ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart49e01 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB021176.1| Zea mays ZmRCP2 mRNA for root cap protein 2, complete cds Length = 1318 Score = 256 bits (129), Expect = 7e-65 Identities = 261/305 (85%) Strand = Plus / Plus Query: 263 atggactgccccgccaactgcccccagtcctgctacccagactgcaacacatgcaaaccc 322 ||||| ||||||||| | || ||||||| |||||| | ||||||| | | ||||||||| Sbjct: 274 atggagtgccccgccgagtgttcccagtcatgctacgccgactgcagctcctgcaaaccc 333 Query: 323 gtctgcgtgtgcaacaccccaggggcgtgcggcgacccgcggttcattggtggtgatggc 382 ||||||||||||| | || |||||||||||||||||||| ||||| || || || ||| Sbjct: 334 gtctgcgtgtgcagcgtgccgggggcgtgcggcgacccgcgcttcatcggcggcgacggc 393 Query: 383 aacgccttctatttccacggacgcagggatgccgacttctgtgtcgtctccgaccgtgac 442 ||||||||||| |||||||| ||| |||| ||||||||||| || |||||||||| ||| Sbjct: 394 aacgccttctacttccacggccgccgggacgccgacttctgcgtgctctccgaccgcgac 453 Query: 443 cttcacatcaacgcgcatttcatcggcaagagcggccacagcggcatgtcccgggacttc 502 || |||||||||||||| |||||||||||| |||| | ||||||||||||||||||| Sbjct: 454 ctccacatcaacgcgcacttcatcggcaagcacggcgccgacggcatgtcccgggacttc 513 Query: 503 acctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggcgccagg 562 || |||||||||||||||||||| |||||||| |||||| |||||| ||||||||||| Sbjct: 514 acgtggatccaggccatcgccgtgctcttcgacggccacgagctctacgtcggcgccagg 573 Query: 563 aagac 567 ||||| Sbjct: 574 aagac 578
>gb|AF134579.1|AF134579 Zea mays clone AGPZm1 arabinogalactan protein (agp) mRNA, partial cds Length = 825 Score = 222 bits (112), Expect = 1e-54 Identities = 196/224 (87%) Strand = Plus / Plus Query: 344 ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403 |||||||||||||||||||| ||||| || || || |||||||||||||| |||||||| Sbjct: 5 ggggcgtgcggcgacccgcgcttcatcggcggcgacggcaacgccttctacttccacggc 64 Query: 404 cgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463 ||| |||| ||||||||||| || |||||||||| ||||| |||||||||||||| ||| Sbjct: 65 cgccgggacgccgacttctgcgtgctctccgaccgcgacctccacatcaacgcgcacttc 124 Query: 464 atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523 ||||||||| |||| | ||||||||||||||||||||| |||||||||||||||||| Sbjct: 125 atcggcaagcacggcgccgacggcatgtcccgggacttcacgtggatccaggccatcgcc 184 Query: 524 gtcctcttcgatggccaccgcctctacctcggcgccaggaagac 567 || |||||||| |||||| |||||| |||||||||||||||| Sbjct: 185 gtgctcttcgacggccacgagctctacgtcggcgccaggaagac 228
>gb|AC120307.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0074E19 map R1938, complete sequence Length = 160847 Score = 204 bits (103), Expect = 2e-49 Identities = 169/191 (88%) Strand = Plus / Plus Query: 344 ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403 |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || Sbjct: 138467 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 138526 Query: 404 cgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463 || ||||| ||||||||||| |||||||||||||| ||||| |||||||||||||| ||| Sbjct: 138527 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 138586 Query: 464 atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523 ||||||||| ||||| | ||||||||| || ||||||||||||||||||||||| ||| Sbjct: 138587 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 138646 Query: 524 gtcctcttcga 534 ||||||||||| Sbjct: 138647 gtcctcttcga 138657 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 538 ccaccgcctctacctcggcgccaggaagaccg 569 ||||||||||||| |||||||||||||||||| Sbjct: 138670 ccaccgcctctacgtcggcgccaggaagaccg 138701
>gb|AC116949.11| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0040B10 map R2918, complete sequence Length = 149132 Score = 204 bits (103), Expect = 2e-49 Identities = 169/191 (88%) Strand = Plus / Plus Query: 344 ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403 |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || Sbjct: 14610 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 14669 Query: 404 cgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463 || ||||| ||||||||||| |||||||||||||| ||||| |||||||||||||| ||| Sbjct: 14670 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 14729 Query: 464 atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523 ||||||||| ||||| | ||||||||| || ||||||||||||||||||||||| ||| Sbjct: 14730 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 14789 Query: 524 gtcctcttcga 534 ||||||||||| Sbjct: 14790 gtcctcttcga 14800 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 538 ccaccgcctctacctcggcgccaggaagaccg 569 ||||||||||||| |||||||||||||||||| Sbjct: 14813 ccaccgcctctacgtcggcgccaggaagaccg 14844
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 204 bits (103), Expect = 2e-49 Identities = 169/191 (88%) Strand = Plus / Plus Query: 344 ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403 |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || Sbjct: 2362468 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 2362527 Query: 404 cgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463 || ||||| ||||||||||| |||||||||||||| ||||| |||||||||||||| ||| Sbjct: 2362528 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 2362587 Query: 464 atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523 ||||||||| ||||| | ||||||||| || ||||||||||||||||||||||| ||| Sbjct: 2362588 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 2362647 Query: 524 gtcctcttcga 534 ||||||||||| Sbjct: 2362648 gtcctcttcga 2362658 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 538 ccaccgcctctacctcggcgccaggaagaccg 569 ||||||||||||| |||||||||||||||||| Sbjct: 2362671 ccaccgcctctacgtcggcgccaggaagaccg 2362702
>dbj|AK106826.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-116-E12, full insert sequence Length = 1747 Score = 204 bits (103), Expect = 2e-49 Identities = 169/191 (88%) Strand = Plus / Minus Query: 344 ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403 |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || Sbjct: 1593 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 1534 Query: 404 cgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463 || ||||| ||||||||||| |||||||||||||| ||||| |||||||||||||| ||| Sbjct: 1533 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 1474 Query: 464 atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523 ||||||||| ||||| | ||||||||| || ||||||||||||||||||||||| ||| Sbjct: 1473 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 1414 Query: 524 gtcctcttcga 534 ||||||||||| Sbjct: 1413 gtcctcttcga 1403 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 538 ccaccgcctctacctcggcgccaggaagaccg 569 ||||||||||||| |||||||||||||||||| Sbjct: 1390 ccaccgcctctacgtcggcgccaggaagaccg 1359
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 204 bits (103), Expect = 2e-49 Identities = 169/191 (88%) Strand = Plus / Plus Query: 344 ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403 |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || Sbjct: 2370249 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 2370308 Query: 404 cgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463 || ||||| ||||||||||| |||||||||||||| ||||| |||||||||||||| ||| Sbjct: 2370309 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 2370368 Query: 464 atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523 ||||||||| ||||| | ||||||||| || ||||||||||||||||||||||| ||| Sbjct: 2370369 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 2370428 Query: 524 gtcctcttcga 534 ||||||||||| Sbjct: 2370429 gtcctcttcga 2370439 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 538 ccaccgcctctacctcggcgccaggaagaccg 569 ||||||||||||| |||||||||||||||||| Sbjct: 2370452 ccaccgcctctacgtcggcgccaggaagaccg 2370483
>gb|AY111354.1| Zea mays CL1277_1 mRNA sequence Length = 1328 Score = 196 bits (99), Expect = 6e-47 Identities = 224/269 (83%) Strand = Plus / Plus Query: 263 atggactgccccgccaactgcccccagtcctgctacccagactgcaacacatgcaaaccc 322 ||||| ||||||||| | || ||||||| |||||| | ||||||| | | ||||||||| Sbjct: 274 atggagtgccccgccgagtgttcccagtcatgctacgccgactgcagctcctgcaaaccc 333 Query: 323 gtctgcgtgtgcaacaccccaggggcgtgcggcgacccgcggttcattggtggtgatggc 382 |||||||||||| || |||||||||||||||| ||||| || || || ||| Sbjct: 334 gtctgcgtgtgcnnnnngccnnnnncgtgcggcgacccgcgcttcatcggcggcgacggc 393 Query: 383 aacgccttctatttccacggacgcagggatgccgacttctgtgtcgtctccgaccgtgac 442 ||||||||||| |||||||| ||| |||| ||||||||||| || |||||||||| ||| Sbjct: 394 aacgccttctacttccacggccgccgggacgccgacttctgcgtgctctccgaccgcgac 453 Query: 443 cttcacatcaacgcgcatttcatcggcaagagcggccacagcggcatgtcccgggacttc 502 || |||||||||||||| |||||||||||| |||| | ||||||||||||||||||| Sbjct: 454 ctccacatcaacgcgcacttcatcggcaagcacggcgccgacggcatgtcccgggacttc 513 Query: 503 acctggatccaggccatcgccgtcctctt 531 || |||||||||||||||||||| ||||| Sbjct: 514 acgtggatccaggccatcgccgtgctctt 542
>ref|XM_472395.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1068 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 494 cgggacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctc 553 ||||||||||||||| | |||||| ||| | ||| ||||| |||||||||||||||||| Sbjct: 448 cgggacttcacctgggtgcaggccctcggcatccgcttcggcggccaccgcctctacctc 507 Query: 554 ggcgccaggaagaccg 569 |||| ||||| ||||| Sbjct: 508 ggcgtcaggaggaccg 523 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Plus Query: 395 ttccacggacgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaac 454 |||||||| |||| ||| ||||||||||| | |||||||| |||| ||||||||| Sbjct: 352 ttccacgggcgcaaggacgccgacttctgcctgctctccgacgccaacctgcacatcaac 411 Query: 455 gcgcatttcatcggcaag 472 ||||| |||||||||||| Sbjct: 412 gcgcacttcatcggcaag 429
>emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L04, complete sequence Length = 143301 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 494 cgggacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctc 553 ||||||||||||||| | |||||| ||| | ||| ||||| |||||||||||||||||| Sbjct: 20655 cgggacttcacctgggtgcaggccctcggcatccgcttcggcggccaccgcctctacctc 20714 Query: 554 ggcgccaggaagaccg 569 |||| ||||| ||||| Sbjct: 20715 ggcgtcaggaggaccg 20730 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Plus Query: 395 ttccacggacgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaac 454 |||||||| |||| ||| ||||||||||| | |||||||| |||| ||||||||| Sbjct: 20559 ttccacgggcgcaaggacgccgacttctgcctgctctccgacgccaacctgcacatcaac 20618 Query: 455 gcgcatttcatcggcaag 472 ||||| |||||||||||| Sbjct: 20619 gcgcacttcatcggcaag 20636
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 494 cgggacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctc 553 ||||||||||||||| | |||||| ||| | ||| ||||| |||||||||||||||||| Sbjct: 20290022 cgggacttcacctgggtgcaggccctcggcatccgcttcggcggccaccgcctctacctc 20290081 Query: 554 ggcgccaggaagaccg 569 |||| ||||| ||||| Sbjct: 20290082 ggcgtcaggaggaccg 20290097 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Plus Query: 395 ttccacggacgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaac 454 |||||||| |||| ||| ||||||||||| | |||||||| |||| ||||||||| Sbjct: 20289926 ttccacgggcgcaaggacgccgacttctgcctgctctccgacgccaacctgcacatcaac 20289985 Query: 455 gcgcatttcatcggcaag 472 ||||| |||||||||||| Sbjct: 20289986 gcgcacttcatcggcaag 20290003 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 19805450 ccgaagccgaagccgaagccg 19805430
>dbj|AK108077.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E01, full insert sequence Length = 1481 Score = 71.9 bits (36), Expect = 2e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 494 cgggacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctc 553 ||||||||||||||| | |||||| ||| | ||| ||||| |||||||||||||||||| Sbjct: 533 cgggacttcacctgggtgcaggccctcggcatccgcttcggcggccaccgcctctacctc 592 Query: 554 ggcgccaggaagaccg 569 |||| ||||| ||||| Sbjct: 593 ggcgtcaggaggaccg 608 Score = 52.0 bits (26), Expect = 0.002 Identities = 65/78 (83%) Strand = Plus / Plus Query: 395 ttccacggacgcagggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaac 454 |||||||| |||| ||| ||||||||||| | |||||||| |||| ||||||||| Sbjct: 437 ttccacgggcgcaaggacgccgacttctgcctgctctccgacgccaacctgcacatcaac 496 Query: 455 gcgcatttcatcggcaag 472 ||||| |||||||||||| Sbjct: 497 gcgcacttcatcggcaag 514
>ref|NM_189426.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 993 Score = 67.9 bits (34), Expect = 3e-08 Identities = 168/212 (79%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 348 cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407 ||||||||||||||||||||| || || || |||||| |||||| |||||||| | Sbjct: 296 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 355 Query: 408 gggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467 ||| ||||||||| ||||||||||| ||||| ||||||||||| || ||||||| Sbjct: 356 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 415 Query: 468 gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527 ||||| || || || | ||| ||| ||||||||||||||||||||| ||| | ||| Sbjct: 416 gcaagcgcaaccccacc---atgagccgcgacttcacctggatccaggccctcggcatcc 472 Query: 528 tcttcgatggccaccgcctctacctcggcgcc 559 ||||| | ||||||||||||| | |||||| Sbjct: 473 gcttcgccgaccaccgcctctacatgggcgcc 504
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 67.9 bits (34), Expect = 3e-08 Identities = 168/212 (79%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 348 cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407 ||||||||||||||||||||| || || || |||||| |||||| |||||||| | Sbjct: 42699435 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 42699494 Query: 408 gggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467 ||| ||||||||| ||||||||||| ||||| ||||||||||| || ||||||| Sbjct: 42699495 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 42699554 Query: 468 gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527 ||||| || || || | ||| ||| ||||||||||||||||||||| ||| | ||| Sbjct: 42699555 gcaagcgcaaccccacc---atgagccgcgacttcacctggatccaggccctcggcatcc 42699611 Query: 528 tcttcgatggccaccgcctctacctcggcgcc 559 ||||| | ||||||||||||| | |||||| Sbjct: 42699612 gcttcgccgaccaccgcctctacatgggcgcc 42699643 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/141 (80%), Gaps = 3/141 (2%) Strand = Plus / Minus Query: 415 cgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474 ||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| | Sbjct: 42697270 cgacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaagcg 42697211 Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534 | || || | ||| ||| ||||||||||||||||||||| ||| | ||| ||||| Sbjct: 42697210 caaccccacc---atgagccgtgacttcacctggatccaggccctcggcatccgcttcgc 42697154 Query: 535 tggccaccgcctctacctcgg 555 | ||||||||||||| |||| Sbjct: 42697153 cgaccaccgcctctacatcgg 42697133 Score = 61.9 bits (31), Expect = 2e-06 Identities = 117/145 (80%), Gaps = 3/145 (2%) Strand = Plus / Minus Query: 415 cgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474 ||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| | Sbjct: 42693169 cgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcggcaagcg 42693110 Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534 | || || | ||| ||| ||||||||||||||||||||| ||| | ||| ||||| Sbjct: 42693109 caaccccacc---atgagccgcgacttcacctggatccaggccctcggcatccgcttcgc 42693053 Query: 535 tggccaccgcctctacctcggcgcc 559 | ||||||||||||| | |||||| Sbjct: 42693052 cgaccaccgcctctacatgggcgcc 42693028 Score = 48.1 bits (24), Expect = 0.032 Identities = 48/56 (85%) Strand = Plus / Plus Query: 416 gacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaa 471 |||||||| ||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 42703655 gacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaa 42703710 Score = 44.1 bits (22), Expect = 0.49 Identities = 52/62 (83%) Strand = Plus / Plus Query: 497 gacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggc 556 |||||||||||||||||| || ||| | || ||||| | ||||||||||||| ||||| Sbjct: 42703733 gacttcacctggatccagtccctcggcatcagcttcggcgaccaccgcctctacatcggc 42703792 Query: 557 gc 558 || Sbjct: 42703793 gc 42703794 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 23307672 ccgaagccgaagccgaagccg 23307652 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 180 agggcccgaagccgaagccgaagc 203 |||| ||||||||||||||||||| Sbjct: 31271041 aggggccgaagccgaagccgaagc 31271018 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 23307705 ccgaagccgaagccgaagcc 23307686
>dbj|AP003448.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1656_A11 Length = 148887 Score = 67.9 bits (34), Expect = 3e-08 Identities = 168/212 (79%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 348 cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407 ||||||||||||||||||||| || || || |||||| |||||| |||||||| | Sbjct: 32200 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 32259 Query: 408 gggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467 ||| ||||||||| ||||||||||| ||||| ||||||||||| || ||||||| Sbjct: 32260 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 32319 Query: 468 gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527 ||||| || || || | ||| ||| ||||||||||||||||||||| ||| | ||| Sbjct: 32320 gcaagcgcaaccccacc---atgagccgcgacttcacctggatccaggccctcggcatcc 32376 Query: 528 tcttcgatggccaccgcctctacctcggcgcc 559 ||||| | ||||||||||||| | |||||| Sbjct: 32377 gcttcgccgaccaccgcctctacatgggcgcc 32408 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/141 (80%), Gaps = 3/141 (2%) Strand = Plus / Minus Query: 415 cgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474 ||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| | Sbjct: 30035 cgacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaagcg 29976 Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534 | || || | ||| ||| ||||||||||||||||||||| ||| | ||| ||||| Sbjct: 29975 caaccccacc---atgagccgtgacttcacctggatccaggccctcggcatccgcttcgc 29919 Query: 535 tggccaccgcctctacctcgg 555 | ||||||||||||| |||| Sbjct: 29918 cgaccaccgcctctacatcgg 29898 Score = 61.9 bits (31), Expect = 2e-06 Identities = 117/145 (80%), Gaps = 3/145 (2%) Strand = Plus / Minus Query: 415 cgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474 ||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| | Sbjct: 25934 cgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcggcaagcg 25875 Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534 | || || | ||| ||| ||||||||||||||||||||| ||| | ||| ||||| Sbjct: 25874 caaccccacc---atgagccgcgacttcacctggatccaggccctcggcatccgcttcgc 25818 Query: 535 tggccaccgcctctacctcggcgcc 559 | ||||||||||||| | |||||| Sbjct: 25817 cgaccaccgcctctacatgggcgcc 25793 Score = 48.1 bits (24), Expect = 0.032 Identities = 48/56 (85%) Strand = Plus / Plus Query: 416 gacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaa 471 |||||||| ||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 36420 gacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaa 36475 Score = 44.1 bits (22), Expect = 0.49 Identities = 52/62 (83%) Strand = Plus / Plus Query: 497 gacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggc 556 |||||||||||||||||| || ||| | || ||||| | ||||||||||||| ||||| Sbjct: 36498 gacttcacctggatccagtccctcggcatcagcttcggcgaccaccgcctctacatcggc 36557 Query: 557 gc 558 || Sbjct: 36558 gc 36559
>ref|NM_189425.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 951 Score = 61.9 bits (31), Expect = 2e-06 Identities = 114/141 (80%), Gaps = 3/141 (2%) Strand = Plus / Plus Query: 415 cgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474 ||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| | Sbjct: 321 cgacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaagcg 380 Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534 | || || | ||| ||| ||||||||||||||||||||| ||| | ||| ||||| Sbjct: 381 caaccccacc---atgagccgtgacttcacctggatccaggccctcggcatccgcttcgc 437 Query: 535 tggccaccgcctctacctcgg 555 | ||||||||||||| |||| Sbjct: 438 cgaccaccgcctctacatcgg 458
>ref|NM_189423.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 975 Score = 61.9 bits (31), Expect = 2e-06 Identities = 117/145 (80%), Gaps = 3/145 (2%) Strand = Plus / Plus Query: 415 cgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474 ||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| | Sbjct: 345 cgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcggcaagcg 404 Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534 | || || | ||| ||| ||||||||||||||||||||| ||| | ||| ||||| Sbjct: 405 caaccccacc---atgagccgcgacttcacctggatccaggccctcggcatccgcttcgc 461 Query: 535 tggccaccgcctctacctcggcgcc 559 | ||||||||||||| | |||||| Sbjct: 462 cgaccaccgcctctacatgggcgcc 486
>gb|AC129716.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0068N01, complete sequence Length = 152233 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 487 catgtcccgggacttcacctggatccaggccatcgccgtcctcttcg 533 ||||||||| |||||||||||||||||||| ||| ||||||||||| Sbjct: 40171 catgtcccgcgacttcacctggatccaggcgctcggcgtcctcttcg 40217
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 487 catgtcccgggacttcacctggatccaggccatcgccgtcctcttcg 533 ||||||||| |||||||||||||||||||| ||| ||||||||||| Sbjct: 378524 catgtcccgcgacttcacctggatccaggcgctcggcgtcctcttcg 378570
>dbj|AK122054.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033114J03, full insert sequence Length = 1352 Score = 58.0 bits (29), Expect = 3e-05 Identities = 157/199 (78%), Gaps = 3/199 (1%) Strand = Plus / Plus Query: 348 cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407 ||||||||||||||||||||| || || || |||||| |||||| |||||||| | Sbjct: 450 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 509 Query: 408 gggatgccgacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467 ||| ||||||||| ||||||||||| ||||| ||||||||||| || ||||||| Sbjct: 510 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 569 Query: 468 gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527 ||||| || || || | ||| ||| ||||||||||||||||||||| ||| | ||| Sbjct: 570 gcaagcgcaaccccacc---atgagccgcgacttcacctggatccaggccctcggcatcc 626 Query: 528 tcttcgatggccaccgcct 546 ||||| | ||||||||| Sbjct: 627 gcttcgccgaccaccgcct 645
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 181 gggcccgaagccgaagccgaagccgg 206 |||||||||||||||||||||||||| Sbjct: 379629 gggcccgaagccgaagccgaagccgg 379654 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 184 cccgaagccgaagccgaagccgg 206 ||||||||||||||||||||||| Sbjct: 3856001 cccgaagccgaagccgaagccgg 3855979
>dbj|AB021175.1| Zea mays ZmRCP1 mRNA for root cap protein 1, complete cds Length = 1225 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Plus Query: 416 gacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaag 472 |||||||| ||||||||||| | ||| |||||||||||||| |||||||||||| Sbjct: 394 gacttctgcatcgtctccgacgccgccctccacatcaacgcgcacttcatcggcaag 450
>ref|NM_112830.2| Arabidopsis thaliana structural constituent of cell wall AT3G19430 mRNA, complete cds Length = 1878 Score = 48.1 bits (24), Expect = 0.032 Identities = 27/28 (96%) Strand = Plus / Plus Query: 441 accttcacatcaacgcgcatttcatcgg 468 |||||||||||||||| ||||||||||| Sbjct: 1010 accttcacatcaacgctcatttcatcgg 1037
>ref|NM_189428.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1026 Score = 48.1 bits (24), Expect = 0.032 Identities = 48/56 (85%) Strand = Plus / Plus Query: 416 gacttctgtgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaa 471 |||||||| ||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 391 gacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaa 446 Score = 44.1 bits (22), Expect = 0.49 Identities = 52/62 (83%) Strand = Plus / Plus Query: 497 gacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggc 556 |||||||||||||||||| || ||| | || ||||| | ||||||||||||| ||||| Sbjct: 469 gacttcacctggatccagtccctcggcatcagcttcggcgaccaccgcctctacatcggc 528 Query: 557 gc 558 || Sbjct: 529 gc 530
>dbj|AB025624.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14 Length = 83097 Score = 48.1 bits (24), Expect = 0.032 Identities = 27/28 (96%) Strand = Plus / Minus Query: 441 accttcacatcaacgcgcatttcatcgg 468 |||||||||||||||| ||||||||||| Sbjct: 50454 accttcacatcaacgctcatttcatcgg 50427
>gb|L47117.1|PIAEMB7R Picea glauca late embryogenesis abundant protein (EMB7) mRNA, complete cds Length = 1245 Score = 48.1 bits (24), Expect = 0.032 Identities = 36/40 (90%) Strand = Plus / Plus Query: 441 accttcacatcaacgcgcatttcatcggcaagagcggcca 480 |||| ||||||||||| |||||||| |||||||| ||||| Sbjct: 350 acctccacatcaacgctcatttcattggcaagagaggcca 389
>ref|XM_471700.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1206 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccggc 207 ||||||||||||||||||||||| Sbjct: 116 ccgaagccgaagccgaagccggc 94
>emb|AJ009934.1|SMAJ9934 Sordaria macrospora SPO76 gene Length = 6411 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 183 gcccgaagccgaagccgaagccg 205 ||||||||||||||||||||||| Sbjct: 5195 gcccgaagccgaagccgaagccg 5217
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccgg 206 |||||||||||||||||||||| Sbjct: 127765 ccgaagccgaagccgaagccgg 127744
>emb|AL939107.1|SCO939107 Streptomyces coelicolor A3(2) complete genome; segment 4/29 Length = 298450 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccggcgacggtc 214 ||||||||||||||||||||| ||||||| Sbjct: 113692 ccgaagccgaagccgaagccgaagacggtc 113663
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 184 cccgaagccgaagccgaagccg 205 |||||||||||||||||||||| Sbjct: 2462764 cccgaagccgaagccgaagccg 2462785
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccgg 206 |||||||||||||||||||||| Sbjct: 6957200 ccgaagccgaagccgaagccgg 6957179 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 20612035 ccgaagccgaagccgaagccg 20612055
>dbj|AP004785.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0061B07 Length = 124766 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccgg 206 |||||||||||||||||||||| Sbjct: 16627 ccgaagccgaagccgaagccgg 16606
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome Length = 2702173 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 cccgaagccgaagccgaagccg 205 |||||||||||||||||||||| Sbjct: 131533 cccgaagccgaagccgaagccg 131512 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131526 ccgaagccgaagccgaagccg 131506 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131520 ccgaagccgaagccgaagccg 131500 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131514 ccgaagccgaagccgaagccg 131494 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131508 ccgaagccgaagccgaagccg 131488 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131502 ccgaagccgaagccgaagccg 131482 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131496 ccgaagccgaagccgaagccg 131476 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131490 ccgaagccgaagccgaagccg 131470 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131484 ccgaagccgaagccgaagccg 131464 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131478 ccgaagccgaagccgaagccg 131458 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131472 ccgaagccgaagccgaagccg 131452 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131466 ccgaagccgaagccgaagccg 131446 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 131460 ccgaagccgaagccgaagccg 131440
>gb|DQ180309.1| Fragaria x ananassa clone PBCESTFXA4 SSR marker Length = 850 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 184 cccgaagccgaagccgaagccg 205 |||||||||||||||||||||| Sbjct: 268 cccgaagccgaagccgaagccg 289
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 cccgaagccgaagccgaagccg 205 |||||||||||||||||||||| Sbjct: 2107795 cccgaagccgaagccgaagccg 2107774
>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome Length = 5498450 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccgg 206 |||||||||||||||||||||| Sbjct: 5061707 ccgaagccgaagccgaagccgg 5061728 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 5061701 ccgaagccgaagccgaagccg 5061721 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 5061695 ccgaagccgaagccgaagccg 5061715 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 5061689 ccgaagccgaagccgaagccg 5061709 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 5061683 ccgaagccgaagccgaagccg 5061703 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 5061677 ccgaagccgaagccgaagccg 5061697
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068848 ccgaagccgaagccgaagccg 4068828 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068842 ccgaagccgaagccgaagccg 4068822 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068836 ccgaagccgaagccgaagccg 4068816 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068830 ccgaagccgaagccgaagccg 4068810 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068824 ccgaagccgaagccgaagccg 4068804 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068818 ccgaagccgaagccgaagccg 4068798 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068812 ccgaagccgaagccgaagccg 4068792 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068806 ccgaagccgaagccgaagccg 4068786 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068800 ccgaagccgaagccgaagccg 4068780 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068794 ccgaagccgaagccgaagccg 4068774 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068788 ccgaagccgaagccgaagccg 4068768 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068782 ccgaagccgaagccgaagccg 4068762 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068776 ccgaagccgaagccgaagccg 4068756 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068770 ccgaagccgaagccgaagccg 4068750 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068764 ccgaagccgaagccgaagccg 4068744 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068758 ccgaagccgaagccgaagccg 4068738 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068752 ccgaagccgaagccgaagccg 4068732 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068746 ccgaagccgaagccgaagccg 4068726 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068740 ccgaagccgaagccgaagccg 4068720 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068734 ccgaagccgaagccgaagccg 4068714 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068728 ccgaagccgaagccgaagccg 4068708 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4068722 ccgaagccgaagccgaagccg 4068702
>ref|XM_512923.1| PREDICTED: Pan troglodytes similar to zinc finger protein 495 (LOC456317), mRNA Length = 9886 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 8053 ccgaagccgaagccgaagccg 8033 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 8047 ccgaagccgaagccgaagccg 8027 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 8041 ccgaagccgaagccgaagcc 8022
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 362855 ccgaagccgaagccgaagccg 362875 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 362849 ccgaagccgaagccgaagccg 362869 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 362843 ccgaagccgaagccgaagccg 362863 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 362837 ccgaagccgaagccgaagccg 362857 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 362831 ccgaagccgaagccgaagccg 362851 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 362825 ccgaagccgaagccgaagccg 362845 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 1271924 ccgaagccgaagccgaagcc 1271943 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 362820 cgaagccgaagccgaagccg 362839
>ref|NM_192611.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 613 ccgaagccgaagccgaagccg 633 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 580 ccgaagccgaagccgaagcc 599
>ref|XM_472356.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 750 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 490 ccgaagccgaagccgaagccg 510
>gb|AF465798.1| Dichroplus elongatus minisatellite A4 sequence Length = 358 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 271 ccgaagccgaagccgaagccg 251
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2228981 ccgaagccgaagccgaagccg 2228961 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2228975 ccgaagccgaagccgaagccg 2228955 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2228969 ccgaagccgaagccgaagccg 2228949 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2228963 ccgaagccgaagccgaagccg 2228943 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2228957 ccgaagccgaagccgaagccg 2228937 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2228951 ccgaagccgaagccgaagccg 2228931 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2228945 ccgaagccgaagccgaagccg 2228925 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 2228939 ccgaagccgaagccgaagcc 2228920
>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence Length = 3510148 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646706 ccgaagccgaagccgaagccg 2646686 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646700 ccgaagccgaagccgaagccg 2646680 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646694 ccgaagccgaagccgaagccg 2646674 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646688 ccgaagccgaagccgaagccg 2646668 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646682 ccgaagccgaagccgaagccg 2646662 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646676 ccgaagccgaagccgaagccg 2646656 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646670 ccgaagccgaagccgaagccg 2646650 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646664 ccgaagccgaagccgaagccg 2646644 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646658 ccgaagccgaagccgaagccg 2646638 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646652 ccgaagccgaagccgaagccg 2646632 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646646 ccgaagccgaagccgaagccg 2646626 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646640 ccgaagccgaagccgaagccg 2646620 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646634 ccgaagccgaagccgaagccg 2646614 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646628 ccgaagccgaagccgaagccg 2646608 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646622 ccgaagccgaagccgaagccg 2646602 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646616 ccgaagccgaagccgaagccg 2646596 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646610 ccgaagccgaagccgaagccg 2646590 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2646604 ccgaagccgaagccgaagccg 2646584 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2474335 ccgaagccgaagccgaagccg 2474355 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2474329 ccgaagccgaagccgaagccg 2474349 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2474323 ccgaagccgaagccgaagccg 2474343 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2474317 ccgaagccgaagccgaagccg 2474337 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1643129 ccgaagccgaagccgaagccg 1643109 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1643123 ccgaagccgaagccgaagccg 1643103 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1643117 ccgaagccgaagccgaagccg 1643097 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 319290 ccgaagccgaagccgaagccg 319310 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 319284 ccgaagccgaagccgaagccg 319304
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 131 gccgcgggggccaccaccgcg 151 ||||||||||||||||||||| Sbjct: 2748779 gccgcgggggccaccaccgcg 2748799
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2266011 ccgaagccgaagccgaagccg 2266031 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2266005 ccgaagccgaagccgaagccg 2266025 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2265999 ccgaagccgaagccgaagccg 2266019 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2265993 ccgaagccgaagccgaagccg 2266013 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2265987 ccgaagccgaagccgaagccg 2266007 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2265981 ccgaagccgaagccgaagccg 2266001 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2265975 ccgaagccgaagccgaagccg 2265995 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2038161 ccgaagccgaagccgaagccg 2038181 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2038155 ccgaagccgaagccgaagccg 2038175 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2038149 ccgaagccgaagccgaagccg 2038169 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2038143 ccgaagccgaagccgaagccg 2038163
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854397 ccgaagccgaagccgaagccg 3854377 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854391 ccgaagccgaagccgaagccg 3854371 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854385 ccgaagccgaagccgaagccg 3854365 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854379 ccgaagccgaagccgaagccg 3854359 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854373 ccgaagccgaagccgaagccg 3854353 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854367 ccgaagccgaagccgaagccg 3854347 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854361 ccgaagccgaagccgaagccg 3854341 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854355 ccgaagccgaagccgaagccg 3854335 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854349 ccgaagccgaagccgaagccg 3854329 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854343 ccgaagccgaagccgaagccg 3854323 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854337 ccgaagccgaagccgaagccg 3854317 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854331 ccgaagccgaagccgaagccg 3854311 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854325 ccgaagccgaagccgaagccg 3854305 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3854319 ccgaagccgaagccgaagccg 3854299 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 181 gggcccgaagccgaagccgaagccg 205 |||| |||||||||||||||||||| Sbjct: 3764163 gggcgcgaagccgaagccgaagccg 3764139 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3764153 ccgaagccgaagccgaagccg 3764133 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3764147 ccgaagccgaagccgaagccg 3764127 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3711596 ccgaagccgaagccgaagccg 3711576 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3711590 ccgaagccgaagccgaagccg 3711570 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3711584 ccgaagccgaagccgaagccg 3711564 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3711578 ccgaagccgaagccgaagccg 3711558 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3711572 ccgaagccgaagccgaagccg 3711552 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889993 ccgaagccgaagccgaagccg 2889973 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889987 ccgaagccgaagccgaagccg 2889967 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889981 ccgaagccgaagccgaagccg 2889961 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889975 ccgaagccgaagccgaagccg 2889955 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889969 ccgaagccgaagccgaagccg 2889949 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889963 ccgaagccgaagccgaagccg 2889943 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889957 ccgaagccgaagccgaagccg 2889937 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889951 ccgaagccgaagccgaagccg 2889931 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889945 ccgaagccgaagccgaagccg 2889925 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889939 ccgaagccgaagccgaagccg 2889919 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889933 ccgaagccgaagccgaagccg 2889913 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889927 ccgaagccgaagccgaagccg 2889907 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889921 ccgaagccgaagccgaagccg 2889901 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889915 ccgaagccgaagccgaagccg 2889895 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889909 ccgaagccgaagccgaagccg 2889889 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889903 ccgaagccgaagccgaagccg 2889883 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2889897 ccgaagccgaagccgaagccg 2889877 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1659510 ccgaagccgaagccgaagccg 1659530 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050295 ccgaagccgaagccgaagccg 1050315 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050289 ccgaagccgaagccgaagccg 1050309 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050283 ccgaagccgaagccgaagccg 1050303 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050277 ccgaagccgaagccgaagccg 1050297 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050271 ccgaagccgaagccgaagccg 1050291 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050265 ccgaagccgaagccgaagccg 1050285 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050259 ccgaagccgaagccgaagccg 1050279 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050253 ccgaagccgaagccgaagccg 1050273 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050247 ccgaagccgaagccgaagccg 1050267 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050241 ccgaagccgaagccgaagccg 1050261 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050235 ccgaagccgaagccgaagccg 1050255 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050229 ccgaagccgaagccgaagccg 1050249 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050223 ccgaagccgaagccgaagccg 1050243 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1050217 ccgaagccgaagccgaagccg 1050237 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 342297 ccgaagccgaagccgaagccg 342317 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 1659505 cgaagccgaagccgaagccg 1659524
>ref|XM_716953.1| Candida albicans SC5314 hypothetical protein (CaO19_11459), mRNA Length = 1122 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 334 ccgaagccgaagccgaagccg 314
>ref|XM_716792.1| Candida albicans SC5314 hypothetical protein (CaO19_3976), mRNA Length = 1122 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 334 ccgaagccgaagccgaagccg 314
>gb|AC174382.2| Mus musculus BAC clone RP24-94K20 from chromosome y, complete sequence Length = 207355 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 158866 ttagcaacaaaagaaaacacc 158846
>gb|AC147252.4| Mus musculus BAC clone RP24-116A5 from chromosome Y, complete sequence Length = 197602 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 8365 ttagcaacaaaagaaaacacc 8385
>gb|AC133178.3| Mus musculus BAC clone RP24-123P23 from chromosome Y, complete sequence Length = 158872 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 30844 ttagcaacaaaagaaaacacc 30864
>gb|AC134567.4| Mus musculus BAC clone RP24-199C24 from chromosome Y, complete sequence Length = 163892 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 154359 ttagcaacaaaagaaaacacc 154339
>gb|AC136975.2| Mus musculus BAC clone RP24-403M20 from chromosome Y, complete sequence Length = 189490 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 90655 ttagcaacaaaagaaaacacc 90675
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome Length = 3928089 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1720610 ccgaagccgaagccgaagccg 1720630
>gb|AC107806.10| Mus musculus chromosome 3, clone RP23-55C1, complete sequence Length = 214411 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 33892 ttagcaacaaaagaaaacacc 33912
>gb|AC157320.2| Zea mays clone ZMMBBb-7C14, complete sequence Length = 132140 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccggcga 209 |||||||||||||||||||| |||| Sbjct: 72923 ccgaagccgaagccgaagcctgcga 72899
>gb|AF173167.3| Pseudomonas alcaligenes putative transposase, putative transposase, gentisate 1,2-dioxygenase (xlnE), xlnF, hypothetical protein (xlnG), hypothetical protein (xlnH), xlnI, probable 3-hydroxybenzoate 6-hydroxylase (xlnD), transposase subunit (tnpA1), transposase subunit (tnpA2), transposase subunit, and putative transposase genes, complete cds Length = 12161 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2704 ccgaagccgaagccgaagccg 2684 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2698 ccgaagccgaagccgaagccg 2678 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2692 ccgaagccgaagccgaagccg 2672
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559771 ccgaagccgaagccgaagccg 1559791 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559765 ccgaagccgaagccgaagccg 1559785 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559759 ccgaagccgaagccgaagccg 1559779 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559753 ccgaagccgaagccgaagccg 1559773 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559747 ccgaagccgaagccgaagccg 1559767 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559741 ccgaagccgaagccgaagccg 1559761 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559735 ccgaagccgaagccgaagccg 1559755 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559729 ccgaagccgaagccgaagccg 1559749 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559723 ccgaagccgaagccgaagccg 1559743 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559717 ccgaagccgaagccgaagccg 1559737 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559711 ccgaagccgaagccgaagccg 1559731 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559705 ccgaagccgaagccgaagccg 1559725 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559699 ccgaagccgaagccgaagccg 1559719 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559693 ccgaagccgaagccgaagccg 1559713 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559687 ccgaagccgaagccgaagccg 1559707 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559681 ccgaagccgaagccgaagccg 1559701 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559675 ccgaagccgaagccgaagccg 1559695 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559669 ccgaagccgaagccgaagccg 1559689 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559663 ccgaagccgaagccgaagccg 1559683 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559657 ccgaagccgaagccgaagccg 1559677 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559651 ccgaagccgaagccgaagccg 1559671 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559645 ccgaagccgaagccgaagccg 1559665 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559639 ccgaagccgaagccgaagccg 1559659 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559633 ccgaagccgaagccgaagccg 1559653 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559627 ccgaagccgaagccgaagccg 1559647 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559621 ccgaagccgaagccgaagccg 1559641 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559615 ccgaagccgaagccgaagccg 1559635 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559609 ccgaagccgaagccgaagccg 1559629 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559603 ccgaagccgaagccgaagccg 1559623 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559597 ccgaagccgaagccgaagccg 1559617 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559591 ccgaagccgaagccgaagccg 1559611 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559585 ccgaagccgaagccgaagccg 1559605 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559579 ccgaagccgaagccgaagccg 1559599 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1559573 ccgaagccgaagccgaagccg 1559593
>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome Length = 5064019 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2053794 ccgaagccgaagccgaagccg 2053774 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2053788 ccgaagccgaagccgaagccg 2053768
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2533007 ccgaagccgaagccgaagccg 2532987 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2162137 ccgaagccgaagccgaagccg 2162157 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2162131 ccgaagccgaagccgaagccg 2162151 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 734584 ccgaagccgaagccgaagccg 734604 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 427368 ccgaagccgaagccgaagccg 427388 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 427362 ccgaagccgaagccgaagccg 427382 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 427356 ccgaagccgaagccgaagccg 427376 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 427350 ccgaagccgaagccgaagccg 427370 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 199728 ccgaagccgaagccgaagccg 199748 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 199722 ccgaagccgaagccgaagccg 199742 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 2533012 cgaagccgaagccgaagccg 2532993 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 2533001 ccgaagccgaagccgaagcc 2532982 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 734579 cgaagccgaagccgaagccg 734598
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3451904 ccgaagccgaagccgaagccg 3451884 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3451898 ccgaagccgaagccgaagccg 3451878 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3451892 ccgaagccgaagccgaagccg 3451872 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3451886 ccgaagccgaagccgaagccg 3451866 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3451880 ccgaagccgaagccgaagccg 3451860 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3451874 ccgaagccgaagccgaagccg 3451854 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3451868 ccgaagccgaagccgaagccg 3451848 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3451862 ccgaagccgaagccgaagccg 3451842 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2620085 ccgaagccgaagccgaagccg 2620065 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2620079 ccgaagccgaagccgaagccg 2620059 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2620073 ccgaagccgaagccgaagccg 2620053 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2620067 ccgaagccgaagccgaagccg 2620047 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2620061 ccgaagccgaagccgaagccg 2620041 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2620055 ccgaagccgaagccgaagccg 2620035 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2620049 ccgaagccgaagccgaagccg 2620029 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2620043 ccgaagccgaagccgaagccg 2620023 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2620037 ccgaagccgaagccgaagccg 2620017 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1546493 ccgaagccgaagccgaagccg 1546513 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1546487 ccgaagccgaagccgaagccg 1546507 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 931261 ccgaagccgaagccgaagccg 931281 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 931255 ccgaagccgaagccgaagccg 931275 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 931249 ccgaagccgaagccgaagccg 931269 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 931243 ccgaagccgaagccgaagccg 931263 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 931237 ccgaagccgaagccgaagccg 931257 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 931231 ccgaagccgaagccgaagccg 931251
>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29 Length = 283100 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 275026 ccgaagccgaagccgaagccg 275006 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 275020 ccgaagccgaagccgaagccg 275000 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 275014 ccgaagccgaagccgaagccg 274994 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 275008 ccgaagccgaagccgaagccg 274988 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 275002 ccgaagccgaagccgaagccg 274982 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274996 ccgaagccgaagccgaagccg 274976 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274990 ccgaagccgaagccgaagccg 274970 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274984 ccgaagccgaagccgaagccg 274964 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274978 ccgaagccgaagccgaagccg 274958 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274972 ccgaagccgaagccgaagccg 274952 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274966 ccgaagccgaagccgaagccg 274946 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274960 ccgaagccgaagccgaagccg 274940 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274954 ccgaagccgaagccgaagccg 274934 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274948 ccgaagccgaagccgaagccg 274928 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 274942 ccgaagccgaagccgaagccg 274922
>emb|AL731642.3|OSJN00289 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0014D23, complete sequence Length = 133759 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 93912 ccgaagccgaagccgaagccg 93892
>gb|AC177798.3| Mus musculus BAC clone RP24-456H11 from chromosome y, complete sequence Length = 171533 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 119964 ttagcaacaaaagaaaacacc 119944
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 Length = 4429080 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1880944 ccgaagccgaagccgaagccg 1880964
>gb|AC183416.2| Mus musculus BAC clone RP24-68E17 from chromosome y, complete sequence Length = 177325 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 102814 ttagcaacaaaagaaaacacc 102834
>gb|AC024580.6| Homo sapiens chromosome 19 clone CTD-2621I17, complete sequence Length = 193609 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 87372 ccgaagccgaagccgaagccg 87392 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 87366 ccgaagccgaagccgaagccg 87386 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 87378 ccgaagccgaagccgaagcc 87397 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 87271 ccgaagccgaagccgaagcc 87290
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 670824 ccgaagccgaagccgaagccg 670844 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 3182332 cgaagccgaagccgaagccg 3182351
>gb|AC175391.3| Mus musculus BAC clone RP24-92G16 from chromosome y, complete sequence Length = 239400 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 51341 ttagcaacaaaagaaaacacc 51321
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2125227 ccgaagccgaagccgaagccg 2125207 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2125221 ccgaagccgaagccgaagccg 2125201 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2125215 ccgaagccgaagccgaagccg 2125195 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2125209 ccgaagccgaagccgaagccg 2125189 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2125203 ccgaagccgaagccgaagccg 2125183 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2125197 ccgaagccgaagccgaagccg 2125177 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1561056 ccgaagccgaagccgaagccg 1561036 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1561050 ccgaagccgaagccgaagccg 1561030 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1561044 ccgaagccgaagccgaagccg 1561024 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1561038 ccgaagccgaagccgaagccg 1561018 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 229978 ccgaagccgaagccgaagccg 229998 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 229972 ccgaagccgaagccgaagccg 229992 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 229966 ccgaagccgaagccgaagccg 229986 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 229984 ccgaagccgaagccgaagcc 230003 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 229961 cgaagccgaagccgaagccg 229980
>gb|AC175672.2| Mus musculus BAC clone RP24-254K21 from chromosome y, complete sequence Length = 189044 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 44818 ttagcaacaaaagaaaacacc 44798
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 1214022 ccgaagccgaagccgaagccg 1214042 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 19879901 cgaagccgaagccgaagccg 19879920
>gb|AF319534.1|AF319534 Neisseria meningitidis strain Z5005 HemO (hemO) and Exl3A (exl3A) genes, complete cds Length = 2704 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 cccgaagccgaagccgaagcc 204 ||||||||||||||||||||| Sbjct: 673 cccgaagccgaagccgaagcc 693
>gb|AF319532.1|AF319532 Neisseria meningitidis strain GA0929 PqiA (pqiA) gene, partial cds; HemO (hemO) and Exl2 (exl2) genes, complete cds; Col (col) gene, partial cds; and unknown gene Length = 4403 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 cccgaagccgaagccgaagcc 204 ||||||||||||||||||||| Sbjct: 1302 cccgaagccgaagccgaagcc 1322
>gb|AF319530.1|AF319530 Neisseria meningitidis strain NMB PqiA (pqiA) gene, partial cds; HemO (hemO) gene, complete cds; and HmbR (hmbR) gene, partial cds Length = 1638 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 cccgaagccgaagccgaagcc 204 ||||||||||||||||||||| Sbjct: 1260 cccgaagccgaagccgaagcc 1280
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2052403 ccgaagccgaagccgaagccg 2052383 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2052397 ccgaagccgaagccgaagccg 2052377 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2052391 ccgaagccgaagccgaagccg 2052371 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2052385 ccgaagccgaagccgaagccg 2052365 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2052379 ccgaagccgaagccgaagccg 2052359 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2052373 ccgaagccgaagccgaagccg 2052353 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2052367 ccgaagccgaagccgaagccg 2052347 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 186 cgaagccgaagccgaagccggcga 209 ||||||||||||||| |||||||| Sbjct: 4093684 cgaagccgaagccgaggccggcga 4093661 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 2052361 ccgaagccgaagccgaagcc 2052342
>ref|NM_145722.1| Rattus norvegicus Bartomin (LOC252831), mRNA Length = 5352 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4439 ccgaagccgaagccgaagccg 4459 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4433 ccgaagccgaagccgaagccg 4453 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4427 ccgaagccgaagccgaagccg 4447 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4421 ccgaagccgaagccgaagccg 4441 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4415 ccgaagccgaagccgaagccg 4435 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4409 ccgaagccgaagccgaagccg 4429 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4403 ccgaagccgaagccgaagccg 4423
>gb|AC175709.2| Mus musculus BAC clone RP24-7D4 from chromosome y, complete sequence Length = 160976 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 ttagcaacaaaagaaaacacc 43 ||||||||||||||||||||| Sbjct: 81802 ttagcaacaaaagaaaacacc 81782
>ref|XM_580236.1| PREDICTED: Rattus norvegicus LOC502067 (LOC502067), mRNA Length = 543 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 133 ccgaagccgaagccgaagccg 153 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 139 ccgaagccgaagccgaagcc 158
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 192 cgaagccgaagccggcgacgg 212 ||||||||||||||||||||| Sbjct: 4286159 cgaagccgaagccggcgacgg 4286139 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 190 gccgaagccgaagccggcga 209 |||||||||||||||||||| Sbjct: 6093365 gccgaagccgaagccggcga 6093346
>dbj|AP006619.1| Nocardia farcinica IFM 10152 plasmid pNF1 DNA, complete sequence Length = 184026 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 183 gcccgaagccgaagccgaagc 203 ||||||||||||||||||||| Sbjct: 120407 gcccgaagccgaagccgaagc 120427
>dbj|AP003333.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1103C09 Length = 163996 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 33370 ccgaagccgaagccgaagccg 33350 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 33403 ccgaagccgaagccgaagcc 33384
>dbj|AP003253.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0451D05 Length = 148381 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 94414 ccgaagccgaagccgaagccg 94394 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 94447 ccgaagccgaagccgaagcc 94428
>dbj|AP003682.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427B07 Length = 172058 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 34442 ccgaagccgaagccgaagccg 34462
>dbj|AP004885.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0575F10 Length = 150462 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 45113 ccgaagccgaagccgaagccg 45133
>dbj|AB114606.1| Streptococcus bovis manL, manM, manN, manO, serS genes for mannose-specific phosphotransferase syste component IIAB, mannose-specific phosphotransferase system component IIC, mannose-specific phosphotransferase system component IID, hypothetical protein, seryl-tRNA synthetase, partial and complete sequence Length = 5428 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 455 gcgcatttcatcggcaagagc 475 ||||||||||||||||||||| Sbjct: 489 gcgcatttcatcggcaagagc 469
>emb|AJ937741.1| Streptomyces ambofaciens ATCC 23877 right terminal inverted repeat Length = 243019 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 94370 ccgaagccgaagccgaagccg 94350
>dbj|AK070921.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074J04, full insert sequence Length = 1015 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 659 ccgaagccgaagccgaagccg 679 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 626 ccgaagccgaagccgaagcc 645
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430310 ccgaagccgaagccgaagccg 3430290 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430304 ccgaagccgaagccgaagccg 3430284 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430298 ccgaagccgaagccgaagccg 3430278 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430292 ccgaagccgaagccgaagccg 3430272 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430286 ccgaagccgaagccgaagccg 3430266 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430280 ccgaagccgaagccgaagccg 3430260 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430274 ccgaagccgaagccgaagccg 3430254 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430268 ccgaagccgaagccgaagccg 3430248 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430262 ccgaagccgaagccgaagccg 3430242 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430256 ccgaagccgaagccgaagccg 3430236 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430250 ccgaagccgaagccgaagccg 3430230 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430244 ccgaagccgaagccgaagccg 3430224 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430238 ccgaagccgaagccgaagccg 3430218 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430232 ccgaagccgaagccgaagccg 3430212 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430226 ccgaagccgaagccgaagccg 3430206 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430220 ccgaagccgaagccgaagccg 3430200 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430214 ccgaagccgaagccgaagccg 3430194 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430208 ccgaagccgaagccgaagccg 3430188 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430202 ccgaagccgaagccgaagccg 3430182 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430196 ccgaagccgaagccgaagccg 3430176 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 3430190 ccgaagccgaagccgaagccg 3430170 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2488108 ccgaagccgaagccgaagccg 2488128 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2488102 ccgaagccgaagccgaagccg 2488122 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2488096 ccgaagccgaagccgaagccg 2488116 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2488090 ccgaagccgaagccgaagccg 2488110 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 3430184 ccgaagccgaagccgaagcc 3430165 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 2488114 ccgaagccgaagccgaagcc 2488133
>dbj|AK065876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013047J07, full insert sequence Length = 3499 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 17 ccgaagccgaagccgaagccg 37
>dbj|AK064665.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-B07, full insert sequence Length = 1424 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 16 ccgaagccgaagccgaagccg 36
>emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E (5 of 5) Length = 2199546 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 849001 ccgaagccgaagccgaagccg 849021
>emb|AJ937740.1| Streptomyces ambofaciens ATCC 23877 left terminal inverted repeat Length = 273746 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 94370 ccgaagccgaagccgaagccg 94350
>gb|AY961445.1| Phytophthora infestans clone PH019E7 low complexity protein mRNA, complete cds Length = 535 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 gcccgaagccgaagccgaagc 203 ||||||||||||||||||||| Sbjct: 399 gcccgaagccgaagccgaagc 379
>gb|AY961443.1| Phytophthora infestans clone PL003F1 low complexity protein mRNA, complete cds Length = 570 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 gcccgaagccgaagccgaagc 203 ||||||||||||||||||||| Sbjct: 397 gcccgaagccgaagccgaagc 377
>gb|AY961439.1| Phytophthora infestans clone PD011B9 HAM34-like putative membrane protein mRNA, complete cds Length = 647 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 gcccgaagccgaagccgaagc 203 ||||||||||||||||||||| Sbjct: 431 gcccgaagccgaagccgaagc 411
>gb|AY961416.1| Phytophthora infestans clone MY-10-B-05 HAM34-like putative membrane protein mRNA, complete cds Length = 592 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 183 gcccgaagccgaagccgaagc 203 ||||||||||||||||||||| Sbjct: 395 gcccgaagccgaagccgaagc 375
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 2049091 ccgaagccgaagccgaagccg 2049071 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 2554551 ccgaagccgaagccgaagcc 2554532
>gb|L20696.1|LILMEIOTIN Lilium longiflorum meiotin-1 mRNA, complete cds Length = 1317 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccgg 206 ||||||||||||||||||||| Sbjct: 784 cgaagccgaagccgaagccgg 804
>dbj|AB050509.1| Macaca fascicularis brain cDNA, clone:QnpA-13140 Length = 2535 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 cccgaagccgaagccgaagcc 204 ||||||||||||||||||||| Sbjct: 372 cccgaagccgaagccgaagcc 392 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 18 ccgaagccgaagccgaagcc 37
>gb|U02467.1|LLU02467 Lilium longiflorum Enchantment meiotin-1 mRNA, partial cds Length = 902 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccgg 206 ||||||||||||||||||||| Sbjct: 690 cgaagccgaagccgaagccgg 710 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccgg 206 ||||||||||||||||||||| Sbjct: 645 cgaagccgaagccgaagccgg 665
>dbj|AB077475.1| Rattus norvegicus mRNA for barmotin, complete cds Length = 5352 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4439 ccgaagccgaagccgaagccg 4459 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4433 ccgaagccgaagccgaagccg 4453 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4427 ccgaagccgaagccgaagccg 4447 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4421 ccgaagccgaagccgaagccg 4441 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4415 ccgaagccgaagccgaagccg 4435 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4409 ccgaagccgaagccgaagccg 4429 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagccg 205 ||||||||||||||||||||| Sbjct: 4403 ccgaagccgaagccgaagccg 4423
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome Length = 3997420 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 184 cccgaagccgaagccgaagccggc 207 |||||||||||||||| ||||||| Sbjct: 2791028 cccgaagccgaagccggagccggc 2791005
>ref|NM_191195.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1914 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 180 agggcccgaagccgaagccgaagc 203 |||| ||||||||||||||||||| Sbjct: 695 aggggccgaagccgaagccgaagc 718
>gb|U29382.1| Caenorhabditis elegans cosmid R03H10, complete sequence Length = 35080 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 4857 ccgaagccgaagccgaagcc 4838
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 1124856 ccgaagccgaagccgaagcc 1124875
>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome Length = 3814139 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 189 agccgaagccgaagccggcg 208 |||||||||||||||||||| Sbjct: 2736082 agccgaagccgaagccggcg 2736063
>gb|AF016429.1| Caenorhabditis elegans cosmid T21H3, complete sequence Length = 38092 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 20013 ccgaagccgaagccgaagcc 20032
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 487088 ccgaagccgaagccgaagcc 487107
>emb|Z34800.1|CEF45H7 Caenorhabditis elegans Cosmid F45H7, complete sequence Length = 39580 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 3955 ccgaagccgaagccgaagcc 3936 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 3925 ccgaagccgaagccgaagcc 3906
>emb|CR718834.2|CNS0GHLK Tetraodon nigroviridis full-length cDNA Length = 805 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 514 ggccatcgccgtcctcttcg 533 |||||||||||||||||||| Sbjct: 440 ggccatcgccgtcctcttcg 421
>emb|CR691174.2|CNS0FW9E Tetraodon nigroviridis full-length cDNA Length = 1728 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 514 ggccatcgccgtcctcttcg 533 |||||||||||||||||||| Sbjct: 502 ggccatcgccgtcctcttcg 483
>gb|AC019210.7| Homo sapiens BAC clone RP11-449G3 from 7, complete sequence Length = 177402 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 attagcaacaaaagaaaaca 41 |||||||||||||||||||| Sbjct: 124314 attagcaacaaaagaaaaca 124333
>gb|AC011228.9| Homo sapiens BAC clone GS1-18A18 from 7, complete sequence Length = 163782 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 attagcaacaaaagaaaaca 41 |||||||||||||||||||| Sbjct: 125820 attagcaacaaaagaaaaca 125839
>ref|XM_775289.1| PREDICTED: Strongylocentrotus purpuratus similar to SMAD specific E3 ubiquitin protein ligase 2 (LOC574887), mRNA Length = 1812 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 436 ccgtgaccttcacatcaacg 455 |||||||||||||||||||| Sbjct: 378 ccgtgaccttcacatcaacg 397
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 190 gccgaagccgaagccggcga 209 |||||||||||||||||||| Sbjct: 4551991 gccgaagccgaagccggcga 4552010
>gb|AY118620.1| Drosophila melanogaster LP11788 full insert cDNA Length = 4704 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 530 ttcgatggccaccgcctcta 549 |||||||||||||||||||| Sbjct: 3936 ttcgatggccaccgcctcta 3917
>dbj|AK122767.1| Homo sapiens cDNA FLJ16306 fis, clone PUAEN2003954, highly similar to Homo sapiens mitogen-activated protein kinase-activated protein kinase 5 Length = 2527 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 328 cgaagccgaagccgaagccg 309
>dbj|AK096935.1| Homo sapiens cDNA FLJ39616 fis, clone SMINT2000541 Length = 2285 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 598 cgaagccgaagccgaagccg 617
>ref|NM_143313.1| Drosophila melanogaster CG5639-RA (CG5639), mRNA Length = 4849 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 530 ttcgatggccaccgcctcta 549 |||||||||||||||||||| Sbjct: 4011 ttcgatggccaccgcctcta 3992
>ref|NM_137181.1| Drosophila melanogaster PS4 CG16827-RA (alphaPS4), mRNA Length = 3048 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 141 ccaccaccgcgcaatcctcg 160 |||||||||||||||||||| Sbjct: 1669 ccaccaccgcgcaatcctcg 1650
>dbj|AK139555.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library, clone:B020004H18 product:RNA binding motif protein 9, full insert sequence Length = 2132 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 gaagccgaagccgaagccgg 206 |||||||||||||||||||| Sbjct: 347 gaagccgaagccgaagccgg 366
>gb|U33548.2|XCU33548 Xanthomonas campestris pv. vesicatoria hrp gene cluster, partial sequence Length = 16929 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 9500 ccgaagccgaagccgaagcc 9519
>gb|DQ250640.1| Zea mays plastid coproporphyrinogen III oxidase (cpx1) mRNA, complete cds; nuclear gene for plastid product Length = 1645 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 364 cgaagccgaagccgaagccg 345
>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome Length = 2839318 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 532 cgatggccaccgcctctacc 551 |||||||||||||||||||| Sbjct: 488870 cgatggccaccgcctctacc 488851
>gb|BC023547.2| Homo sapiens chromosome 12 open reading frame 47, mRNA (cDNA clone IMAGE:4110415) Length = 1954 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 249 cgaagccgaagccgaagccg 268
>dbj|AK077594.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730462H23 product:fox-1 homolog (C. elegans), full insert sequence Length = 3559 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 gaagccgaagccgaagccgg 206 |||||||||||||||||||| Sbjct: 222 gaagccgaagccgaagccgg 241
>gb|AF320027.1|AF320027 Sorghum bicolor heme oxygenase 2 (HO2) mRNA, partial cds; nuclear gene for chloroplast product Length = 1444 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 191 cgaagccgaagccgaagccg 210
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 196 gccgaagccggcgacggtca 215 |||||||||||||||||||| Sbjct: 273819 gccgaagccggcgacggtca 273838
>gb|BT023104.1| Drosophila melanogaster IP03724 full insert cDNA Length = 2049 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 141 ccaccaccgcgcaatcctcg 160 |||||||||||||||||||| Sbjct: 515 ccaccaccgcgcaatcctcg 496
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 10251595 ccgaagccgaagccgaagcc 10251614
>gb|AC008342.12|AC008342 Drosophila melanogaster, chromosome 2R, region 51F-51F, BAC clone BACR33K06, complete sequence Length = 175007 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 141 ccaccaccgcgcaatcctcg 160 |||||||||||||||||||| Sbjct: 66099 ccaccaccgcgcaatcctcg 66080
>gb|AC007817.7|AC007817 Drosophila melanogaster, chromosome 3R, region 98A-98B, BAC clone BACR15D01, complete sequence Length = 180499 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 530 ttcgatggccaccgcctcta 549 |||||||||||||||||||| Sbjct: 101848 ttcgatggccaccgcctcta 101867
>gb|AC003029.5| Homo sapiens 12 PAC RP3-462E2 (Roswell Park Cancer institute Human PAC Library) complete sequence Length = 137830 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 51087 cgaagccgaagccgaagccg 51068
>dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0481E12 Length = 161563 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 180 agggcccgaagccgaagccgaagc 203 |||| ||||||||||||||||||| Sbjct: 25324 aggggccgaagccgaagccgaagc 25301
>gb|AC025716.2| Caenorhabditis elegans cosmid Y39G10AR, complete sequence Length = 132558 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 48030 ccgaagccgaagccgaagcc 48011
>dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0508B05 Length = 166165 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 57502 cgaagccgaagccgaagccg 57521
>dbj|AP004650.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1540_G08 Length = 126263 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 57618 ccgaagccgaagccgaagcc 57637
>dbj|AK110860.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-172-D05, full insert sequence Length = 1629 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 ccgaagccgaagccgaagcc 204 |||||||||||||||||||| Sbjct: 255 ccgaagccgaagccgaagcc 274
>dbj|AK102467.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094F14, full insert sequence Length = 2636 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 180 agggcccgaagccgaagccgaagc 203 |||| ||||||||||||||||||| Sbjct: 1188 aggggccgaagccgaagccgaagc 1211
>gb|BC041049.1| Homo sapiens mitogen-activated protein kinase-activated protein kinase 5, transcript variant 1, mRNA (cDNA clone MGC:52129 IMAGE:4909021), complete cds Length = 2024 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 cgaagccgaagccgaagccg 205 |||||||||||||||||||| Sbjct: 65 cgaagccgaagccgaagccg 46
>gb|AE003761.2| Drosophila melanogaster chromosome 3R, section 99 of 118 of the complete sequence Length = 224910 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 530 ttcgatggccaccgcctcta 549 |||||||||||||||||||| Sbjct: 151034 ttcgatggccaccgcctcta 151053
>gb|AE003811.3| Drosophila melanogaster chromosome 2R, section 39 of 73 of the complete sequence Length = 255652 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 141 ccaccaccgcgcaatcctcg 160 |||||||||||||||||||| Sbjct: 107601 ccaccaccgcgcaatcctcg 107582
>ref|NM_053104.3| Mus musculus RNA binding motif protein 9 (Rbm9), transcript variant 1, mRNA Length = 3559 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 gaagccgaagccgaagccgg 206 |||||||||||||||||||| Sbjct: 222 gaagccgaagccgaagccgg 241
>dbj|AP004982.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT04L20, TM0437a, complete sequence Length = 48314 Score = 40.1 bits (20), Expect = 7.7 Identities = 35/40 (87%) Strand = Plus / Minus Query: 495 gggacttcacctggatccaggccatcgccgtcctcttcga 534 |||||||||||||| |||| ||||||| |||||||||| Sbjct: 25999 gggacttcacctgggtccaatccatcgctatcctcttcga 25960
>emb|AL772386.4| Mouse DNA sequence from clone RP23-89G22 on chromosome 15, complete sequence Length = 149807 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 gaagccgaagccgaagccgg 206 |||||||||||||||||||| Sbjct: 117840 gaagccgaagccgaagccgg 117859 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,936,526 Number of Sequences: 3902068 Number of extensions: 3936526 Number of successful extensions: 83238 Number of sequences better than 10.0: 148 Number of HSP's better than 10.0 without gapping: 154 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 79691 Number of HSP's gapped (non-prelim): 3443 length of query: 569 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 546 effective length of database: 17,143,297,704 effective search space: 9360240546384 effective search space used: 9360240546384 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
