ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart50d03
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_450461.1| Oryza sativa (japonica cultivar-group), mRNA 153 6e-34
2gb|AF475125.1| Triticum aestivum enoyl-Acp reductase mRNA, parti... 153 6e-34
3dbj|AK103141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 153 6e-34
4ref|XM_481639.1| Oryza sativa (japonica cultivar-group), mRNA 149 9e-33
5emb|AJ003025.1|OSENOYLAC Oryza sativa mRNA for enoyl-ACP reductase 149 9e-33
6dbj|AK070992.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 9e-33
7dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
8dbj|AP005594.3| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
9gb|BT016571.1| Zea mays clone Contig404 mRNA sequence 133 6e-28
10dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 133 6e-28
11dbj|AP005490.3| Oryza sativa (japonica cultivar-group) genomic D... 133 6e-28
12dbj|AP004759.3| Oryza sativa (japonica cultivar-group) genomic D... 133 6e-28
13gb|AY112451.1| Zea mays CL3046_1 mRNA sequence 133 6e-28
14gb|AY106087.1| Zea mays PCO109463 mRNA sequence 129 9e-27
15gb|AY083164.1| Olea europaea subsp. europaea enoyl ACP reductase... 94 5e-16
16emb|AJ003124.1|PHAJ3124 Petunia hybrida pte gene 82 2e-12
17emb|AJ243090.1|BNA243090 Brassica napus mRNA for enoyl-[acyl-car... 74 4e-10
18ref|NM_126612.2| Arabidopsis thaliana MOD1 (MOSAIC DEATH 1); eno... 72 2e-09
19ref|NM_179609.1| Arabidopsis thaliana MOD1 (MOSAIC DEATH 1); eno... 72 2e-09
20gb|AF327528.1| Arabidopsis thaliana At2g05990 mRNA sequence 72 2e-09
21gb|AY113962.1| Arabidopsis thaliana putative enoyl-ACP reductase... 72 2e-09
22gb|AY056192.1| Arabidopsis thaliana putative enoyl-ACP reductase... 72 2e-09
23gb|AF324719.2|AF324719 Arabidopsis thaliana At2g05990 (At2g05990... 72 2e-09
24emb|BX820208.1|CNS0AA28 Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
25emb|BX820100.1|CNS0AA6U Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
26emb|BX819977.1|CNS0AA6V Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
27emb|BX819653.1|CNS0AA6M Arabidopsis thaliana Full-length cDNA Co... 72 2e-09
28gb|AF207593.1|AF207593 Arabidopsis thaliana enoyl-ACP reductase ... 72 2e-09
29gb|AC005970.3| Arabidopsis thaliana chromosome 2 clone T6P5 map ... 68 3e-08
30emb|AJ243089.1|BNA243089 Brassica napus mRNA for enoyl-[acyl-car... 64 4e-07
31emb|Y13860.1|ATENRA Arabidopsis thaliana enr-A gene 60 7e-06
32gb|S60064.1|S60064 Brassica napus enoyl-acyl carrier protein red... 58 3e-05
33emb|AJ243088.1|BNA243088 Brassica napus mRNA for enoyl-[acyl-car... 50 0.006
34emb|AJ243087.1|BNA243087 Brassica napus mRNA for enoyl-[acyl-car... 50 0.006
35gb|AC154828.2| Mus musculus BAC clone RP24-549A19 from 13, compl... 48 0.026
36emb|CT009754.11| Mouse DNA sequence from clone RP23-5P19 on chro... 48 0.026
37gb|AC106840.12| Mus musculus chromosome 1, clone RP24-144D4, com... 46 0.10
38gb|AC115000.7| Mus musculus chromosome 1, clone RP24-103F2, comp... 46 0.10
39gb|AC122834.2| Mus musculus BAC clone RP23-183H9 from 15, comple... 46 0.10
40gb|AC171401.8| Mus musculus chromosome 7, clone RP23-174D7, comp... 46 0.10
41gb|AC161261.5| Mus musculus BAC clone RP23-376D23 from chromosom... 44 0.40
42gb|AC107645.28| Mus musculus chromosome 15, clone RP23-78J21, co... 42 1.6
43gb|DQ490467.1| Emericella nidulans beta-glucosidase (AN0712-2) m... 42 1.6
44ref|XM_653224.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 1.6
45gb|AC117243.3| Mus musculus BAC clone RP24-198D9 from 9, complet... 42 1.6
46emb|X95462.1|BNENOYLRD B.napus mRNA for enoyl reductase 42 1.6
47emb|BX324117.16| Mouse DNA sequence from clone RP23-389N3 on chr... 42 1.6
48emb|BX000694.9| Mouse DNA sequence from clone RP23-30B5 on chrom... 42 1.6
49gb|AY665242.1| Saimiri boliviensis chondroitin sulfate proteogly... 40 6.2
50gb|AC107839.14| Mus musculus chromosome 7, clone RP23-284K1, com... 40 6.2
51gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 40 6.2
52gb|AC116726.11| Mus musculus chromosome 10, clone RP23-285L15, c... 40 6.2
53gb|AC109283.8| Mus musculus chromosome 1, clone RP24-156F3, comp... 40 6.2
54gb|AC122773.8| Mus musculus chromosome 1, clone RP24-160N7, comp... 40 6.2
55gb|AF125314.2| Mus musculus chromosome X clones MP1-C03180, MP1-... 40 6.2
56gb|AC095999.8| Rattus norvegicus 4 BAC CH230-12B2 (Children's Ho... 40 6.2
57gb|AC115719.10| Mus musculus chromosome 18, clone RP24-356J16, c... 40 6.2
58gb|AC101956.5| Mus musculus chromosome 5, clone RP24-166L23, com... 40 6.2
59gb|AC147985.3| Mus musculus BAC clone RP24-402C11 from chromosom... 40 6.2
60gb|AC140303.3| Mus musculus BAC clone RP23-381H21 from chromosom... 40 6.2
61gb|AC091353.6| Rattus norvegicus 4 BAC CH230-1B20 (Children's Ho... 40 6.2
62gb|AC095825.6| Rattus norvegicus 4 BAC CH230-9J6 (Children's Hos... 40 6.2
63gb|AC124181.3| Mus musculus BAC clone RP23-204B12 from chromosom... 40 6.2
64gb|AC140311.2| Mus musculus BAC clone RP23-392M3 from chromosome... 40 6.2
65gb|AC162527.5| Mus musculus BAC clone RP23-30M17 from chromosome... 40 6.2
66gb|AC114010.6| Mus musculus BAC clone RP24-378K23 from chromosom... 40 6.2
67gb|AC123985.10| Mus musculus chromosome 14, clone RP23-154G18, c... 40 6.2
68gb|AC132458.3| Mus musculus BAC clone RP23-152C8 from chromosome... 40 6.2
69emb|CT025565.5| Mouse DNA sequence from clone RP24-126K5 on chro... 40 6.2
70gb|AC137749.11| Mus musculus chromosome 6, clone RP23-69C16, com... 40 6.2
71gb|AC125460.4| Mus musculus BAC clone RP24-448D10 from chromosom... 40 6.2
72gb|AC126552.5| Mus musculus BAC clone RP23-342F3 from chromosome... 40 6.2
73gb|AC122416.4| Mus musculus BAC clone RP24-157E17 from chromosom... 40 6.2
74gb|AC122261.2| Mus musculus BAC clone RP23-187F24 from 15, compl... 40 6.2
75gb|AC117670.15| Mus musculus chromosome 7, clone RP23-383P11, co... 40 6.2
76gb|AC104863.12| Mus musculus chromosome 6, clone RP23-109C11, co... 40 6.2
77gb|AC036121.11| Mus musculus chromosome 6, clone RP23-158O9, com... 40 6.2
78gb|AC112662.7| Mus musculus chromosome 5, clone RP23-467F2, comp... 40 6.2
79gb|AC165082.2| Mus musculus BAC clone RP23-412H17 from chromosom... 40 6.2
80gb|AC102609.7| Mus musculus, clone RP23-403I3, complete sequence 40 6.2
81gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 6.2
82gb|AC117633.6| Mus musculus, clone RP23-200C8, complete sequence 40 6.2
83gb|AC116071.5| Rattus norvegicus 3 BAC CH230-230O7 (Children's H... 40 6.2
84gb|AC166324.1| Mus musculus BAC clone RP24-500J7 from chromosome... 40 6.2
85emb|AL607126.9| Mouse DNA sequence from clone RP23-206I16 on chr... 40 6.2
86emb|AL935054.11| Mouse DNA sequence from clone RP23-280A12 on ch... 40 6.2
87gb|AC108211.3| Homo sapiens BAC clone RP11-511I14 from 4, comple... 40 6.2
88dbj|AK033076.1| Mus musculus adult male corpus striatum cDNA, RI... 40 6.2
89gb|AC155310.2| Mus musculus BAC clone RP24-81L10 from chromosome... 40 6.2
90gb|AC158380.2| Mus musculus BAC clone RP24-178I16 from chromosom... 40 6.2
91gb|AC012382.14|AC012382 Mus musculus chromosome 7, clone RP23-92... 40 6.2
92gb|AC157276.2| Mus musculus BAC clone RP23-426N20 from chromosom... 40 6.2
93gb|AC005237.2|AC005237 Homo sapiens BAC clone RP11-556H17 from 2... 40 6.2
94gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosom... 40 6.2
95dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 40 6.2
96gb|AC084382.2| Mus musculus BAC clone RP23-5K17 from 15, complet... 40 6.2
97emb|CT009515.16| Mouse DNA sequence from clone RP23-117H6 on chr... 40 6.2
98gb|AC100406.7| Mus musculus chromosome 9, clone RP23-134M7, comp... 40 6.2
99gb|AC110216.10| Mus musculus chromosome 18, clone RP24-502I6, co... 40 6.2
100gb|AC159965.5| Mus musculus chromosome 15, clone RP23-471C16, co... 40 6.2
101emb|CT030260.9| Mouse DNA sequence from clone RP23-462I24 on chr... 40 6.2
102gb|AC133576.10| Mus musculus chromosome 19, clone RP23-204H15, c... 40 6.2
103emb|CT027564.7| Mouse DNA sequence from clone RP24-293N14 on chr... 40 6.2
104emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chr... 40 6.2
105emb|AL844852.11| Mouse DNA sequence from clone RP23-260N23 on ch... 40 6.2
106emb|CT030684.4| Mouse DNA sequence from clone RP24-88G11 on chro... 40 6.2
107emb|AL662929.15| Mouse DNA sequence from clone RP23-435E13 on ch... 40 6.2
108emb|AL929556.14| Mouse DNA sequence from clone RP23-353B17 on ch... 40 6.2
109gb|AC172892.1| Mus musculus BAC clone RP23-269B2 from chromosome... 40 6.2
110emb|AL928601.6| Mouse DNA sequence from clone RP23-88B5 on chrom... 40 6.2
111emb|AL773590.8| Mouse DNA sequence from clone RP23-181A13 on chr... 40 6.2
112emb|AL671910.9| Mouse DNA sequence from clone RP23-245M12 on chr... 40 6.2
113emb|AL671888.8| Mouse DNA sequence from clone RP23-247O14 on chr... 40 6.2
114emb|AL672054.5| Mouse DNA sequence from clone RP23-237I22 on chr... 40 6.2
115emb|AL691469.9| Mouse DNA sequence from clone RP23-248F18 on chr... 40 6.2
116emb|AL772145.9| Mouse DNA sequence from clone RP23-212H4 on chro... 40 6.2
117gb|AC151299.3| Mus musculus BAC clone RP23-11N17 from chromosome... 40 6.2
118emb|AL929399.6| Mouse DNA sequence from clone RP23-59E24 on chro... 40 6.2
119emb|AL671982.4| Mouse DNA sequence from clone RP23-132H1 on chro... 40 6.2
120emb|AL731789.9| Mouse DNA sequence from clone RP23-52F6 on chrom... 40 6.2
121dbj|AP003145.1| Mus musculus genomic DNA, chromosome 7, clone:RP... 40 6.2
122emb|AL772294.6| Mouse DNA sequence from clone RP23-125F4 on chro... 40 6.2 
>ref|XM_450461.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1652

 Score =  153 bits (77), Expect = 6e-34
 Identities = 110/121 (90%)
 Strand = Plus / Plus

                                                                       
Query: 343 cccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggctat 402
           ||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 350 cccattgatctcagaggtaaaagagcatttattgctggagttgctgatgataatggctat 409

                                                                       
Query: 403 ggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgg 462
           ||||||||||| ||||| |||||||| |||||||| || || ||||||||||||||||||
Sbjct: 410 ggctgggcaatagcaaaagctcttgctgcagctggtgccgagattcttgttggtacatgg 469

            
Query: 463 g 463
           |
Sbjct: 470 g 470
to top
>gb|AF475125.1| Triticum aestivum enoyl-Acp reductase mRNA, partial cds
          Length = 453

 Score =  153 bits (77), Expect = 6e-34
 Identities = 110/121 (90%)
 Strand = Plus / Plus

                                                                       
Query: 343 cccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggctat 402
           ||||| ||||| ||||| |||||||||||||||||||| || ||||||||||| || |||
Sbjct: 238 cccattgatctcagaggtaaaagagcatttattgctggagtcgctgatgataatggttat 297

                                                                       
Query: 403 ggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgg 462
           ||||||||||| || ||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 298 ggctgggcaatagccaaggctcttgctgcagctggtgctgaaattcttgttggtacatgg 357

            
Query: 463 g 463
           |
Sbjct: 358 g 358
to top
>dbj|AK103141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033120G12, full
           insert sequence
          Length = 1652

 Score =  153 bits (77), Expect = 6e-34
 Identities = 110/121 (90%)
 Strand = Plus / Plus

                                                                       
Query: 343 cccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggctat 402
           ||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 350 cccattgatctcagaggtaaaagagcatttattgctggagttgctgatgataatggctat 409

                                                                       
Query: 403 ggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgg 462
           ||||||||||| ||||| |||||||| |||||||| || || ||||||||||||||||||
Sbjct: 410 ggctgggcaatagcaaaagctcttgctgcagctggtgccgagattcttgttggtacatgg 469

            
Query: 463 g 463
           |
Sbjct: 470 g 470
to top
>ref|XM_481639.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1647

 Score =  149 bits (75), Expect = 9e-33
 Identities = 105/115 (91%)
 Strand = Plus / Plus

                                                                       
Query: 349 gatcttagagggaaaagagcatttattgctggggttgctgatgataacggctatggctgg 408
           ||||||||||| ||||| || || |||||||| ||||||||||| || ||||||||||||
Sbjct: 440 gatcttagaggtaaaagggcgttcattgctggagttgctgatgacaatggctatggctgg 499

                                                                  
Query: 409 gcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatggg 463
           |||||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 500 gcaattgcaaaggctcttgctgctgctggtgctgaaattcttgttggtacatggg 554



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 150 gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 209
           ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || |||||
Sbjct: 226 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 285

                   
Query: 210 ggccgtct 217
           ||| ||||
Sbjct: 286 ggcggtct 293
to top
>emb|AJ003025.1|OSENOYLAC Oryza sativa mRNA for enoyl-ACP reductase
          Length = 1520

 Score =  149 bits (75), Expect = 9e-33
 Identities = 105/115 (91%)
 Strand = Plus / Plus

                                                                       
Query: 349 gatcttagagggaaaagagcatttattgctggggttgctgatgataacggctatggctgg 408
           ||||||||||| ||||| || || |||||||| ||||||||||| || ||||||||||||
Sbjct: 253 gatcttagaggtaaaagggcgttcattgctggagttgctgatgacaatggctatggctgg 312

                                                                  
Query: 409 gcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatggg 463
           |||||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 313 gcaattgcaaaggctcttgctgctgctggtgctgaaattcttgttggtacatggg 367



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 150 gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 209
           ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || |||||
Sbjct: 39  gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 98

                   
Query: 210 ggccgtct 217
           ||| ||||
Sbjct: 99  ggcggtct 106
to top
>dbj|AK070992.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023077K10, full
           insert sequence
          Length = 1647

 Score =  149 bits (75), Expect = 9e-33
 Identities = 105/115 (91%)
 Strand = Plus / Plus

                                                                       
Query: 349 gatcttagagggaaaagagcatttattgctggggttgctgatgataacggctatggctgg 408
           ||||||||||| ||||| || || |||||||| ||||||||||| || ||||||||||||
Sbjct: 440 gatcttagaggtaaaagggcgttcattgctggagttgctgatgacaatggctatggctgg 499

                                                                  
Query: 409 gcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatggg 463
           |||||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 500 gcaattgcaaaggctcttgctgctgctggtgctgaaattcttgttggtacatggg 554



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 150 gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 209
           ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || |||||
Sbjct: 226 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 285

                   
Query: 210 ggccgtct 217
           ||| ||||
Sbjct: 286 ggcggtct 293
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score =  141 bits (71), Expect = 2e-30
 Identities = 95/103 (92%)
 Strand = Plus / Plus

                                                                           
Query: 361     aaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgcaaag 420
               |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 5729046 aaaagagcatttattgctggagttgctgatgataatggctatggctgggcaatagcaaaa 5729105

                                                          
Query: 421     gctcttgccgcagctggggctgaaattcttgttggtacatggg 463
               |||||||| |||||||| || || |||||||||||||||||||
Sbjct: 5729106 gctcttgctgcagctggtgccgagattcttgttggtacatggg 5729148
to top
>dbj|AP005594.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0701E06
          Length = 123415

 Score =  141 bits (71), Expect = 2e-30
 Identities = 95/103 (92%)
 Strand = Plus / Plus

                                                                         
Query: 361   aaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgcaaag 420
             |||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 25251 aaaagagcatttattgctggagttgctgatgataatggctatggctgggcaatagcaaaa 25310

                                                        
Query: 421   gctcttgccgcagctggggctgaaattcttgttggtacatggg 463
             |||||||| |||||||| || || |||||||||||||||||||
Sbjct: 25311 gctcttgctgcagctggtgccgagattcttgttggtacatggg 25353
to top
>gb|BT016571.1| Zea mays clone Contig404 mRNA sequence
          Length = 1517

 Score =  133 bits (67), Expect = 6e-28
 Identities = 112/127 (88%)
 Strand = Plus / Plus

                                                                       
Query: 337 gggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataac 396
           ||||| ||||| ||||| ||||| ||||| ||||| |||||||| |||||||||||||| 
Sbjct: 295 gggcttcccattgatctcagaggtaaaagggcattcattgctggagttgctgatgataat 354

                                                                       
Query: 397 ggctatggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggt 456
           |||||||| ||||||||||| ||||| ||||| || ||||| |||||||||||||| |||
Sbjct: 355 ggctatggatgggcaattgcgaaggcacttgctgcggctggtgctgaaattcttgtgggt 414

                  
Query: 457 acatggg 463
           |||||||
Sbjct: 415 acatggg 421
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  133 bits (67), Expect = 6e-28
 Identities = 85/91 (93%)
 Strand = Plus / Plus

                                                                            
Query: 373      attgctggggttgctgatgataacggctatggctgggcaattgcaaaggctcttgccgca 432
                |||||||| ||||||||||| || |||||||||||||||||||||||||||||||| || 
Sbjct: 14409114 attgctggagttgctgatgacaatggctatggctgggcaattgcaaaggctcttgctgct 14409173

                                               
Query: 433      gctggggctgaaattcttgttggtacatggg 463
                ||||| |||||||||||||||||||||||||
Sbjct: 14409174 gctggtgctgaaattcttgttggtacatggg 14409204



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                            
Query: 150      gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 209
                ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || |||||
Sbjct: 14407860 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 14407919

                        
Query: 210      ggccgtct 217
                ||| ||||
Sbjct: 14407920 ggcggtct 14407927
to top
>dbj|AP005490.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
            clone:OSJNBa0049I01
          Length = 140261

 Score =  133 bits (67), Expect = 6e-28
 Identities = 85/91 (93%)
 Strand = Plus / Plus

                                                                        
Query: 373  attgctggggttgctgatgataacggctatggctgggcaattgcaaaggctcttgccgca 432
            |||||||| ||||||||||| || |||||||||||||||||||||||||||||||| || 
Sbjct: 3982 attgctggagttgctgatgacaatggctatggctgggcaattgcaaaggctcttgctgct 4041

                                           
Query: 433  gctggggctgaaattcttgttggtacatggg 463
            ||||| |||||||||||||||||||||||||
Sbjct: 4042 gctggtgctgaaattcttgttggtacatggg 4072



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 150  gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 209
            ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || |||||
Sbjct: 2728 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 2787

                    
Query: 210  ggccgtct 217
            ||| ||||
Sbjct: 2788 ggcggtct 2795
to top
>dbj|AP004759.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0670E08
          Length = 133106

 Score =  133 bits (67), Expect = 6e-28
 Identities = 85/91 (93%)
 Strand = Plus / Plus

                                                                         
Query: 373   attgctggggttgctgatgataacggctatggctgggcaattgcaaaggctcttgccgca 432
             |||||||| ||||||||||| || |||||||||||||||||||||||||||||||| || 
Sbjct: 53397 attgctggagttgctgatgacaatggctatggctgggcaattgcaaaggctcttgctgct 53456

                                            
Query: 433   gctggggctgaaattcttgttggtacatggg 463
             ||||| |||||||||||||||||||||||||
Sbjct: 53457 gctggtgctgaaattcttgttggtacatggg 53487



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                         
Query: 150   gcagatgctggccgcacgcccctgcgtctcggcctctcagagtatgctcacctcgagggc 209
             ||||||| |||| |||||||||||| |||| ||||| ||| | ||||| || || |||||
Sbjct: 52143 gcagatggtggctgcacgcccctgcatctcagcctcccagggaatgcttacttccagggc 52202

                     
Query: 210   ggccgtct 217
             ||| ||||
Sbjct: 52203 ggcggtct 52210
to top
>gb|AY112451.1| Zea mays CL3046_1 mRNA sequence
          Length = 1482

 Score =  133 bits (67), Expect = 6e-28
 Identities = 112/127 (88%)
 Strand = Plus / Plus

                                                                       
Query: 337 gggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataac 396
           ||||| ||||| ||||| ||||| ||||| ||||| |||||||| |||||||||||||| 
Sbjct: 291 gggcttcccattgatctcagaggtaaaagggcattcattgctggagttgctgatgataat 350

                                                                       
Query: 397 ggctatggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggt 456
           |||||||| ||||||||||| ||||| ||||| || ||||| |||||||||||||| |||
Sbjct: 351 ggctatggatgggcaattgcgaaggcacttgctgcggctggtgctgaaattcttgtgggt 410

                  
Query: 457 acatggg 463
           |||||||
Sbjct: 411 acatggg 417
to top
>gb|AY106087.1| Zea mays PCO109463 mRNA sequence
          Length = 1496

 Score =  129 bits (65), Expect = 9e-27
 Identities = 107/121 (88%)
 Strand = Plus / Plus

                                                                       
Query: 343 cccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggctat 402
           ||||| ||||| | ||| |||||||||||||| ||||| |||||||||||||| || |||
Sbjct: 346 cccattgatctcacaggtaaaagagcatttatagctggagttgctgatgataatggttat 405

                                                                       
Query: 403 ggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacatgg 462
           || ||||||||||| ||||||||||| || ||||| ||||| ||||||||||||||||||
Sbjct: 406 ggttgggcaattgctaaggctcttgctgctgctggtgctgagattcttgttggtacatgg 465

            
Query: 463 g 463
           |
Sbjct: 466 g 466
to top
>gb|AY083164.1| Olea europaea subsp. europaea enoyl ACP reductase (ear) mRNA,
           complete cds
          Length = 1674

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 104/123 (84%)
 Strand = Plus / Plus

                                                                       
Query: 341 tgcccatcgatcttagagggaaaagagcatttattgctggggttgctgatgataacggct 400
           ||||| ||||||| ||||| || || ||||||||||||||  | || |||||||| || |
Sbjct: 475 tgcccgtcgatctgagaggtaagagggcatttattgctggtatagcggatgataatggat 534

                                                                       
Query: 401 atggctgggcaattgcaaaggctcttgccgcagctggggctgaaattcttgttggtacat 460
           |||| |||||||| |||||  ||||||| || ||||| ||||| ||||||||||||||||
Sbjct: 535 atggatgggcaatagcaaaatctcttgcagctgctggtgctgagattcttgttggtacat 594

              
Query: 461 ggg 463
           |||
Sbjct: 595 ggg 597
to top
>emb|AJ003124.1|PHAJ3124 Petunia hybrida pte gene
          Length = 5047

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                        
Query: 367  gcatttattgctggggttgctgatgataacggctatggctgggcaattgcaaaggctctt 426
            ||||||||||||||  | || ||||| || || ||||| ||||| || |||||| |||||
Sbjct: 1833 gcatttattgctggcatagcagatgacaatgggtatggatgggcgatagcaaagtctctt 1892

                                                 
Query: 427  gccgcagctggggctgaaattcttgttggtacatggg 463
            || || || ||||||||||||||||||||||||||||
Sbjct: 1893 gcagctgcaggggctgaaattcttgttggtacatggg 1929
to top
>emb|AJ243090.1|BNA243090 Brassica napus mRNA for enoyl-[acyl-carrier protein] reductase,
           isoform B2 (enrB2 gene)
          Length = 1380

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 97/117 (82%)
 Strand = Plus / Plus

                                                                       
Query: 331 tcttctgggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgat 390
           |||||||| || ||||| ||| | |||||||||||||| |||||||||||  | ||||||
Sbjct: 305 tcttctggacttcccattgatttgagagggaaaagagcctttattgctggtatagctgat 364

                                                                    
Query: 391 gataacggctatggctgggcaattgcaaaggctcttgccgcagctggggctgaaatt 447
           ||||| || ||||| ||||| || || ||  ||||||| || ||||| |||||||||
Sbjct: 365 gataatggatatggttgggccatagccaaatctcttgctgctgctggtgctgaaatt 421
to top
>ref|NM_126612.2| Arabidopsis thaliana MOD1 (MOSAIC DEATH 1); enoyl-[acyl-carrier
           protein] reductase (NADH)/ oxidoreductase AT2G05990
           (MOD1) transcript variant AT2G05990.1 mRNA, complete cds
          Length = 1606

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 431 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 490

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 491 gcaaaatctcttgctgctgctggagctgaaat 522
to top
>ref|NM_179609.1| Arabidopsis thaliana MOD1 (MOSAIC DEATH 1); enoyl-[acyl-carrier
           protein] reductase (NADH)/ oxidoreductase AT2G05990
           (MOD1) transcript variant AT2G05990.2 mRNA, complete cds
          Length = 1639

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 464 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 523

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 524 gcaaaatctcttgctgctgctggagctgaaat 555
to top
>gb|AF327528.1| Arabidopsis thaliana At2g05990 mRNA sequence
          Length = 1314

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 400 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 459

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 460 gcaaaatctcttgctgctgctggagctgaaat 491
to top
>gb|AY113962.1| Arabidopsis thaliana putative enoyl-ACP reductase enr-A (At2g05990)
           mRNA, complete cds
          Length = 1204

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 277 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 336

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 337 gcaaaatctcttgctgctgctggagctgaaat 368
to top
>gb|AY056192.1| Arabidopsis thaliana putative enoyl-ACP reductase enr-A (At2g05990)
           mRNA, complete cds
          Length = 1561

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 435 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 494

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 495 gcaaaatctcttgctgctgctggagctgaaat 526
to top
>gb|AF324719.2|AF324719 Arabidopsis thaliana At2g05990 (At2g05990/T6P5.19) mRNA, complete
           cds
          Length = 1335

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 400 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 459

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 460 gcaaaatctcttgctgctgctggagctgaaat 491
to top
>emb|BX820208.1|CNS0AA28 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZH11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1376

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 290 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 349

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 350 gcaaaatctcttgctgctgctggagctgaaat 381
to top
>emb|BX820100.1|CNS0AA6U Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS74ZA07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1427

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 336 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 395

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 396 gcaaaatctcttgctgctgctggagctgaaat 427
to top
>emb|BX819977.1|CNS0AA6V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZB05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1468

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 398 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 457

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 458 gcaaaatctcttgctgctgctggagctgaaat 489
to top
>emb|BX819653.1|CNS0AA6M Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS11ZF12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1399

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 310 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 369

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 370 gcaaaatctcttgctgctgctggagctgaaat 401
to top
>gb|AF207593.1|AF207593 Arabidopsis thaliana enoyl-ACP reductase (ENR1) mRNA, complete cds
          Length = 1597

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           |||||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || 
Sbjct: 464 agagggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccata 523

                                           
Query: 415 gcaaaggctcttgccgcagctggggctgaaat 446
           |||||  ||||||| || ||||| ||||||||
Sbjct: 524 gcaaaatctcttgctgctgctggagctgaaat 555
to top
>gb|AC005970.3| Arabidopsis thaliana chromosome 2 clone T6P5 map mi310, complete sequence
          Length = 121160

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                          
Query: 357    agggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgc 416
              |||||||||||| || ||||||||  | ||||||||||| |||||||| ||||| || ||
Sbjct: 107142 agggaaaagagctttcattgctggtatagctgatgataatggctatggttgggccatagc 107201

                                            
Query: 417    aaaggctcttgccgcagctggggctgaaat 446
              |||  ||||||| || ||||| ||||||||
Sbjct: 107202 aaaatctcttgctgctgctggagctgaaat 107231
to top
>emb|AJ243089.1|BNA243089 Brassica napus mRNA for enoyl-[acyl-carrier protein] reductase,
           isoform B1 (enrB1 gene)
          Length = 1384

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 95/116 (81%)
 Strand = Plus / Plus

                                                                       
Query: 331 tcttctgggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgat 390
           |||||||| || ||||| ||| | ||||||||||| || |||||||||||  | ||||||
Sbjct: 299 tcttctggacttcccattgatttgagagggaaaagggcctttattgctggtatagctgat 358

                                                                   
Query: 391 gataacggctatggctgggcaattgcaaaggctcttgccgcagctggggctgaaat 446
           ||||| || ||||| ||||| || || ||  ||||||| || ||||| ||||||||
Sbjct: 359 gataatggatatggttgggccatagccaaatctcttgctgctgctggtgctgaaat 414
to top
>emb|Y13860.1|ATENRA Arabidopsis thaliana enr-A gene
          Length = 4198

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                        
Query: 357  agggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaattgc 416
            |||||||||||| || ||||||||  | ||||||||||| ||||| || ||||| || ||
Sbjct: 1840 agggaaaagagctttcattgctggtatagctgatgataatggctacggttgggccatagc 1899

                                          
Query: 417  aaaggctcttgccgcagctggggctgaaat 446
            |||  ||||||| || ||||| ||||||||
Sbjct: 1900 aaaatctcttgctgctgctggagctgaaat 1929
to top
>gb|S60064.1|S60064 Brassica napus enoyl-acyl carrier protein reductase mRNA, complete
           cds
          Length = 1358

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 331 tcttctgggctgcccatcgatcttagagggaaaagagcatttattgctggggttgctgat 390
           |||||||| || ||||| ||| | |||||||||||||| |||||||||||  | ||||||
Sbjct: 287 tcttctggacttcccattgatttgagagggaaaagagcctttattgctggtatagctgat 346

                
Query: 391 gataa 395
           |||||
Sbjct: 347 gataa 351
to top
>emb|AJ243088.1|BNA243088 Brassica napus mRNA for enoyl-[acyl-carrier protein] reductase,
           isoform A2 (enrA2 gene)
          Length = 1332

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 88/109 (80%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           ||||||||||| || || ||||||||  | ||||||||||| || ||||| ||||| || 
Sbjct: 304 agagggaaaagggctttcattgctggtatagctgatgataatggatatggttgggccata 363

                                                            
Query: 415 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatggg 463
           || ||  ||||||| || ||||| ||||||||  | ||||| |||||||
Sbjct: 364 gccaaatctcttgctgctgctggtgctgaaatattggttgggacatggg 412
to top
>emb|AJ243087.1|BNA243087 Brassica napus mRNA for enoyl-[acyl-carrier protein] reductase,
           isoform 1A, (enrA1 gene)
          Length = 1349

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 88/109 (80%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           ||||||||||| || || ||||||||  | ||||||||||| || ||||| ||||| || 
Sbjct: 329 agagggaaaagggctttcattgctggtatagctgatgataatggatatggttgggccata 388

                                                            
Query: 415 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatggg 463
           || ||  ||||||| || ||||| ||||||||  | ||||| |||||||
Sbjct: 389 gccaaatctcttgctgctgctggtgctgaaatattggttgggacatggg 437
to top
>gb|AC154828.2| Mus musculus BAC clone RP24-549A19 from 13, complete sequence
          Length = 138426

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 52     ctcccccacccagatccctccctc 75
              ||||||||||||||||||||||||
Sbjct: 112835 ctcccccacccagatccctccctc 112858
to top
>emb|CT009754.11| Mouse DNA sequence from clone RP23-5P19 on chromosome 13, complete
             sequence
          Length = 255133

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 52    ctcccccacccagatccctccctc 75
             ||||||||||||||||||||||||
Sbjct: 17574 ctcccccacccagatccctccctc 17597
to top
>gb|AC106840.12| Mus musculus chromosome 1, clone RP24-144D4, complete sequence
          Length = 139608

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 45     ccctgtgctcccccacccagatccctccctc 75
              |||||| ||||||||||||| ||||||||||
Sbjct: 125054 ccctgtcctcccccacccagttccctccctc 125084
to top
>gb|AC115000.7| Mus musculus chromosome 1, clone RP24-103F2, complete sequence
          Length = 191603

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 45     ccctgtgctcccccacccagatccctccctc 75
              |||||| ||||||||||||| ||||||||||
Sbjct: 183097 ccctgtcctcccccacccagttccctccctc 183067
to top
>gb|AC122834.2| Mus musculus BAC clone RP23-183H9 from 15, complete sequence
          Length = 191019

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 53     tcccccacccagatccctccctc 75
              |||||||||||||||||||||||
Sbjct: 150742 tcccccacccagatccctccctc 150764
to top
>gb|AC171401.8| Mus musculus chromosome 7, clone RP23-174D7, complete sequence
          Length = 211696

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 52     ctcccccacccagatccctccct 74
              |||||||||||||||||||||||
Sbjct: 144183 ctcccccacccagatccctccct 144205
to top
>gb|AC161261.5| Mus musculus BAC clone RP23-376D23 from chromosome 17, complete
             sequence
          Length = 190041

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 56    cccacccagatccctccctcac 77
             ||||||||||||||||||||||
Sbjct: 45474 cccacccagatccctccctcac 45495
to top
>gb|AC107645.28| Mus musculus chromosome 15, clone RP23-78J21, complete sequence
          Length = 240912

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 56    cccacccagatccctccctca 76
             |||||||||||||||||||||
Sbjct: 66946 cccacccagatccctccctca 66966
to top
>gb|DQ490467.1| Emericella nidulans beta-glucosidase (AN0712-2) mRNA, complete cds
          Length = 2538

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 321  agaaggtagctcttctgggct 341
            |||||||||||||||||||||
Sbjct: 1019 agaaggtagctcttctgggct 1039
to top
>ref|XM_653224.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0712.2), mRNA
          Length = 2538

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 321  agaaggtagctcttctgggct 341
            |||||||||||||||||||||
Sbjct: 1019 agaaggtagctcttctgggct 1039
to top
>gb|AC117243.3| Mus musculus BAC clone RP24-198D9 from 9, complete sequence
          Length = 168127

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    ccacccagatccctccctcac 77
             |||||||||||||||||||||
Sbjct: 78820 ccacccagatccctccctcac 78800
to top
>emb|X95462.1|BNENOYLRD B.napus mRNA for enoyl reductase
          Length = 1351

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 87/109 (79%)
 Strand = Plus / Plus

                                                                       
Query: 355 agagggaaaagagcatttattgctggggttgctgatgataacggctatggctgggcaatt 414
           ||||||||||| || || ||||||||  | ||||||||||| || ||||| ||||| || 
Sbjct: 327 agagggaaaagggctttcattgctggtatagctgatgataatggatatggttgggccata 386

                                                            
Query: 415 gcaaaggctcttgccgcagctggggctgaaattcttgttggtacatggg 463
           || ||  ||||||| || ||||  ||||||||  | ||||| |||||||
Sbjct: 387 gccaaatctcttgctgctgctgctgctgaaatattggttgggacatggg 435
to top
>emb|BX324117.16| Mouse DNA sequence from clone RP23-389N3 on chromosome X, complete
             sequence
          Length = 155139

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 55    ccccacccagatccctccctc 75
             |||||||||||||||||||||
Sbjct: 62877 ccccacccagatccctccctc 62897
to top
>emb|BX000694.9| Mouse DNA sequence from clone RP23-30B5 on chromosome 4, complete
             sequence
          Length = 55045

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 272   cctgctctaggtctcttggttcttg 296
             |||||||| ||||||||||||||||
Sbjct: 19120 cctgctctgggtctcttggttcttg 19144
to top
>gb|AY665242.1| Saimiri boliviensis chondroitin sulfate proteoglycan 3 mRNA, partial
            cds
          Length = 3594

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 40   gcatcccctgtgctcccccacccagatc 67
            ||||||||||||||||||  ||||||||
Sbjct: 1495 gcatcccctgtgctcccctccccagatc 1522
to top
>gb|AC107839.14| Mus musculus chromosome 7, clone RP23-284K1, complete sequence
          Length = 170751

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 63117 cccacccagatccctccctc 63098
to top
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome
          Length = 2364842

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 148     gcgcagatgctggccgcacgcccc 171
               |||||| |||||||||||||||||
Sbjct: 1841788 gcgcaggtgctggccgcacgcccc 1841811
to top
>gb|AC116726.11| Mus musculus chromosome 10, clone RP23-285L15, complete sequence
          Length = 185427

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 52    ctcccccacccagatccctccctc 75
             ||||| ||||||||||||||||||
Sbjct: 24388 ctccctcacccagatccctccctc 24411
to top
>gb|AC109283.8| Mus musculus chromosome 1, clone RP24-156F3, complete sequence
          Length = 133845

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 38985 cccacccagatccctccctc 39004
to top
>gb|AC122773.8| Mus musculus chromosome 1, clone RP24-160N7, complete sequence
          Length = 142124

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 56   cccacccagatccctccctc 75
            ||||||||||||||||||||
Sbjct: 1851 cccacccagatccctccctc 1870
to top
>gb|AF125314.2| Mus musculus chromosome X clones MP1-C03180, MP1-C22301, CT7-374D15,
              proximal part, complete sequence
          Length = 300285

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 161127 cccacccagatccctccctc 161146
to top
>gb|AC095999.8| Rattus norvegicus 4 BAC CH230-12B2 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 217673

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 52   ctcccccacccagatccctccctc 75
            ||||||||||||| ||||||||||
Sbjct: 4573 ctcccccacccagttccctccctc 4596
to top
>gb|AC115719.10| Mus musculus chromosome 18, clone RP24-356J16, complete sequence
          Length = 177037

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    ctcccccacccagatccctc 71
             ||||||||||||||||||||
Sbjct: 90576 ctcccccacccagatccctc 90595
to top
>gb|AC101956.5| Mus musculus chromosome 5, clone RP24-166L23, complete sequence
          Length = 183807

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 12762 cccacccagatccctccctc 12743
to top
>gb|AC147985.3| Mus musculus BAC clone RP24-402C11 from chromosome 19, complete sequence
          Length = 170479

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 126584 cccacccagatccctccctc 126603
to top
>gb|AC140303.3| Mus musculus BAC clone RP23-381H21 from chromosome 3, complete sequence
          Length = 192020

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 162172 cccacccagatccctccctc 162153
to top
>gb|AC091353.6| Rattus norvegicus 4 BAC CH230-1B20 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 242904

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 52     ctcccccacccagatccctccctc 75
              ||||||||||||| ||||||||||
Sbjct: 126031 ctcccccacccagttccctccctc 126054
to top
>gb|AC095825.6| Rattus norvegicus 4 BAC CH230-9J6 (Children's Hospital Oakland Research
             Institute) complete sequence
          Length = 234084

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 52    ctcccccacccagatccctccctc 75
             ||||||||||||| ||||||||||
Sbjct: 12173 ctcccccacccagttccctccctc 12150
to top
>gb|AC124181.3| Mus musculus BAC clone RP23-204B12 from chromosome 18, complete sequence
          Length = 220244

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 138365 cccacccagatccctccctc 138384
to top
>gb|AC140311.2| Mus musculus BAC clone RP23-392M3 from chromosome 9, complete sequence
          Length = 195460

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 187361 cccacccagatccctccctc 187342
to top
>gb|AC162527.5| Mus musculus BAC clone RP23-30M17 from chromosome 14, complete sequence
          Length = 200348

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 52    ctcccccacccagatccctccctc 75
             ||||||| ||||||||||||||||
Sbjct: 73405 ctccccctcccagatccctccctc 73382
to top
>gb|AC114010.6| Mus musculus BAC clone RP24-378K23 from chromosome 12, complete
             sequence
          Length = 175670

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 50378 cccacccagatccctccctc 50397
to top
>gb|AC123985.10| Mus musculus chromosome 14, clone RP23-154G18, complete sequence
          Length = 229313

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 52     ctcccccacccagatccctccctc 75
              ||||||| ||||||||||||||||
Sbjct: 218715 ctccccctcccagatccctccctc 218738
to top
>gb|AC132458.3| Mus musculus BAC clone RP23-152C8 from chromosome 5, complete sequence
          Length = 219470

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 52    ctcccccacccagatccctccctc 75
             ||||||||||||| ||||||||||
Sbjct: 92450 ctcccccacccaggtccctccctc 92427
to top
>emb|CT025565.5| Mouse DNA sequence from clone RP24-126K5 on chromosome 17, complete
             sequence
          Length = 175523

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 11839 cccacccagatccctccctc 11858
to top
>gb|AC137749.11| Mus musculus chromosome 6, clone RP23-69C16, complete sequence
          Length = 293695

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 241634 cccacccagatccctccctc 241653
to top
>gb|AC125460.4| Mus musculus BAC clone RP24-448D10 from chromosome 15, complete
             sequence
          Length = 205859

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 94676 cccacccagatccctccctc 94657
to top
>gb|AC126552.5| Mus musculus BAC clone RP23-342F3 from chromosome 15, complete sequence
          Length = 213862

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 171253 cccacccagatccctccctc 171234
to top
>gb|AC122416.4| Mus musculus BAC clone RP24-157E17 from chromosome 9, complete sequence
          Length = 140024

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 58505 cccacccagatccctccctc 58486
to top
>gb|AC122261.2| Mus musculus BAC clone RP23-187F24 from 15, complete sequence
          Length = 223801

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 196265 cccacccagatccctccctc 196284
to top
>gb|AC117670.15| Mus musculus chromosome 7, clone RP23-383P11, complete sequence
          Length = 219661

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 56   cccacccagatccctccctc 75
            ||||||||||||||||||||
Sbjct: 4045 cccacccagatccctccctc 4064
to top
>gb|AC104863.12| Mus musculus chromosome 6, clone RP23-109C11, complete sequence
          Length = 198321

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 154998 cccacccagatccctccctc 155017
to top
>gb|AC036121.11| Mus musculus chromosome 6, clone RP23-158O9, complete sequence
          Length = 215685

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 133013 cccacccagatccctccctc 133032
to top
>gb|AC112662.7| Mus musculus chromosome 5, clone RP23-467F2, complete sequence
          Length = 200679

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 107206 cccacccagatccctccctc 107225
to top
>gb|AC165082.2| Mus musculus BAC clone RP23-412H17 from chromosome 17, complete sequence
          Length = 196132

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 190637 cccacccagatccctccctc 190656
to top
>gb|AC102609.7| Mus musculus, clone RP23-403I3, complete sequence
          Length = 208575

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    tcttctcccgaggctggtgg 105
             ||||||||||||||||||||
Sbjct: 66662 tcttctcccgaggctggtgg 66643
to top
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 143    ccggcgcgcagatgctggcc 162
              ||||||||||||||||||||
Sbjct: 364221 ccggcgcgcagatgctggcc 364240
to top
>gb|AC117633.6| Mus musculus, clone RP23-200C8, complete sequence
          Length = 224221

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 204567 cccacccagatccctccctc 204548
to top
>gb|AC116071.5| Rattus norvegicus 3 BAC CH230-230O7 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 224778

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 356    gagggaaaagagcatttattgctg 379
              |||||| |||||||||||||||||
Sbjct: 180093 gagggataagagcatttattgctg 180116
to top
>gb|AC166324.1| Mus musculus BAC clone RP24-500J7 from chromosome 9, complete sequence
          Length = 168018

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 52     ctcccccacccagatccctccctc 75
              |||||||||||| |||||||||||
Sbjct: 120503 ctcccccacccatatccctccctc 120526
to top
>emb|AL607126.9| Mouse DNA sequence from clone RP23-206I16 on chromosome 11, complete
             sequence
          Length = 221930

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 43    tcccctgtgctcccccacccagatccct 70
             |||||| | |||||||||||||||||||
Sbjct: 87989 tcccctctcctcccccacccagatccct 87962
to top
>emb|AL935054.11| Mouse DNA sequence from clone RP23-280A12 on chromosome 11 Contains the
              5' end of the gene for a novel protein (C330012F17Rik,
              C130096N06Rik), a ribosomal protein L37a (Rpl37a)
              pseudogene, a pseudogene similar to part of a novel protein
              (D130064H19Rik), a fibrillarin (Fbl) pseudogene, the 5' end
              of the gene for a novel protein (4931428D14Rik)
              (2300003H10) and three CpG islands, complete sequence
          Length = 199018

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 132333 cccacccagatccctccctc 132352
to top
>gb|AC108211.3| Homo sapiens BAC clone RP11-511I14 from 4, complete sequence
          Length = 222457

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 430   gcagctggggctgaaattct 449
             ||||||||||||||||||||
Sbjct: 54248 gcagctggggctgaaattct 54229
to top
>dbj|AK033076.1| Mus musculus adult male corpus striatum cDNA, RIKEN full-length
           enriched library, clone:7630403P10
           product:unclassifiable, full insert sequence
          Length = 1299

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 56  cccacccagatccctccctc 75
           ||||||||||||||||||||
Sbjct: 429 cccacccagatccctccctc 410
to top
>gb|AC155310.2| Mus musculus BAC clone RP24-81L10 from chromosome 14, complete sequence
          Length = 177707

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 52     ctcccccacccagatccctccctc 75
              |||||||| |||||||||||||||
Sbjct: 145254 ctcccccaaccagatccctccctc 145231
to top
>gb|AC158380.2| Mus musculus BAC clone RP24-178I16 from chromosome 6, complete sequence
          Length = 168179

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 145472 cccacccagatccctccctc 145491
to top
>gb|AC012382.14|AC012382 Mus musculus chromosome 7, clone RP23-92L23, complete sequence
          Length = 276523

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 224354 cccacccagatccctccctc 224335
to top
>gb|AC157276.2| Mus musculus BAC clone RP23-426N20 from chromosome 12, complete
             sequence
          Length = 220385

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 56781 cccacccagatccctccctc 56800
to top
>gb|AC005237.2|AC005237 Homo sapiens BAC clone RP11-556H17 from 2, complete sequence
          Length = 175179

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 307   agagcggtgtcaggagaagg 326
             ||||||||||||||||||||
Sbjct: 50024 agagcggtgtcaggagaagg 50043
to top
>gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosome 9, complete sequence
          Length = 212426

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 164933 cccacccagatccctccctc 164952
to top
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 365     gagcatttattgctggggtt 384
               ||||||||||||||||||||
Sbjct: 4318399 gagcatttattgctggggtt 4318380
to top
>gb|AC084382.2| Mus musculus BAC clone RP23-5K17 from 15, complete sequence
          Length = 164883

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 52     ctcccccacccagatccctccctc 75
              ||||||||||||| ||||||||||
Sbjct: 114955 ctcccccacccagttccctccctc 114932
to top
>emb|CT009515.16| Mouse DNA sequence from clone RP23-117H6 on chromosome 14, complete
             sequence
          Length = 197196

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 13916 cccacccagatccctccctc 13935
to top
>gb|AC100406.7| Mus musculus chromosome 9, clone RP23-134M7, complete sequence
          Length = 183837

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 110846 cccacccagatccctccctc 110827
to top
>gb|AC110216.10| Mus musculus chromosome 18, clone RP24-502I6, complete sequence
          Length = 201138

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 113601 cccacccagatccctccctc 113582
to top
>gb|AC159965.5| Mus musculus chromosome 15, clone RP23-471C16, complete sequence
          Length = 173156

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 129285 cccacccagatccctccctc 129266
to top
>emb|CT030260.9| Mouse DNA sequence from clone RP23-462I24 on chromosome 12, complete
              sequence
          Length = 164672

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 103248 cccacccagatccctccctc 103267
to top
>gb|AC133576.10| Mus musculus chromosome 19, clone RP23-204H15, complete sequence
          Length = 213096

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 12176 cccacccagatccctccctc 12195
to top
>emb|CT027564.7| Mouse DNA sequence from clone RP24-293N14 on chromosome 16, complete
             sequence
          Length = 180784

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 52    ctcccccacccagatccctccctc 75
             ||||||| ||||||||||||||||
Sbjct: 14746 ctcccccccccagatccctccctc 14769
to top
>emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chromosome 14, complete
             sequence
          Length = 194408

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 12496 cccacccagatccctccctc 12477
to top
>emb|AL844852.11| Mouse DNA sequence from clone RP23-260N23 on chromosome 2, complete
              sequence
          Length = 257676

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 143956 cccacccagatccctccctc 143937
to top
>emb|CT030684.4| Mouse DNA sequence from clone RP24-88G11 on chromosome 14, complete
            sequence
          Length = 200616

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 52   ctcccccacccagatccctccctc 75
            |||||||| |||||||||||||||
Sbjct: 8157 ctcccccaaccagatccctccctc 8180
to top
>emb|AL662929.15| Mouse DNA sequence from clone RP23-435E13 on chromosome 11, complete
             sequence
          Length = 140752

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 68374 cccacccagatccctccctc 68355
to top
>emb|AL929556.14| Mouse DNA sequence from clone RP23-353B17 on chromosome 2, complete
              sequence
          Length = 192715

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 118724 cccacccagatccctccctc 118743
to top
>gb|AC172892.1| Mus musculus BAC clone RP23-269B2 from chromosome 16, complete sequence
          Length = 206740

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 52    ctcccccacccagatccctccctc 75
             ||||||| ||||||||||||||||
Sbjct: 31443 ctcccccccccagatccctccctc 31420
to top
>emb|AL928601.6| Mouse DNA sequence from clone RP23-88B5 on chromosome 11, complete
             sequence
          Length = 55129

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 32154 cccacccagatccctccctc 32135
to top
>emb|AL773590.8| Mouse DNA sequence from clone RP23-181A13 on chromosome 2, complete
             sequence
          Length = 185348

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 27763 cccacccagatccctccctc 27782
to top
>emb|AL671910.9| Mouse DNA sequence from clone RP23-245M12 on chromosome X, complete
             sequence
          Length = 141713

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 52    ctcccccacccagatccctccctc 75
             |||||||||| |||||||||||||
Sbjct: 37948 ctcccccaccaagatccctccctc 37971
to top
>emb|AL671888.8| Mouse DNA sequence from clone RP23-247O14 on chromosome X, complete
             sequence
          Length = 52491

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 44    cccctgtgctcccccacccagatccctccctc 75
             ||||| |||||||||||| || ||||||||||
Sbjct: 22593 cccctatgctcccccacctagttccctccctc 22562
to top
>emb|AL672054.5| Mouse DNA sequence from clone RP23-237I22 on chromosome X, complete
              sequence
          Length = 187770

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 100824 cccacccagatccctccctc 100805
to top
>emb|AL691469.9| Mouse DNA sequence from clone RP23-248F18 on chromosome 2, complete
              sequence
          Length = 191923

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 44     cccctgtgctcccccacccagatccctccctc 75
              ||||| ||||| || |||||||||||||||||
Sbjct: 171937 cccctctgctctccaacccagatccctccctc 171906
to top
>emb|AL772145.9| Mouse DNA sequence from clone RP23-212H4 on chromosome 3, complete
              sequence
          Length = 228623

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 140661 cccacccagatccctccctc 140680
to top
>gb|AC151299.3| Mus musculus BAC clone RP23-11N17 from chromosome 17, complete sequence
          Length = 206555

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 54285 cccacccagatccctccctc 54266
to top
>emb|AL929399.6| Mouse DNA sequence from clone RP23-59E24 on chromosome 4, complete
             sequence
          Length = 120490

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 40613 cccacccagatccctccctc 40632
to top
>emb|AL671982.4| Mouse DNA sequence from clone RP23-132H1 on chromosome X, complete
              sequence
          Length = 190627

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 137670 cccacccagatccctccctc 137651
to top
>emb|AL731789.9| Mouse DNA sequence from clone RP23-52F6 on chromosome X, complete
             sequence
          Length = 218939

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 68811 cccacccagatccctccctc 68830
to top
>dbj|AP003145.1| Mus musculus genomic DNA, chromosome 7, clone:RP23-17N3, complete
              sequences
          Length = 138654

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     cccacccagatccctccctc 75
              ||||||||||||||||||||
Sbjct: 102544 cccacccagatccctccctc 102525
to top
>emb|AL772294.6| Mouse DNA sequence from clone RP23-125F4 on chromosome X, complete
             sequence
          Length = 144678

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    cccacccagatccctccctc 75
             ||||||||||||||||||||
Sbjct: 29552 cccacccagatccctccctc 29571


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,287,353
Number of Sequences: 3902068
Number of extensions: 3287353
Number of successful extensions: 63333
Number of sequences better than 10.0: 122
Number of HSP's better than 10.0 without gapping: 122
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63036
Number of HSP's gapped (non-prelim): 297
length of query: 463
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 441
effective length of database: 17,147,199,772
effective search space: 7561915099452
effective search space used: 7561915099452
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top