ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart49e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC154317.2| Mus musculus BAC clone RP23-346H4 from chromosome... 42 0.30
2gb|AF117829.3| Homo sapiens chromosome 8 multiple clones map q21... 38 4.7
3dbj|AP006436.1| Sus scrofa CC chemokine receptor genes(CCR3, CCR... 38 4.7
4gb|AC074178.1|AC074178 Homo sapiens PAC clone RP5-1098O20 from 8... 38 4.7
5gb|AC007591.2|F9L1 Arabidopsis thaliana chromosome 1 BAC F9L1 se... 38 4.7
6emb|AL158801.4|CNS01RGN Human chromosome 14 DNA sequence BAC R-6... 38 4.7
7emb|AL139316.5|CNS01DXH Human chromosome 14 DNA sequence BAC R-6... 38 4.7
8gb|AF069291.1|AF069291 Homo sapiens BAC clone 255A7 from 8q21 co... 38 4.7
9emb|AL808131.9| Mouse DNA sequence from clone RP23-367H7 on chro... 38 4.7

>gb|AC154317.2| Mus musculus BAC clone RP23-346H4 from chromosome 13, complete sequence
          Length = 205164

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 57    cttatgaccaacaattcaagg 77
             |||||||||||||||||||||
Sbjct: 98174 cttatgaccaacaattcaagg 98154



to top

>gb|AF117829.3| Homo sapiens chromosome 8 multiple clones map q21.3, complete sequence
          Length = 320187

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 11     tggaagctcaatataccaa 29
              |||||||||||||||||||
Sbjct: 285874 tggaagctcaatataccaa 285892



to top

>dbj|AP006436.1| Sus scrofa CC chemokine receptor genes(CCR3, CCR1, CCXCR1, FYCO1),
             complete and partial cds, clone: 0659A02
          Length = 167298

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 39    agcaagcaaccatggcttc 57
             |||||||||||||||||||
Sbjct: 37312 agcaagcaaccatggcttc 37330



to top

>gb|AC074178.1|AC074178 Homo sapiens PAC clone RP5-1098O20 from 8, complete sequence
          Length = 107549

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    tggaagctcaatataccaa 29
             |||||||||||||||||||
Sbjct: 29850 tggaagctcaatataccaa 29868



to top

>gb|AC007591.2|F9L1 Arabidopsis thaliana chromosome 1 BAC F9L1 sequence, complete sequence
          Length = 141984

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 32     ctctaacagcaagcaaccatggc 54
              ||||| |||||||||||||||||
Sbjct: 104274 ctctaccagcaagcaaccatggc 104252



to top

>emb|AL158801.4|CNS01RGN Human chromosome 14 DNA sequence BAC R-665C16 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 205860

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 40     gcaagcaaccatggcttcttatg 62
              |||||||| ||||||||||||||
Sbjct: 173476 gcaagcaaacatggcttcttatg 173454



to top

>emb|AL139316.5|CNS01DXH Human chromosome 14 DNA sequence BAC R-698F20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 192440

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 40    gcaagcaaccatggcttcttatg 62
             |||||||| ||||||||||||||
Sbjct: 19876 gcaagcaaacatggcttcttatg 19854



to top

>gb|AF069291.1|AF069291 Homo sapiens BAC clone 255A7 from 8q21 containing NBS1 gene, complete
             sequence
          Length = 184919

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    tggaagctcaatataccaa 29
             |||||||||||||||||||
Sbjct: 55607 tggaagctcaatataccaa 55625



to top

>emb|AL808131.9| Mouse DNA sequence from clone RP23-367H7 on chromosome X, complete
              sequence
          Length = 210322

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 40     gcaagcaaccatggcttct 58
              |||||||||||||||||||
Sbjct: 111651 gcaagcaaccatggcttct 111669


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 573,043
Number of Sequences: 3902068
Number of extensions: 573043
Number of successful extensions: 35588
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35576
Number of HSP's gapped (non-prelim): 12
length of query: 105
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 84
effective length of database: 17,151,101,840
effective search space: 1440692554560
effective search space used: 1440692554560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top