3| Mus musculus BAC clone RP24-133O24 from chromosome 18, complete
             sequence
          Length = 182085

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 49743 cttcccttcccttcccttccctcccctccc 49772



to top

>gb|AC123830.5| Mus musculus BAC clone RP24-125B17 from chromosome 7, complete sequence
          Length = 186045

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 131605 cttcccttcccttcccttccctcccctccc 131634



to top

>gb|AC134837.3| Mus musculus BAC clone RP24-338L20 from chromosome 16, complete sequence
          Length = 175319

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 127376 cttcccttcccttcccttccctcccctccc 127347



to top

>gb|AC122321.4| Mus musculus BAC clone RP23-319I22 from chromosome 12, complete
             sequence
          Length = 167106

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 78760 cttcccttcccttcccttccctcccctccc 78789



to top

>gb|AC123066.4| Mus musculus BAC clone RP23-262I13 from chromosome 19, complete
             sequence
          Length = 206333

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 85697 cttcccttcccttcccttccctcccctccc 85726



to top

>gb|AY050668.1| Homo sapiens PKC-potentiated PP1 inhibitory protein (PPP1R14A) gene,
             complete cds
          Length = 169660

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 83366 cttcccttcccttcccttccctcccctccc 83395



to top

>emb|CR937052.2| Rattus norvegicus chromosome 1 BAC CH230-445C15, complete sequence
          Length = 151854

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 31919 cttcccttcccttcccttccctcccctccc 31948



to top

>gb|AC116119.12| Mus musculus chromosome 12, clone RP23-76D19, complete sequence
          Length = 264410

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 203810 cttcccttcccttcccttccctcccctccc 203781



to top

>gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosome 6, complete sequence
          Length = 183845

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 103347 cttcccttcccttcccttccctcccctccc 103376



to top

>gb|AC126933.3| Mus musculus BAC clone RP24-117M7 from chromosome 1, complete sequence
          Length = 170885

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 170453 cttcccttcccttcccttccctcccctccc 170424



to top

>gb|AC123798.5| Mus musculus BAC clone RP24-334O8 from chromosome 3, complete sequence
          Length = 168467

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 91843 cttcccttcccttcccttccctcccctccc 91872



to top

>gb|AC130721.3| Mus musculus BAC clone RP24-333B3 from chromosome 6, complete sequence
          Length = 149502

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 40278 cttcccttcccttcccttccctcccctccc 40249



to top

>gb|AC122482.4| Mus musculus BAC clone RP24-361E14 from chromosome 1, complete sequence
          Length = 149646

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 29635 cttcccttcccttcccttccctcccctccc 29664



to top

>gb|AC133182.3| Mus musculus BAC clone RP24-181H19 from chromosome 18, complete
             sequence
          Length = 163378

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 12767 cttcccttcccttcccttccctcccctccc 12738



to top

>gb|AC134535.4| Mus musculus BAC clone RP24-371E20 from chromosome 7, complete sequence
          Length = 214571

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 30845 cttcccttcccttcccttccctcccctccc 30816



to top

>gb|AC132245.3| Mus musculus BAC clone RP24-420M8 from chromosome 13, complete sequence
          Length = 148654

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 1     cttcccttcccttcccttgcctctcc 26
             |||||||||||||||||| |||||||
Sbjct: 56388 cttcccttcccttcccttccctctcc 56363



to top

>gb|AC129590.4| Mus musculus BAC clone RP24-428B12 from chromosome 14, complete
             sequence
          Length = 180177

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 70195 cttcccttcccttcccttccctcccctccc 70224



to top

>gb|AC124441.5| Mus musculus BAC clone RP24-176L17 from chromosome 18, complete
             sequence
          Length = 190119

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 31243 cttcccttcccttcccttccctcccctccc 31214



to top

>gb|AC114821.4| Mus musculus BAC clone RP23-72K1 from chromosome 1, complete sequence
          Length = 197978

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 147045 cttcccttcccttcccttccctcccctccc 147016



to top

>gb|AC124601.5| Mus musculus BAC clone RP23-27M3 from chromosome 12, complete sequence
          Length = 237876

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||  |||||||||||
Sbjct: 95093 cttcccttcccttccctcccctctcctccc 95064



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 95019 cttcccttcccttcccttccctcccctccc 94990



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 2    ttcccttcccttcccttgcctctcctccc 30
            ||||||||||||||||  |||||||||||
Sbjct: 6057 ttcccttcccttccctcccctctcctccc 6029



to top

>gb|AC140352.3| Mus musculus BAC clone RP23-223L7 from chromosome 18, complete sequence
          Length = 165504

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 90756 cttcccttcccttcccttccctcccctccc 90785



to top

>gb|AC127304.4| Mus musculus BAC clone RP23-285C13 from chromosome 3, complete sequence
          Length = 151365

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| ||| |||||||
Sbjct: 19359 cttcccttcccttcccttccctttcctccc 19330



to top

>gb|AC116585.3| Mus musculus BAC clone RP23-358A16 from chromosome 3, complete
            sequence
          Length = 227492

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 1    cttcccttcccttcccttgcctctcctccc 30
            |||||||||||||||||| |||| ||||||
Sbjct: 1896 cttcccttcccttcccttccctcccctccc 1925



to top

>gb|AC124588.4| Mus musculus BAC clone RP23-133F15 from chromosome 1, complete
            sequence
          Length = 141995

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1    cttcccttcccttcccttgcct 22
            ||||||||||||||||||||||
Sbjct: 2414 cttcccttcccttcccttgcct 2435



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1    cttcccttcccttcccttgcct 22
            ||||||||||||||||||||||
Sbjct: 2379 cttcccttcccttcccttgcct 2400



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1    cttcccttcccttcccttgcct 22
            ||||||||||||||||||||||
Sbjct: 2309 cttcccttcccttcccttgcct 2330



to top

>gb|AC139757.4| Mus musculus BAC clone RP23-440H11 from chromosome 18, complete sequence
          Length = 193847

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 157599 cttcccttcccttcccttccctcccctccc 157628



to top

>gb|AC122878.4| Mus musculus BAC clone RP23-116F15 from chromosome 14, complete
             sequence
          Length = 226611

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 41626 cttcccttcccttcccttccctcccctccc 41655



to top

>gb|AC131080.13| Mus musculus chromosome 16, clone RP23-438H16, complete sequence
          Length = 192584

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 75549 cttcccttcccttcccttccctcccctccc 75520



to top

>gb|AC111096.15| Mus musculus chromosome 3, clone RP23-174B18, complete sequence
          Length = 209936

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 16617 cttcccttcccttcccttccctcccctccc 16646



to top

>gb|AC118020.11| Mus musculus, clone RP23-459B19, complete sequence
          Length = 191669

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 95806 cttcccttcccttcccttccctcccctccc 95777



to top

>gb|AC104231.10| Homo sapiens chromosome 15, clone RP11-96H23, complete sequence
          Length = 81256

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| ||| |||||||
Sbjct: 35121 cttcccttcccttcccttccctatcctccc 35150



to top

>gb|AC125340.3| Mus musculus BAC clone RP24-364H15 from chromosome 1, complete sequence
          Length = 177161

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 136298 cttcccttcccttcccttccctcccctccc 136269



to top

>gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosome 1, complete sequence
          Length = 205642

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 30762 cttcccttcccttcccttccctcccctccc 30733



to top

>gb|AC125154.3| Mus musculus BAC clone RP24-380C2 from chromosome 3, complete sequence
          Length = 186277

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 152390 cttcccttcccttcccttccctcccctccc 152361



to top

>gb|AC123792.4| Mus musculus BAC clone RP24-309B14 from chromosome 7, complete sequence
          Length = 162493

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 63111 cttcccttcccttcccttccctcccctccc 63082



to top

>gb|AC122041.4| Mus musculus BAC clone RP24-443H19 from chromosome 16, complete
             sequence
          Length = 183268

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1     cttcccttcccttcccttgcct 22
             ||||||||||||||||||||||
Sbjct: 57015 cttcccttcccttcccttgcct 57036



to top

>gb|AC122055.4| Mus musculus BAC clone RP24-465O15 from chromosome 17, complete sequence
          Length = 159138

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 131046 cttcccttcccttcccttccctcccctccc 131017



to top

>gb|AC124359.3| Mus musculus BAC clone RP24-495G2 from chromosome 1, complete sequence
          Length = 174750

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 160713 cttcccttcccttcccttccctcccctccc 160742



to top

>gb|AC129081.6| Mus musculus BAC clone RP24-274H24 from chromosome 3, complete sequence
          Length = 179064

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| ||| |||||||
Sbjct: 166616 cttcccttcccttcccttccctttcctccc 166587



to top

>gb|AC121809.3| Mus musculus BAC clone RP23-451B23 from chromosome 8, complete sequence
          Length = 192626

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 119439 cttcccttcccttcccttccctcccctccc 119468



to top

>gb|AC121817.3| Mus musculus BAC clone RP23-458O1 from chromosome 8, complete sequence
          Length = 191176

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 159571 cttcccttcccttcccttccctcccctccc 159542



to top

>gb|AC121826.3| Mus musculus BAC clone RP23-470O13 from chromosome 3, complete sequence
          Length = 187184

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||  |||||||||||
Sbjct: 129015 cttcccttcccttccctcccctctcctccc 128986



to top

>gb|AC121831.3| Mus musculus BAC clone RP24-66F17 from chromosome 2, complete sequence
          Length = 190963

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 94348 cttcccttcccttcccttccctcccctccc 94319



to top

>gb|AC121829.3| Mus musculus BAC clone RP23-480P21 from chromosome 5, complete sequence
          Length = 197131

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 101360 cttcccttcccttcccttccctcccctccc 101331



to top

>gb|AC124470.4| Mus musculus BAC clone RP24-174O2 from chromosome 6, complete sequence
          Length = 187005

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 84905 cttcccttcccttcccttccctcccctccc 84934



to top

>gb|AC124582.4| Mus musculus BAC clone RP23-120A15 from 6, complete sequence
          Length = 183555

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 70358 cttcccttcccttcccttccctcccctccc 70329



to top

>gb|AC115356.5| Mus musculus BAC clone RP23-47E9 from 15, complete sequence
          Length = 212177

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 82162 cttcccttcccttcccttccctcccctccc 82191



to top

>gb|AC122865.3| Mus musculus BAC clone RP23-143B2 from 8, complete sequence
          Length = 201139

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 10507 cttcccttcccttcccttccctcccctccc 10536



to top

>gb|AC122862.4| Mus musculus BAC clone RP23-140O11 from 5, complete sequence
          Length = 192695

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 70547 cttcccttcccttcccttccctcccctccc 70576



to top

>gb|AC123557.4| Mus musculus BAC clone RP23-183P22 from 1, complete sequence
          Length = 198349

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 53392 cttcccttcccttcccttccctcccctccc 53363



to top

>gb|AC122841.4| Mus musculus BAC clone RP23-194E5 from 3, complete sequence
          Length = 200088

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 25868 cttcccttcccttcccttccctcccctccc 25897



to top

>gb|AC131711.3| Mus musculus BAC clone RP23-192M18 from 6, complete sequence
          Length = 228400

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 1     cttcccttcccttcccttgcct 22
             ||||||||||||||||||||||
Sbjct: 60553 cttcccttcccttcccttgcct 60532



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 1     cttcccttcccttcccttgcct 22
             ||||||||||||||||||||||
Sbjct: 60528 cttcccttcccttcccttgcct 60507



to top

>gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, complete sequence
          Length = 182135

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 1    cttcccttcccttcccttgcctctcctccc 30
            |||||||||||||||||| |||| ||||||
Sbjct: 8809 cttcccttcccttcccttccctcccctccc 8780



to top

>gb|AC121567.3| Mus musculus BAC clone RP23-225D14 from 14, complete sequence
          Length = 165586

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 10318 cttcccttcccttcccttccctcccctccc 10289



to top

>gb|AC129333.4| Mus musculus BAC clone RP23-104F23 from 6, complete sequence
          Length = 216849

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 23277 cttcccttcccttcccttccctcccctccc 23306



to top

>gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, complete sequence
          Length = 185947

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 164495 cttcccttcccttcccttccctcccctccc 164524



to top

>gb|AC131663.3| Mus musculus BAC clone RP23-258B18 from 6, complete sequence
          Length = 191685

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 119494 cttcccttcccttcccttccctcccctccc 119465



to top

>gb|AC127329.3| Mus musculus BAC clone RP23-260A24 from 8, complete sequence
          Length = 183639

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 1    cttcccttcccttcccttgcctctcctccc 30
            |||||||||||||||||| |||| ||||||
Sbjct: 7994 cttcccttcccttcccttccctcccctccc 8023



to top

>gb|AC099413.3| Mus musculus BAC clone RP23-2O10 from 4, complete sequence
          Length = 208798

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 55127 cttcccttcccttcccttccctcccctccc 55098



to top

>gb|AC116572.3| Mus musculus BAC clone RP23-101D16 from 14, complete sequence
          Length = 199090

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 46012 cttcccttcccttcccttccctcccctccc 45983



to top

>gb|AC112701.6| Mus musculus BAC clone RP23-171A11 from 13, complete sequence
          Length = 184506

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 1    cttcccttcccttcccttgcctctcctccc 30
            |||||||||||||||||| |||| ||||||
Sbjct: 3857 cttcccttcccttcccttccctcccctccc 3828



to top

>gb|AC105407.5| Mus musculus BAC clone RP24-196J17 from 13, complete sequence
          Length = 175889

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| ||| |||||||
Sbjct: 38422 cttcccttcccttccctttcctttcctccc 38393



to top

>gb|AC121957.2| Mus musculus BAC clone RP24-232G13 from 18, complete sequence
          Length = 178929

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 18278 cttcccttcccttcccttccctcccctccc 18249



to top

>gb|AC121981.3| Mus musculus BAC clone RP24-290K9 from 5, complete sequence
          Length = 184908

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 117442 cttcccttcccttcccttccctcccctccc 117413



to top

>gb|AC122496.2| Mus musculus BAC clone RP24-400K16 from 5, complete sequence
          Length = 180081

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 86550 cttcccttcccttcccttccctcccctccc 86521



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 35980 cttcccttcccttcccttccctcccctccc 36009



to top

>gb|AC123802.2| Mus musculus BAC clone RP24-398M15 from 3, complete sequence
          Length = 121242

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 16765 cttcccttcccttccctttcctcccctccc 16794



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| ||| |||||||
Sbjct: 16760 cttcccttcccttcccttccctttcctccc 16789



to top

>gb|AC100752.10| Mus musculus chromosome 3, clone RP23-2A4, complete sequence
          Length = 208757

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 1   cttcccttcccttcccttgcctctcctccc 30
           |||||||||||||||||| ||| |||||||
Sbjct: 149 cttcccttcccttcccttccctttcctccc 120



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 1   cttcccttcccttcccttgcctctcctccc 30
           |||||||||||||||||| |||| ||||||
Sbjct: 144 cttcccttcccttccctttcctcccctccc 115



to top

>gb|AC110514.9| Mus musculus chromosome 17, clone RP23-363P16, complete sequence
          Length = 171261

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 92209 cttcccttcccttccctttcctcccctccc 92238



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| ||| |||||||
Sbjct: 92204 cttcccttcccttcccttccctttcctccc 92233



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 1     cttcccttcccttcccttgcctct 24
             |||||||||||||||||| |||||
Sbjct: 92244 cttcccttcccttcccttccctct 92267



to top

>gb|AC096785.29| Mus musculus strain C57BL/6J clone rp23-382i2 map 18, complete sequence
          Length = 201304

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 1     cttcccttcccttcccttgcct 22
             ||||||||||||||||||||||
Sbjct: 46462 cttcccttcccttcccttgcct 46441



to top

>gb|AC101490.8| Mus musculus chromosome 3, clone RP23-188O2, complete sequence
          Length = 247848

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| ||| |||||||
Sbjct: 167501 cttcccttcccttcccttccctttcctccc 167530



to top

>gb|AC019155.4| Homo sapiens BAC clone RP11-3B12 from 7, complete sequence
          Length = 176130

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 126508 cttcccttcccttcccttccctcccctccc 126537



to top

>gb|AC010082.4| Homo sapiens BAC clone RP11-109D3 from 7, complete sequence
          Length = 143035

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 1     cttcccttcccttcccttgcct 22
             ||||||||||||||||||||||
Sbjct: 55912 cttcccttcccttcccttgcct 55891



to top

>gb|AC092647.2| Homo sapiens BAC clone RP11-419M24 from 7, complete sequence
          Length = 163891

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 78782 cttcccttcccttcccttccctcccctccc 78753



to top

>gb|AC006337.5| Homo sapiens BAC clone RP11-535N23 from 7, complete sequence
          Length = 172291

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1     cttcccttcccttcccttgcct 22
             ||||||||||||||||||||||
Sbjct: 79475 cttcccttcccttcccttgcct 79496



to top

>gb|AC004538.1| Homo sapiens PAC clone RP5-887P4 from 7, complete sequence
          Length = 83079

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 71942 cttcccttcccttcccttccctcccctccc 71971



to top

>gb|AC116468.13| Mus musculus chromosome 16, clone RP23-166G21, complete sequence
          Length = 193206

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 17707 cttcccttcccttcccttccctcccctccc 17678



to top

>gb|AC110918.9| Mus musculus chromosome 5, clone RP23-189P23, complete sequence
          Length = 267946

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 83192 cttcccttcccttcccttccctcccctccc 83221



to top

>gb|AC116465.8| Mus musculus chromosome 10, clone RP23-64J3, complete sequence
          Length = 237801

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 150198 cttcccttcccttcccttccctcccctccc 150227



to top

>gb|AC102105.8| Mus musculus chromosome 12, clone RP23-89G24, complete sequence
          Length = 188853

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| ||| |||||||
Sbjct: 55008 cttcccttcccttcccttccctttcctccc 55037



to top

>gb|AC103939.8| Mus musculus chromosome 18, clone RP23-300E7, complete sequence
          Length = 240406

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 180319 cttcccttcccttcccttccctcccctccc 180348



to top

>gb|AC158751.7| Mus musculus chromosome 7, clone RP23-413C19, complete sequence
          Length = 198442

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| |||| ||||||
Sbjct: 111633 cttcccttcccttcccttccctcccctccc 111662



to top

>gb|AC164537.3| Mus musculus chromosome 7, clone RP23-68N11, complete sequence
          Length = 153418

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| ||| |||||||
Sbjct: 146285 cttcccttcccttcccttccctttcctccc 146256



to top

>gb|AC161825.13| Mus musculus 10 BAC RP23-35O24 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 199841

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             ||||||||||||||| || |||||||||||
Sbjct: 60192 cttcccttcccttcctttccctctcctccc 60163



to top

>gb|AC150314.5| Mus musculus BAC clone RP23-269O24 from chromosome 10, complete
             sequence
          Length = 243006

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 1     cttcccttcccttcccttgcctctcctccc 30
             |||||||||||||||||| |||| ||||||
Sbjct: 65207 cttcccttcccttcccttccctcccctccc 65178



to top

>gb|AC154577.2| Mus musculus BAC clone RP23-375G9 from chromosome 17, complete sequence
          Length = 189549

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 1      cttcccttcccttcccttgcctctcctccc 30
              |||||||||||||||||| ||| |||||||
Sbjct: 134618 cttcccttcccttcccttccctttcctccc 134589


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,450,140
Number of Sequences: 3902068
Number of extensions: 4450140
Number of successful extensions: 150641
Number of sequences better than 10.0: 998
Number of HSP's better than 10.0 without gapping: 995
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 135576
Number of HSP's gapped (non-prelim): 14720
length of query: 469
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 447
effective length of database: 17,147,199,772
effective search space: 7664798298084
effective search space used: 7664798298084
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top