Clone Name	bart49h11
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK103322.1| Oryza sativa (japonica cultivar-group) cDNA clon...	224	2e-55
2	ref|NM_190066.1| Oryza sativa (japonica cultivar-group), predic...	222	8e-55
3	gb|BT018453.1| Zea mays clone EL01N0408D06.d mRNA sequence	113	5e-22
4	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
5	dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
6	ref|XM_475148.1| Oryza sativa (japonica cultivar-group), predic...	105	1e-19
7	dbj|AK102012.1| Oryza sativa (japonica cultivar-group) cDNA clon...	105	1e-19
8	gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome...	62	2e-06
9	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	62	2e-06
10	emb|AL512288.19| Human DNA sequence from clone RP11-460I13 on ch...	46	0.10
11	emb|AL157902.6| Human DNA sequence from clone RP4-675C20 on chro...	44	0.41
12	emb|AJ251365.1|NPL251365 Nicotiana plumbaginifolia mRNA for VAP27	44	0.41
13	ref|XM_467003.1| Oryza sativa (japonica cultivar-group), mRNA	42	1.6
14	ref|XM_752663.1| Ustilago maydis 521 hypothetical protein (UM016...	42	1.6
15	gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome	42	1.6
16	gb|AF157904.1| Spermophilus musicus isolate S52 cytochrome b (cy...	40	6.5
17	gb|AF157900.1| Spermophilus musicus isolate S49 cytochrome b (cy...	40	6.5
18	gb|AY374271.1| Etheostoma proeliare cytochrome b (cytb) gene, pa...	40	6.5
19	gb|AY217805.1| Mabuya spilogaster isolate L1 cytochrome b (cytb)...	40	6.5
20	gb|AY843894.1| Hyla picta cytochrome b (cytb) gene, partial cds;...	40	6.5
21	gb|AF469426.1| Podarcis bocagei isolate Gpb6 cytochrome b gene, ...	40	6.5
22	gb|AF469424.1| Podarcis bocagei isolate MP3 cytochrome b gene, p...	40	6.5
23	emb|AL627362.2|CNS07TIX DNA centromeric region sequence from BAC...	40	6.5
24	gb|AF372119.1| Lacerta schreiberi haplotype 17 cytochrome b (cyt...	40	6.5
25	gb|AF372118.1| Lacerta schreiberi haplotype 16 cytochrome b (cyt...	40	6.5
26	emb|BX936343.9| Zebrafish DNA sequence from clone CH211-51C14 in...	40	6.5
27	gb|AY395623.1| Podoces biddulphi voucher NRM 568806 cytochrome b...	40	6.5
28	gb|AF372088.1| Podarcis bocagei isolate Pbb6 cytochrome b gene, ...	40	6.5
29	gb|AF372087.1| Podarcis bocagei isolate Pbb5 cytochrome b gene, ...	40	6.5
30	gb|AF386541.1| Etheostoma exile isolate EexeA cytochrome b gene,...	40	6.5
31	gb|AF261224.1| Pteronotropis hubbsi specimen-voucher UAIC 7988.0...	40	6.5
32	gb|AF370658.1|AF370658 Geophagus sp. Farias 100 cytochrome b (cy...	40	6.5
33	gb|AF499600.1| Hemibagrus nemurus cytochrome b (cytb) gene, part...	40	6.5
34	gb|AF212975.1|AF212975 Bolitoglossa mexicana isolate MEX_4C cyto...	40	6.5
35	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	40	6.5
36	dbj|AB120177.1| Cobitis hankugensis mitochondrial DNA, partial s...	40	6.5
37	gb|AF212099.1|AF212099 Bolitoglossa mexicana specimen-voucher MV...	40	6.5
38	dbj|AB043880.1| Callosciurus prevostii mitochondrial cytb gene f...	40	6.5
39	dbj|AB043879.1| Callosciurus prevostii mitochondrial cytb gene f...	40	6.5
40	gb|DQ081139.1| Podarcis bocagei isolate BTA1 cytochrome b gene, ...	40	6.5
41	gb|AC002981.1|AC002981 Homo sapiens Xp22 BAC GS279A12 (Genome Sy...	40	6.5
42	emb|BX649397.8| Zebrafish DNA sequence from clone CH211-14J20 in...	40	6.5
43	gb|U46183.1|SSU46183 Sciurus stramineus cytochrome b gene, mitoc...	40	6.5
44	emb|AJ297676.1|GSP297676 Geophagus sp. 1-JSR-2000 mitochondrial ...	40	6.5
45	gb|DQ119372.1| Hemibagrus wyckioides cytochrome b and tRNA-Thr g...	40	6.5

---

>dbj|AK103322.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033125J06, full
           insert sequence
          Length = 1784

 Score =  224 bits (113), Expect = 2e-55
 Identities = 176/197 (89%)
 Strand = Plus / Plus

                                                                       
Query: 282 gatgggccagggcgtcgtctagatccagccccgcgagctccagttcacctttgagctgaa 341
           ||||||||||| | ||| | ||||||| || |||||||||||||||||||||||| ||||
Sbjct: 212 gatgggccaggacctcgccgagatccaccctcgcgagctccagttcacctttgaggtgaa 271

                                                                       
Query: 342 gaagcagagttcatgttctgtccatcttgtcaacaaatccgatgaatatgtcgctttcaa 401
           |||||| ||||||||| ||||||||||||||||||||||| ||||||||||||| |||||
Sbjct: 272 gaagcaaagttcatgtactgtccatcttgtcaacaaatccaatgaatatgtcgcattcaa 331

                                                                       
Query: 402 ggttaagacaacttcccctaaaagatattgcgtccgaccaaatattggagttatccttcc 461
           |||||| ||||| || |||||||| ||||| || |||||||| | |||||| ||||||||
Sbjct: 332 ggttaaaacaacatcacctaaaaggtattgtgttcgaccaaacactggagtcatccttcc 391

                            
Query: 462 aagggcaacatgtgatt 478
           |||| ||||||||||||
Sbjct: 392 aaggtcaacatgtgatt 408

---

>ref|NM_190066.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1185

 Score =  222 bits (112), Expect = 8e-55
 Identities = 175/196 (89%)
 Strand = Plus / Plus

                                                                       
Query: 283 atgggccagggcgtcgtctagatccagccccgcgagctccagttcacctttgagctgaag 342
           |||||||||| | ||| | ||||||| || |||||||||||||||||||||||| |||||
Sbjct: 1   atgggccaggacctcgccgagatccaccctcgcgagctccagttcacctttgaggtgaag 60

                                                                       
Query: 343 aagcagagttcatgttctgtccatcttgtcaacaaatccgatgaatatgtcgctttcaag 402
           ||||| ||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||
Sbjct: 61  aagcaaagttcatgtactgtccatcttgtcaacaaatccaatgaatatgtcgcattcaag 120

                                                                       
Query: 403 gttaagacaacttcccctaaaagatattgcgtccgaccaaatattggagttatccttcca 462
           ||||| ||||| || |||||||| ||||| || |||||||| | |||||| |||||||||
Sbjct: 121 gttaaaacaacatcacctaaaaggtattgtgttcgaccaaacactggagtcatccttcca 180

                           
Query: 463 agggcaacatgtgatt 478
           ||| ||||||||||||
Sbjct: 181 aggtcaacatgtgatt 196

---

>gb|BT018453.1| Zea mays clone EL01N0408D06.d mRNA sequence
          Length = 1477

 Score =  113 bits (57), Expect = 5e-22
 Identities = 162/197 (82%)
 Strand = Plus / Plus

                                                                       
Query: 280 gcgatgggccagggcgtcgtctagatccagccccgcgagctccagttcacctttgagctg 339
           |||||||| |||| | ||||| ||||||| || ||||||||||||||||| |||||| ||
Sbjct: 54  gcgatggggcaggacctcgtcgagatccacccgcgcgagctccagttcacatttgaggtg 113

                                                                       
Query: 340 aagaagcagagttcatgttctgtccatcttgtcaacaaatccgatgaatatgtcgctttc 399
           ||||| || |||||||||  ||||   ||   |||||| ||| | |||||||| ||||| 
Sbjct: 114 aagaaacaaagttcatgtgttgtctgcctaaccaacaagtccaacgaatatgttgctttt 173

                                                                       
Query: 400 aaggttaagacaacttcccctaaaagatattgcgtccgaccaaatattggagttatcctt 459
           |||||||| || || |||||||||||||| || || ||||||||||  || |||||||||
Sbjct: 174 aaggttaaaacgacatcccctaaaagatactgtgttcgaccaaataccggggttatcctt 233

                            
Query: 460 ccaagggcaacatgtga 476
           || |||  |||||||||
Sbjct: 234 ccgaggaaaacatgtga 250

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                            
Query: 332      ttgagctgaagaagcagagttcatgttctgtccatcttgtcaacaaatccgatgaatatg 391
                ||||| |||||||||| ||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 41113101 ttgaggtgaagaagcaaagttcatgtactgtccatcttgtcaacaaatccaatgaatatg 41113042

                              
Query: 392      tcgctttcaaggtt 405
                |||| |||||||||
Sbjct: 41113041 tcgcattcaaggtt 41113028



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                            
Query: 401      aggttaagacaacttcccctaaaagatattgcgtccgaccaaatattggagttatccttc 460
                ||||||| ||||| || |||||||| ||||| || |||||||| | |||||| |||||||
Sbjct: 41112497 aggttaaaacaacatcacctaaaaggtattgtgttcgaccaaacactggagtcatccttc 41112438

                                  
Query: 461      caagggcaacatgtgatt 478
                ||||| ||||||||||||
Sbjct: 41112437 caaggtcaacatgtgatt 41112420



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                                  
Query: 282      gatgggccagggcgtcgtctagatccagccccgcgagctccagttcacct 331
                ||||||||||| | ||| | ||||||| || |||||||||||||||||||
Sbjct: 41114364 gatgggccaggacctcgccgagatccaccctcgcgagctccagttcacct 41114315

---

>dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0504E02
          Length = 137468

 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                         
Query: 332   ttgagctgaagaagcagagttcatgttctgtccatcttgtcaacaaatccgatgaatatg 391
             ||||| |||||||||| ||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 10156 ttgaggtgaagaagcaaagttcatgtactgtccatcttgtcaacaaatccaatgaatatg 10097

                           
Query: 392   tcgctttcaaggtt 405
             |||| |||||||||
Sbjct: 10096 tcgcattcaaggtt 10083



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                        
Query: 401  aggttaagacaacttcccctaaaagatattgcgtccgaccaaatattggagttatccttc 460
            ||||||| ||||| || |||||||| ||||| || |||||||| | |||||| |||||||
Sbjct: 9552 aggttaaaacaacatcacctaaaaggtattgtgttcgaccaaacactggagtcatccttc 9493

                              
Query: 461  caagggcaacatgtgatt 478
            ||||| ||||||||||||
Sbjct: 9492 caaggtcaacatgtgatt 9475



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 282   gatgggccagggcgtcgtctagatccagccccgcgagctccagttcacct 331
             ||||||||||| | ||| | ||||||| || |||||||||||||||||||
Sbjct: 11419 gatgggccaggacctcgccgagatccaccctcgcgagctccagttcacct 11370

---

>ref|XM_475148.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1434

 Score =  105 bits (53), Expect = 1e-19
 Identities = 122/145 (84%)
 Strand = Plus / Plus

                                                                       
Query: 331 tttgagctgaagaagcagagttcatgttctgtccatcttgtcaacaaatccgatgaatat 390
           |||||| |||||||| | |||||||||| ||||  ||| || |||||||| || ||||||
Sbjct: 58  tttgaggtgaagaagaaaagttcatgttatgtctgtctagtgaacaaatcagaggaatat 117

                                                                       
Query: 391 gtcgctttcaaggttaagacaacttcccctaaaagatattgcgtccgaccaaatattgga 450
           || || |||||||| || |||||||| || ||||| ||||| || ||||||||| | |||
Sbjct: 118 gttgcattcaaggtcaaaacaacttctccaaaaaggtattgtgttcgaccaaatgtagga 177

                                    
Query: 451 gttatccttccaagggcaacatgtg 475
           || || |||||||||||||||||||
Sbjct: 178 gtcattcttccaagggcaacatgtg 202

---

>dbj|AK102012.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033080D06, full
           insert sequence
          Length = 2055

 Score =  105 bits (53), Expect = 1e-19
 Identities = 122/145 (84%)
 Strand = Plus / Plus

                                                                       
Query: 331 tttgagctgaagaagcagagttcatgttctgtccatcttgtcaacaaatccgatgaatat 390
           |||||| |||||||| | |||||||||| ||||  ||| || |||||||| || ||||||
Sbjct: 291 tttgaggtgaagaagaaaagttcatgttatgtctgtctagtgaacaaatcagaggaatat 350

                                                                       
Query: 391 gtcgctttcaaggttaagacaacttcccctaaaagatattgcgtccgaccaaatattgga 450
           || || |||||||| || |||||||| || ||||| ||||| || ||||||||| | |||
Sbjct: 351 gttgcattcaaggtcaaaacaacttctccaaaaaggtattgtgttcgaccaaatgtagga 410

                                    
Query: 451 gttatccttccaagggcaacatgtg 475
           || || |||||||||||||||||||
Sbjct: 411 gtcattcttccaagggcaacatgtg 435

---

>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0025P09, complete sequence
          Length = 167318

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                         
Query: 409   acaacttcccctaaaagatattgcgtccgaccaaatattggagttatccttccaagggca 468
             |||||||| || ||||| ||||| || ||||||||| | ||||| || ||||||||||||
Sbjct: 83646 acaacttctccaaaaaggtattgtgttcgaccaaatgtaggagtcattcttccaagggca 83587

                    
Query: 469   acatgtg 475
             |||||||
Sbjct: 83586 acatgtg 83580

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                            
Query: 409      acaacttcccctaaaagatattgcgtccgaccaaatattggagttatccttccaagggca 468
                |||||||| || ||||| ||||| || ||||||||| | ||||| || ||||||||||||
Sbjct: 17823692 acaacttctccaaaaaggtattgtgttcgaccaaatgtaggagtcattcttccaagggca 17823633

                       
Query: 469      acatgtg 475
                |||||||
Sbjct: 17823632 acatgtg 17823626

---

>emb|AL512288.19| Human DNA sequence from clone RP11-460I13 on chromosome 1 Contains the
             gene for acid sphingomyelinase-like phosphodiesterase
             (ASML3B), the gene for a novel protein (FLJ10307), two
             novel genes, the 3' end of the EYA3 gene for eyes absent
             homolog 3 (Drosophila) and an interferon-induced
             transmembrane protein pseudogene, complete sequence
          Length = 113117

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 323   agttcacctttgagctgaagaag 345
             |||||||||||||||||||||||
Sbjct: 33369 agttcacctttgagctgaagaag 33391

---

>emb|AL157902.6| Human DNA sequence from clone RP4-675C20 on chromosome 1p13.2 Contains
              the 3' end of the MAN1A2 gene for mannosidase alpha class
              1A member, a novel pseudogene and the 3' end of a novel
              gene, complete sequence
          Length = 116397

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 333    tgagctgaagaagcagagttca 354
              ||||||||||||||||||||||
Sbjct: 102348 tgagctgaagaagcagagttca 102327

---

>emb|AJ251365.1|NPL251365 Nicotiana plumbaginifolia mRNA for VAP27
          Length = 1241

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 373 aacaaatccgatgaatatgtcgctttcaaggttaagac 410
           ||||| |||||| | ||||||||||||||||| |||||
Sbjct: 136 aacaagtccgataactatgtcgctttcaaggtgaagac 173

---

>ref|XM_467003.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1113

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 382 gatgaatatgtcgctttcaaggttaagacaact 414
           |||||||||||| | || |||||||||||||||
Sbjct: 239 gatgaatatgtcacgtttaaggttaagacaact 271

---

>ref|XM_752663.1| Ustilago maydis 521 hypothetical protein (UM01609.1) partial mRNA
          Length = 930

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 390 tgtcgctttcaaggttaagac 410
           |||||||||||||||||||||
Sbjct: 159 tgtcgctttcaaggttaagac 179

---

>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome
          Length = 2679306

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 51      cctcgtcaaacccgccgacga 71
               |||||||||||||||||||||
Sbjct: 1929691 cctcgtcaaacccgccgacga 1929711

---

>gb|AF157904.1| Spermophilus musicus isolate S52 cytochrome b (cytb) gene, complete
           cds; mitochondrial
          Length = 1140

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 339 aaatattggagttatccttc 358

---

>gb|AF157900.1| Spermophilus musicus isolate S49 cytochrome b (cytb) gene, complete
           cds; mitochondrial
          Length = 1140

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 339 aaatattggagttatccttc 358

---

>gb|AY374271.1| Etheostoma proeliare cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 1111

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 319 aaatattggagttatccttc 338

---

>gb|AY217805.1| Mabuya spilogaster isolate L1 cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 699

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 228 aaatattggagttatccttc 247

---

>gb|AY843894.1| Hyla picta cytochrome b (cytb) gene, partial cds; mitochondrial
          Length = 385

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 322 aaatattggagttatccttc 341

---

>gb|AF469426.1| Podarcis bocagei isolate Gpb6 cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 306

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 243 aaatattggagttatccttc 262

---

>gb|AF469424.1| Podarcis bocagei isolate MP3 cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 306

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 243 aaatattggagttatccttc 262

---

>emb|AL627362.2|CNS07TIX DNA centromeric region sequence from BAC DP15B03, DP38F06 of chromosome
             5 of Podospora anserina
          Length = 156244

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 453   tatccttccaagggcaacat 472
             ||||||||||||||||||||
Sbjct: 43422 tatccttccaagggcaacat 43403

---

>gb|AF372119.1| Lacerta schreiberi haplotype 17 cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 663

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 243 aaatattggagttatccttc 262

---

>gb|AF372118.1| Lacerta schreiberi haplotype 16 cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 663

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 243 aaatattggagttatccttc 262

---

>emb|BX936343.9| Zebrafish DNA sequence from clone CH211-51C14 in linkage group 3,
              complete sequence
          Length = 160177

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 335    agctgaagaagcagagttcatgtt 358
              |||||||||||||||| |||||||
Sbjct: 100029 agctgaagaagcagagatcatgtt 100052

---

>gb|AY395623.1| Podoces biddulphi voucher NRM 568806 cytochrome b gene, partial
           cds; mitochondrial
          Length = 924

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 243 aaatattggagttatccttc 262

---

>gb|AF372088.1| Podarcis bocagei isolate Pbb6 cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 306

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 243 aaatattggagttatccttc 262

---

>gb|AF372087.1| Podarcis bocagei isolate Pbb5 cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 306

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 243 aaatattggagttatccttc 262

---

>gb|AF386541.1| Etheostoma exile isolate EexeA cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 1140

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 339 aaatattggagttatccttc 358

---

>gb|AF261224.1| Pteronotropis hubbsi specimen-voucher UAIC 7988.01 cytochrome b
           (cytb) gene, partial cds; mitochondrial gene for
           mitochondrial product
          Length = 1131

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 329 aaatattggagttatccttc 348

---

>gb|AF370658.1|AF370658 Geophagus sp. Farias 100 cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 1138

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 339 aaatattggagttatccttc 358

---

>gb|AF499600.1| Hemibagrus nemurus cytochrome b (cytb) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 1138

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 336 aaatattggagttatccttc 355

---

>gb|AF212975.1|AF212975 Bolitoglossa mexicana isolate MEX_4C cytochrome b gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 647

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 322 aaatattggagttatccttc 341

---

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 65      ccgacgaagggggaggacgg 84
               ||||||||||||||||||||
Sbjct: 1072427 ccgacgaagggggaggacgg 1072408

---

>dbj|AB120177.1| Cobitis hankugensis mitochondrial DNA, partial sequence,
           isolate:101
          Length = 3329

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 455 aaatattggagttatccttc 474

---

>gb|AF212099.1|AF212099 Bolitoglossa mexicana specimen-voucher MVZ 191635 cytochrome b (cyt
           b) gene, partial cds; mitochondrial gene for
           mitochondrial product
          Length = 647

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 322 aaatattggagttatccttc 341

---

>dbj|AB043880.1| Callosciurus prevostii mitochondrial cytb gene for cytochrome b,
           partial cds
          Length = 1080

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 312 aaatattggagttatccttc 331

---

>dbj|AB043879.1| Callosciurus prevostii mitochondrial cytb gene for cytochrome b,
           partial cds
          Length = 1080

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 312 aaatattggagttatccttc 331

---

>gb|DQ081139.1| Podarcis bocagei isolate BTA1 cytochrome b gene, partial cds;
           mitochondrial
          Length = 306

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 243 aaatattggagttatccttc 262

---

>gb|AC002981.1|AC002981 Homo sapiens Xp22 BAC GS279A12 (Genome Systems) complete sequence
          Length = 153568

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 410    caacttcccctaaaagatat 429
              ||||||||||||||||||||
Sbjct: 141094 caacttcccctaaaagatat 141113

---

>emb|BX649397.8| Zebrafish DNA sequence from clone CH211-14J20 in linkage group 3,
             complete sequence
          Length = 171286

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 407   agacaacttcccctaaaaga 426
             ||||||||||||||||||||
Sbjct: 73226 agacaacttcccctaaaaga 73207

---

>gb|U46183.1|SSU46183 Sciurus stramineus cytochrome b gene, mitochondrial gene encoding
           mitochondrial protein, partial cds
          Length = 528

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 339 aaatattggagttatccttc 358

---

>emb|AJ297676.1|GSP297676 Geophagus sp. 1-JSR-2000 mitochondrial partial cytb gene for
           cytochrome b, isolate 1
          Length = 346

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 255 aaatattggagttatccttc 274

---

>gb|DQ119372.1| Hemibagrus wyckioides cytochrome b and tRNA-Thr genes, partial
           sequence; mitochondrial
          Length = 1160

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 441 aaatattggagttatccttc 460
           ||||||||||||||||||||
Sbjct: 336 aaatattggagttatccttc 355


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,231,534
Number of Sequences: 3902068
Number of extensions: 2231534
Number of successful extensions: 39617
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39498
Number of HSP's gapped (non-prelim): 119
length of query: 478
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 456
effective length of database: 17,147,199,772
effective search space: 7819123096032
effective search space used: 7819123096032
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---